Cloning Vector Research Articles

First Report of Cotton Leafroll Dwarf Virus Infecting Cotton in Georgia, U.S.A.

During the 2018 growing season, cotton plants in several fields in Georgia were observed with symptoms that included leaf curling, reddening and drooping of leaves, subsequent distortion of leaf growth above the nodes where reddened leaves were first observed, and shortening of upper internodes and their discoloration to deep green. These symptoms were visible in the upper portion of the plants, resembling “cotton blue” disease caused by cotton leafroll dwarf virus (CLRDV) (family Luteoviridae, genus Polerovirus). The symptoms were observed sporadically with less than 10% disease incidence within affected fields. CLRDV is a phloem-limited virus with single-stranded, positive-sense RNA genome, transmitted by aphids (Aphis gossypii) in a persistent, circulative, nonpropagative manner (Distefano et al. 2010; Sharman et al. 2015). A total of 93 symptomatic and asymptomatic leaves and petioles were collected from several different commercial cotton fields in the southern part of the state. Total RNA was extracted using the modified cetyltrimethylammonium bromide method (Sharman et al. 2015). Complementary DNA (cDNA) was synthesized from 2.5 µg of total RNA using Superscript III reverse transcription (Invitrogen, U.S.A.) and specific reverse primers targeting different open reading frames (ORFs) of the virus genome. The cDNA was used for polymerase chain reaction (PCR) with primers CLRDV3675F and Pol3982R targeting ORF 3 of the virus (310-bp product, Sharman et al. 2015) and primers 17 and 18 targeting ORF 5 (1,065-bp product, Distefano et al. 2010). A new set of primers, SB11F (5′-AGGTTTTCTGGTAGCAGTACCAATATCAACGTTA-3′) and SB11R (5′-TATCTTGCATTGTGGATTTCCCTCATAA-3′), was developed to amplify the 803-bp fragment spanning complete ORF 3 and ORF 4, encoding virus coat protein and movement protein genes. Using the three different sets of primers, products of predicted sizes were amplified from the symptomatic tissues, but not from asymptomatic tissues collected from fields and negative controls including asymptomatic leaves from plants grown in an insect-free controlled growth chamber and DNase/RNase free water (Invitrogen). Reverse transcription PCR products were gel purified, cloned into TOPO-TA cloning vector (Invitrogen), and sequenced using Sanger sequencing (GeneScript, NJ). The consensus sequence of three clones for ORF 3 and 4 from this study (MK290759 and MK290760) when analyzed using NCBI-BLASTn showed 97% sequence identity with the Brazilian and Argentinean isolates (KF906261.1 and KF359947.1, respectively) and many other isolates from South American and Asian countries. ORF 3 and 4 sequences from Georgia shared 98 to 99% identity among themselves. The partial sequences for ORF 5 (MK513938 and MK513939) shared 95% identity with the isolate from Argentina (KF359946.1 and KF359947.1). The presence of the virus was detected in all the symptomatic samples collected from 14 counties in Georgia, covering the entire cotton growing region of the state. To the best of our knowledge, this is the first report of CLRDV in Georgia, U.S.A. CLRDV infection of cotton has been reported in other cotton-growing regions in Africa, Asia, South America, and, more recently, in Alabama, U.S.A. (Avelar et al. 2018; Correa et al. 2005; Distefano et al. 2010; Mukherjee et al. 2012). With its rapid spread, this virus could pose an imminent threat and cause severe economic losses to the cotton industry. Further research is needed to elucidate epidemiology, symptomatology, vector transmission, and crop losses owing to CLRDV in the United States.

Generation of PK-15 cell lines highly permissive to porcine circovirus 2 infection by transposon-mediated interferon-gamma gene transfer

Porcine circovirus 2 (PCV2)-associated diseases affect the swine industry worldwide. Vaccination is the major tool for the disease control, but the vaccine production is hindered by lower propagation rate of PCV2 in vitro. Previous studies showed that interferons (IFNs) can increase PCV2 yield in PK-15 cells. In the present study, we constructed a Sleepy Beauty (SB) transposon vector expressing porcine IFNg gene fused with the coding sequence for immunoglobulin G Fc domain. After dilution cloning, the transposon and transposase vectors were co-transfected into PK-15 cell clones with higher permissivity to PCV2 infection. Two transgenic PK-15 cell lines, namely PK15-IFNgRan and PK15-IFNgSB which contained randomly integrated transfer vector or SB cassette without selection marker, were screened by PCR analysis. The characterization results demonstrated that the two transgenic cell lines can stably express IFNg-Fc fusion protein with potent antiviral activities. Both viral titration and quantitative PCR analyses showed that the two transgenic cell lines are highly permissive to PCV2 infection with significantly increased viral yields. These results indicate that the two transgenic PK-15 cell lines, PK15-IFNgSB in particular, can be used for PCV2 vaccine development.

Variability in the immunogenic preS region of Pakistani hepatitis B virus isolates.

This paper reports the genetic variability of hepatitis B virus in Pakistan population. The worldwide prevalence of hepatitis B virus is estimated to be around 350 million that causes significant mortality especially in developing countries like Pakistan. In this study, genetic diversity of HBV was checked by using preS domain of HBV. About seventy-five samples were selected for study. Among these samples nine samples showed positive results after PCR and gel analysis. These nine samples were named SBS001-SBS008. After gel purification these samples were ligated in T/A cloning vector and transformed with E. coli DH5α. After successful cloning and positive restriction analysis these samples were subjected to DNA sequencing. Sequencing results showed that eight samples (SBS002-SBS008) have a deletion of 33 nucleotides at N-terminal that is characteristics of genotype D while SBS001 belongs to genotype C. Silent mutations and amino acid changes were also searched in this highly variable region of genome. Based upon this study it was concluded that genotype D is the most common genotype in Pakistan.

Construction, Expression, and Purification of p28 as a Cell-Penetrating Peptide ‎with Anticancer Effects on Burkitt’s Lymphoma Cell Line

Background: The p28 is a small-sized cell-penetrating peptide derived from bacterial protein azurin and can function as a cancer-specific anti-proliferative agent. It can penetrate cancer tissues easily without involving the immune system, and increase the intracellular concentration of p53. Objectives: In this study, we have expressed and purified recombinant p28, then evaluated its anti-proliferative and pro-apoptotic effects on Raji cancer cell line. Methods: The p28 gene was amplified and cloned into pTZ57R cloning vector and was sequenced subsequently. Afterward, it was transformed into E. coli BL21 bacterial host by using pET-28a expression vector. Peptide purification was carried out using Ni-NTA ‎chromatography system. Bradford, SDS-PAGE, and western blotting assays were applied to assess the concentration and expression level of the recombinant peptide. The proficiency ‎of p28 in inhibition of tumor growth and induction of apoptosis in cancerous cells was investigated by evaluating the Raji and HEK-293 cells treated with different concentrations of p28. Results: The overexpression of the p28 peptide in the bacterial host was confirmed by SDS-PAGE and western blotting. Moreover, Bradford assay revealed desirable concentrations of the recombinant p28 before and after dialysis. The MTT and PE-Annexin V apoptosis assays indicated the specific function of p28 in impeding the proliferation of cancerous cells and triggering the apoptosis. Conclusions: The p28 induces apoptosis in cancerous cells but not in normal control cells. ‎In summary, p28 is a non-immunogenic small peptide that can penetrate cancerous cells ‎preferentially, impede the cell proliferation, and induce the apoptosis. Overall, these ‎findings suggest p28 as‎ a promising anticancer drug.

Ultrafast, low-power, PCB manufacturable, continuous-flow microdevice for DNA amplification.

The design and fabrication of a continuous-flow μPCR device with very short amplification time and low power consumption are presented. Commercially available, 4-layer printed circuit board (PCB) substrates are employed, with in-house designed yet industrially manufactured embedded Cu micro-resistive heaters lying at very close distance from the microfluidic network, where DNA amplification takes place. The 1.9-m-long microchannel in combination with desirably high flow velocities (for fast amplification) challenged the robustness of the sealing that was overcome with the development of a novel bonding method rendering the microdevice robust even at extreme pressure drops (12 bars). The proposed fabrication methods are PCB compatible, allowing for mass and reliable production of the μPCR device in the established PCB industry. The μPCR chip was successfully validated during the amplification of two different DNA fragments (and with different target DNA copies) corresponding to the exon 20 of the BRCA1 gene, and to the plasmid pBR322, a commonly used cloning vector in E. coli. Successful DNA amplification was demonstrated at total reaction times down to 2min, with a power consumption of 2.7W, rendering the presented μPCR one of the fastest and lowest power-consuming devices, suitable for implementation in low-resource settings. Detailed numerical calculations of the DNA residence time distributions, within an acceptable temperature range for denaturation, annealing, and extension, performed for the first time in the literature, provide useful information regarding the actual on-chip PCR protocol and justify the maximum volumetric flow rate for successful DNA amplification. The calculations indicate that the shortest amplification time is achieved when the device is operated at its enzyme kinetic limit (i.e., extension rate). Graphical abstract.

Engineering a Minimal Cloning Vector from a pUC18 Plasmid Backbone with an Extended Multiple Cloning Site

Minimal plasmids play an essential role in many intermediate steps in molecular biology. For example, they can be used to assemble building blocks in synthetic biology or be used as intermediate cloning plasmids that are ideal for PCR-based mutagenesis methods. A small backbone also opens up for additional unique restriction enzyme cloning sites. Here we describe the generation of pICOz, a 1185-bp fully functional high-copy cloning plasmid with an extended multiple cloning site. We believe that this is the smallest high-copy cloning vector ever described.

Construction of recombinant sox2-encoding plasmids that regulate pluripotency of breast cancer stem cells from indonesian patient

A therapy development with recombinant protein is a new and potential innovation to destroy cancer stem cells (CSCs). Various ways of killing CSCs include the provision of polyvalent anti-protein antibodies that code pluripotency. Therefore, it takes a mixture of Oct-4, c-Myc, Sox2, and Klf4 protein antigens that can stimulate the formation of polyvalent antibodies. This study aimed to construct Sox2 recombinant by identifying the target genes by reverse transcriptase PCR and then arranging their designs to be inserted into the cloning vector pET101/D-TOPO®. The target gene was developed by finding the complete sequences of Sox2 nucleotides on the NCBI GenBank. The growth on LB-ampicillin agar plates was amplified by PCR to obtain colonies with pET101/D-TOPO® vectors and inserts of the pluripotent gene of CSCs, then the PCR results were observed through electrophoresis. A total of fifteen colonies have DNA bands with a base pair of about 300 bp in length. The recombinant clones produced Sox2 genes with a base length of 330 bp.

Preparation and purification of DNA from bacterial cells; characterization of plasmid DNA

The use of genetic material to deliver genes for therapeutic purposes has been practiced for many years. With the advancement in genetic engineering, foreign genes of industrial applications can be inserted into cloning vector for mass production in various host cells. Escherichia coli is an extremely important model organism in modern biological engineering, the suitable growth media is essential for the optimal expression of the genes in E. coli . The present study aims at isolation and purification of genomic DNA from E. coli , the characterization of pBR322 plasmid DNA. Bacterial culture conditions were optimized in shake – flask cultures based on optimal temperature, inoculum size and medium composition. Solutions and methods are disclosed for the effective, simple isolation of DNA from bacterial cells. High bioprocess recovery and product quality were primarily associated with the complete removal of total cellular RNA impurity. The process was demonstrated without the use of animal-derived RNase. High-molecular-weight (HMW) RNA and other impurities were removed by selective precipitation using calcium chloride at an optimal concentration. The optimal conditions for the growth of Escherichia coli were shown maximum absorbance as 7.5 at 37 0 C temperature, 1% inoculum size using TB medium composition. The purified genomic DNA had concentration as 73.5 µg/ml and purity 1.8. The 0.5M CaCl 2 was optimal concentration for removal of RNA. The plasmid DNA pBR322 was confirmed by comparing the band to 4.36 Kb, purity of plasmid was 1.85 and it contains 96.8% of super coiled DNA. The contaminants like chromosomal DNA, RNA, host cell proteins and mycoplasma were absent in the plasmid DNA.

Analysis of Nucleotide Alterations in the E6 Genomic Region of Human Papillomavirus Types 6 and 11 in Condyloma Acuminatum Samples from Brazil.

Condyloma acuminata (CA), or genital warts, are benign proliferative epidermal or mucous lesions that are caused by infection with human papillomavirus (HPV), mainly the low-risk types 6 and 11. HPV variants are defined as viral sequences that share identity in the nucleotide sequence of the L1 gene greater than 98%. Based on this criterion, HPV6 and 11 variant lineages have been studied, and there are ongoing attempts to correlate these genetic variants with different clinical findings of infection. Therefore, the aims of this study were to detect variants and nucleotide alterations present in the E6 regions of HPV types 6 and 11 found in CA samples, to correlate the HPV presence with the clinical-pathological data of the patients, and to determine phylogenetic relationships with variants from other places in the world. The E6 regions of 25 HPV6 samples and 7 HPV11 samples from CA were amplified using PCR with specific primers. The products were ligated to a cloning vector and five colonies of each sample were sequenced to observe the nucleotide alterations. Twelve samples were identified as the HPV6B3 variant, presenting the mutation (guanine) G474A (adenine), and one of them also showed the mutation (thymine) T369G. The other 13 patients were positive for HPV6B1 without nucleotide alterations. In the analysis of the HPV11 samples, all patients showed the mutations T137C and (cytosine) C380T. One patient also presented the nucleotide alteration T410C. None of the mutations found in the 32 analyzed samples resulted in amino acid changes. Patient age, local occurrence, and HIV infection did not show significant association with HPV infection. Besides, the data found in this study did not show a relationship with the geographical region of isolation when compared to other data from different regions of the world. In this way, despite the nucleotide alterations found, it was not possible to observe amino acid changes and variants grouping according to geographical region.

A substitution in the pre-S1 promoter region is associated with the viral regulation of hepatitis B virus

BackgroundMuch evidence has demonstrated the influence of Hepatitis B virus (HBV) mutations on the clinical course of HBV infection. As large (L) protein plays a crucial role for viral entry, we hypothesized that mutations in the pre-S1 promoter region might affect the expression of L protein and subsequently change the biological characters of virus.MethodsPatients infected with genotype C HBV were enrolled for analysis. HBV DNA sequences were inserted into a TA cloning vector and analyzed. To evaluate the effects of mutations in the pre-S1 promoter region, promoter activity and the expression of mRNA and L protein were analyzed using HepG2 cells.ResultsIn total, 35 patients were enrolled and 13 patients (37.1%) had a single base substitution in the pre-S1 promoter region; the most frequent substitution was a G-to-A substitution at the 2765th base (G2765A) in the Sp1 region. The HBV viral load showed a negative correlation with the substitution ratio of the Sp1 region or G2765A (r = − 0.493 and − 0.473, respectively). Among those with a viral load ≤5.0 log IU/ml, patients with the G2765A substitution showed a significantly lower HBV viral load than those with the wild-type sequence. HepG2 cells transfected with the G2765A substitution vector showed reduced luciferase activity of the pre-S1 promoter, as well as reduced expression of pre-S1 mRNA and L protein. Furthermore, the G2765A substitution greatly reduced the L protein expression level of vector-produced virus particles.ConclusionG2765A substitution in the pre-S1 promoter reduced the expression of L protein and resulted in a low viral load and less severe disease in chronic HBV infections.

Vaccine potential of LenA and LcpA proteins of Leptospira interrogans in combination with Escherichia coli heat-labile enterotoxin, B subunit (LTB)

Leptospirosis is a zooanthroponosis caused by the genus of Leptospira. It is an emerging public health problem due to its increasing incidence. The achievement to a vaccine that prevent from entrance of Leptospira interrogans to the deeper tissues of the host is needed. This study aimed to investigate the immunogenicity of LcpA (rLcpA) and LenA (rLenA) recombinant proteins in combination with LTB (rLTB) recombinant protein as an adjuvant against leptospiral infection in hamsters. The genes encoding these proteins were cloned into pGH cloning vector and then lenA, lcpA and ltb genes subcloned into pET-15b and pET-28a expression vectors, respectively. The hamsters were immunized with the purified recombinant proteins and challenged with Leptospira interrogans for evaluation of their survival. The antibody responses to the recombinant proteins were determined by ELISA. Then, data entered into SPSS software. Statistical Kruskal-Wallis test was used to compare the significant differences among different groups. The groups with significant differences were further analyzed by post hoc tests. The p value < 0.05 statistically was considered significant. Immunized hamsters with rLenA-plus-rLTB, rLcpA-plus-rLTB and rLenA-plus-rLcpA-plus-rLTB proteins showed 60%, 74%, and 80% survival rates, respectively. A significant amount of interleukin-17 (IL-17), interleukin-4 (IL-4) and gamma interferon (IFNγ) cytokines were produced in immunized hamsters. Based on our findings, rLcpA and rLenA proteins in combination with rLTB can protect the hamsters against L. interrogans and effectively induce a protective antibody response. Thus, these proteins can be used as an additional prophylactic tool against leptospira.

A novel series of high-efficiency vectors for TA cloning and blunt-end cloning of PCR products

An efficient PCR cloning method is indispensable in modern molecular biology, as it can greatly improve the efficiency of DNA cloning processes. Here, I describe the development of three vectors for TA cloning and blunt-end cloning. Specifically, pCRT and pCRZeroT were designed to improve the efficiency of TA cloning. pCRZeroT can also be used with pCRZero to facilitate blunt-end cloning using the ccdB gene. Using pCRZero and pCRZeroT and applying the Golden Gate reaction, I developed a direct PCR cloning protocol with non-digested circular vectors and PCR products. This direct PCR cloning protocol yielded colony-formation rates and cloning efficiencies that are comparable with those obtained by conventional PCR cloning with pre-digested vectors and PCR products. The three plasmids I designed are available from Addgene (https://www.addgene.org/).

A new vector coupling ligation-independent cloning with sortase a fusion for efficient cloning and one-step purification of tag-free recombinant proteins

We have developed a new ligation independent cloning (LIC) vector – pSrtA9, which can be utilized for one-step purification of recombinant proteins. The new LIC site in the pSrtA9 vector, hosts a DNA sequence centered on a SfoI restriction site and integrates a coding sequence for sortase A (SrtA) recognition. Preceding the LIC site, pSrtA9 incorporates an N-terminal 6xHis-tag and the catalytic core of SrtA from Staphylococcus aureus (SrtAΔ59). Thus, after cloning and protein expression in Escherichia coli, the resultant fusion protein comprises an N-terminal 6xHis-tag, SrtAΔ59, an L-P-E-T-G linker and the protein of interest at the C-terminus. The fusion protein can be captured onto immobilized Ni-NTA resin and any unwanted proteolysis activity of SrtA is suppressed during the purification by optimisation of solution conditions. Upon addition of Ca2+ and triglycine (Gly3), the immobilized fusion protein undergoes on-column SrtA-mediated cleavage at the T-G bond of LPETG linker to selectively release 90% of the protein of interest within 3 h when incubated at room temperature. This new pSrtA9 vector, thus, offers an efficient method for LIC of genes and a one-step purification procedure to obtain a tag-free recombinant protein, and is therefore suitable for the high-throughput proteins production.

Piperacillin-Tazobactam (TZP) Resistance in Escherichia coli Due to Hyperproduction of TEM-1 β-Lactamase Mediated by the Promoter Pa/Pb.

TEM-1, mediated by plasmid and transposon, is the most commonly encountered β-lactamase in Gram-negative bacteria. Four different promoters upstream of blaTEM-related genes have been identified: the weak P3 promoter, and the strong promoters Pa/Pb, P4, and P5. In this study, we investigated the genetic basis of a clinical strain of Escherichia coli (RJ904), which was found to be resistant to BLBLIs (β-lactam/β-lactamase inhibitors), including amoxicillin-clavulanate, ticarcillin-clavulanate (TCC), and piperacillin-tazobactam (TZP) but sensitive to third-generation cephalosporins. The conjugation test and S1-nuclease pulsed-field gel electrophoresis (S1-PFGE) demonstrated that transfer of this resistance was mediated by a ca. 100 kb plasmid. The transformant with TZP resistance was screened out with the shortgun cloning. Sequence analysis revealed that the recombinant plasmid contained a blaTEM-1b gene with the strong promoter Pa/Pb. Different plasmids were cloned based on the clone vector pACYC184 with the insertion of the blaTEM-1b gene with promoters Pa/Pb or P3. Susceptibility to TZP was determined by the E-test, agar dilution, and broth microdilution. The level of blaTEM-1b-specific transcription was determined by quantitative real-time PCR. Substitution of Pa/Pb for P3 resulted in a 128-fold decline of the MIC value of TZP, from >1024 mg/L to 8 mg/L, and a significantly lower blaTEM-1b expression level. Hyperproduction of TEM-1 β-lactamase mediated by the promoter Pa/Pb was responsible for high resistance to TZP in E. coli. Our data show possible risks of resistance development in association with the clinical use of TZP. The blaTEM promoter modifications should be considered for whole genome whole-genome sequencing-inferred bacterial antimicrobial susceptibility testing.

Identifying ErbB Proteins as Potential Receptors for Nephronectin during Mouse Corneal Development

Corneal defects are a major cause of blindness, but treatment options remain limited. Advancements require improved understanding of molecular processes involved in corneal development. Corneal development is an intricate process that involves migration, proliferation, and differentiation of embryonic neural stem cells known as neural crest cells. However, very little is known about the molecular mechanisms involved in these processes. Our recent studies identified Nephronectin, an extracellular matrix protein, in the developing cornea. The current study is to determine whether Nephronectin signals through ErbB proteins (ErbB1, ErbB2, ErbB3) during corneal development. To test the hypothesis that neural crest cells co‐localize and interact with nephronectin through ErbB proteins during corneal development, we first isolated cDNA from corneal tissues, then identified the expression of the ErbB genes by reverse transcription polymerase chain reaction (RT‐PCR), and finally determined their localization by in situ hybridization. Our initial analysis by RT‐PCR indicates that ErbB1 is highly expressed during corneal development. Next, we synthesized RNA probes using a cloning vector to analyze their spatial expression on paraffin‐embedded embryonic corneal sections. Our preliminary analyses showed that ErbB1 is expressed in the presumptive corneal stroma and epithelium, suggesting a potential role of Nephronectin/ErbB1 signaling during cell migration, proliferation, or differentiation into corneal cells. Additionally, ErbB2 and ERbB3 are expressed in the epithelium, indicating a role in proliferation. Identifying signaling pathways that govern corneal development can lead to better strategies to repair corneal defects.Support or Funding InformationResearch reported in this abstract was supported by the National Institute Of General Medical Sciences of the National Institutes of Health under linked Award Numbers RL5GM118969, TL4GM118971, and UL1GM118970. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.This abstract is from the Experimental Biology 2019 Meeting. There is no full text article associated with this abstract published in The FASEB Journal.

Short-Homology-Mediated CRISPR/Cas9-Based Method for Genome Editing in Fission Yeast

The CRISPR/Cas9 system enables the editing of genomes of numerous organisms through the induction of the double-strand breaks (DSB) at specific chromosomal targets. We improved the CRISPR/Cas9 system to ease the direct introduction of a point mutation or a tagging sequence into the chromosome by combining it with the noncanonical homology-directed DNA repair (HDR) based genome editing in fission yeast. We constructed convenient cloning vectors, which possessed a guide RNA (gRNA) expression module, or the humanized Streptococcus pyogenes Cas9 gene that is expressed under the control of an inducible promoter to avoid the needless expression, or both a gRNA and Cas9 gene. Using this system, we attempted the short-homology-mediated genome editing and found that the HDR pathway provides high-frequency genome editing at target loci without the need of a long donor DNA. Using short oligonucleotides, we successfully introduced point mutations into two target genes at high frequency. We also precisely integrated the sequences for epitope and GFP tagging using donor DNA possessing short homology into the target loci, which enabled us to obtain cells expressing N-terminally tagged fusion proteins. This system could expedite genome editing in fission yeast, and could be applicable to other organisms.

First Report of Onion Yellow Dwarf Virus on Shallot (Allium cepa var. aggregatum) in China

Allium species are economically important crops in the world. Viruses are among the most important pathogens affecting their yield, especially those belonging to the genera Potyvirus, Carlavirus, and Allexivirus (Katis et al. 2012). Members of the genus Potyvirus are usually the most abundant and cause most of the damage induced. Onion yellow dwarf virus (OYDV) and Leek yellow stripe virus (LYSV) are often found in almost all Allium-cultivating regions and cause significant yield losses worldwide (Katis et al. 2012; Milosevic et al. 2015). In May 2017, severe leaf twisting, yellowing, and plant stunting were observed on shallot (Allium cepa var. aggregatum) in Jilin and Heilongjiang provinces of China. The disease was found in 77% of fields of shallot (total 12,000 ha) in 2017 and 2018. A total of 29 symptomatic plants were collected and tested using double antibody sandwich (DAS)-ELISA kits (DSMZ, Braunschweig, Germany) for the presence of OYDV and LYSV and a triple antibody sandwich ELISA kit (DSMZ) for shallot latent virus (SLV). OYDV was detected in 24 out of 29 shallot samples, and all were negative for LYSV and SLV. The virus was mechanically transmitted from an ELISA-positive sample to 10 plants of shallot using 0.01 M phosphate buffer (pH 7). All 10 mechanically inoculated plants of shallot developed symptoms identical to those observed on the original host plants 21 days postinoculation. All 10 inoculated plants were DAS-ELISA positive for OYDV. Presence of OYDV in ELISA-positive shallot plants was further confirmed by reverse transcription polymerase chain reaction (RT-PCR). Total RNAs were extracted using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany); reverse transcription and PCR were carried out with the PrimeScript II first Strand cDNA Synthesis Kit (Takara, Japan) and Premix Taq (Ex Taq version 2.0) (Takara, Japan). OYDV coat protein (CP) specific primer pair (U: GCCGGCCCAGGGGAGGATG; D: CATTCTGACTCCAAGCAGAG) designed to amplify the complete CP gene was used for amplification. All infected shallot plants yielded an amplicon of the expected size (774 bp), whereas no amplification products were obtained from healthy controls. The RT-PCR product derived from the isolate JL1-3 was sequenced after T vector ligation with a pMD18-T Vector Cloning Kit (Takara, Japan) and submitted to GenBank (accession no. KY347900). Pairwise comparison of the JL1-3 isolate CP sequence with other homologous sequences available in GenBank was conducted, and sequence analysis showed that CP gene of this Chinese isolate shared the highest nucleotide identity of 97 and 95% with the CP gene of OYDV isolates OYDV-AT and AC-41 (GenBank accession nos. JX433020 and Y11826) from Germany and Netherlands, respectively. To our knowledge, this is the first report of OYDV on shallot in China. Further investigation is necessary to prevent the spread of this pathogen to new locations and to new hosts (Naderi Saffar et al. 2013) in China.

CRKII overexpression promotes the in vitro proliferation, migration and invasion potential of murine hepatocarcinoma Hca-P cells.

Lymphatic metastasis is a major mechanism of tumor metastasis. The present study aimed to investigate the association of CRKII, a member of the CRK family, with the in vitro malignant behaviors of a murine hepatocarcinoma Hca-P cell line, with a lymph node metastatic rate of ~25%. Total mRNA was extracted from Hca-P cells, and then the murine CRKII gene was amplified by polymerase chain reaction and cloned into the pEASY-blunt cloning vector. Subsequently, the recombinant pcDNA3.1/V5-HisB-CRKII plasmid was constructed and transfected into Hca-P cells. Western blotting indicated that the CRKII expression level in pcDNA3.1/V5-HisB-CRKII-Hca-P cells was increased by ~185%, compared with pcDNA3.1/V5-HisB-Hca-P cells. The stable overexpression of CRKII enhanced the in vitro proliferation ability, as measured with a Cell Counting Kit-8 assay, and the colony forming capacity was measured with a soft agar colony forming assay for Hca-P cells. The in vitro migration and invasion capacities of Hca-P cells were increased by ~179 and 156% in Hca-P cells, respectively, following the stable upregulation of CRKII. Collectively, the recombinant pcDNA3.1/V5-HisB-CRKII-Hca-P plasmid was constructed successfully. Additionally, the CRKII expression level was positively associated with the in vitro proliferation, migration and invasion malignant properties of Hca-P cells.

Expression of an Environmentally Friendly Enzyme, Engineered Carbonic Anhydrase, in Escherichia coli

Carbon dioxide (CO2) is one of the main causes for global warming. The most important enzyme that converts CO2 into bicarbonate and prevents CO2 emissions in the environment is carbonic anhydrase (CA). The aim of this study was to clone the heat-stable CA gene in Escherichia coli host. The CA gene coding frame of Caminibacter mediatlanticus was optimized based on the more frequently used codons by E. coli. Accordingly, nine codons were inserted in this gene fragment. After CA gene insertion in cloning vector (pGH), it was sub-cloned in pBI121 expression vector and transformed into E. coli XL1-Blue. The accuracy of gene cloning was confirmed by PCR, restriction enzyme digestion and sequencing. Cell extract was prepared from recombinant bacteria. Culture supernatants were assayed for CA activity by the color change of bromothymol blue as indicator. The time for the indicator color changes were recorded and the assays were repeated five times. The average of color change time for cell extract of recombinant, non-recombinant E. coli and control reaction were 1.5, 16, and 48 min, respectively. The amount of active enzyme was calculated to be 92.8 units/ml and the enzyme retained its activity after of incubation at 60 °C, 65 °C, and 70 °C. Due to the positive properties of CA from C. mediatlanticus, codon optimization, modification, and expression of this gene, using a simple and inexpensive method, may be used to obtain CA with enhanced properties.

Construction and expression of a prokaryotic expression vector for the goat sry gene

Goats are economically important animals in the world, and their sex is an important factor in their economic efficiency. Reconstruction of a goat SRY gene expression vector can lay a foundation for studying the immunogenicity and sex determination of SRY protein at the molecular level. In this study, the coding region of the goat SRY gene was used as the target gene fragment for synthesis and optimization, and the cloning vector was used as a template to amplify the target gene and finally ligated to the expression vector pET-SUMO. The recombinant plasmid was then verified by the double restriction enzyme method and transformed into Escherichia coli (DE3). After the induction of expression by Isopropyl â-D-Thiogalactoside (IPTG), the cells were lysed, and SDS-PAGE electrophoresis was performed to observe the expression of the recombinant protein. Additionally, the immunological activity of the recombinant protein was assessed. The target gene was successfully ligated into the prokaryotic expression vector pET-28a; additionally, the prokaryotic expression plasmid pET-SUMO was successfully constructed, and the SRY antigen protein (42 kDa) was expressed. The titer of the rabbit antiserum (PAI-1608012-1) was more than 1:50000, as measured by ELISA, which demonstrated that the titer and the sensitivity of the rabbit serum reached the expected levels. In this study, the prokaryotic expression vector pET-SUMO was successfully constructed. The recombinant protein has high immunopotency and immunoreactivity, which lays a foundation for the preparation of antibodies and the molecular sexing of goats in the future.