Changes In Circular Dichroism Research Articles

Chirality of CsPbBr3 Nanocrystals with Varying Dimensions in the Presence of Chiral Molecules.

Chiral lead halide perovskite (LHP) nanocrystals (NCs) have been attracting considerable interest for circularly polarized luminescence (CPL)-based optoelectronic applications. This study combined experimental and computational analyses to investigate how the dimensionality of 3D (cubic) to 0D (quantum dots) influences the tunable chiral emission of CsPbBr3 LHP NCs. The circular dichroism (CD) spectra have a significant blue shift from 508 to 406 nm. The dissymmetry factors for CD (gCD) change from ±2.5 × 10-3 to ±7.5 × 10-3 as dimensionality varies from 3D to 0D in the presence of the chiral molecule (cyclohexylethylamine, CHEA). A significant luminescence dissymmetry factor (glum) of ±5.6 × 10-4 is observed in the 0D CsPbBr3 NCs. Theoretical calculations using structural distortion parameters, the extent of charge transfer, and electrostatic potential profiles have revealed that the most significant enhancement of the chirality transfer occurs from the CHEA molecules to 0D NCs, and the order of chirality transfer from CHEA to CsPbBr3 NCs is 0D (quantum dots) > 2D (nanoplatelet) > 3D (cubic).

Insights on the comparative affinity of ribonucleic acids with plant-based beta carboline alkaloid, harmine: Spectroscopic, calorimetric and computational evaluation

Small molecules as ligands target multifunctional ribonucleic acids (RNA) for therapeutic engagement. This study explores how the anticancer DNA intercalator harmine interacts various motifs of RNAs, including the single-stranded A-form poly (rA), the clover leaf tRNAphe, and the double-stranded A-form poly (rC)-poly (rG). Harmine showed the affinity to the polynucleotides in the order, poly (rA) > tRNAphe > poly (rC)·poly (rG). While no induced circular dichroism change was detected with poly (rC)poly (rG), significant structural alterations of poly (rA) followed by tRNAphe and occurrence of concurrent initiation of optical activity in the attached achiral molecule of alkaloid was reported. At 25 °C, the affinity further showed exothermic and entropy-driven binding. The interaction also highlighted heat capacity (ΔCop) and Gibbs energy contribution from the hydrophobic transfer (ΔGhyd) of binding with harmine. Molecular docking calculations indicated that harmine exhibits higher affinity for poly (rA) compared to tRNAphe and poly (rC)·poly (rG). Subsequent molecular dynamics simulations were conducted to investigate the binding mode and stability of harmine with poly(A), tRNAphe, and poly (rC)·poly (rG). The results revealed that harmine adopts a partial intercalative binding with poly (rA) and tRNAphe, characterized by pronounced stacking forces and stronger binding free energy observed with poly (rA), while a comparatively weaker binding free energy was observed with tRNAphe. In contrast, the stacking forces with poly (rC)·poly (rG) were comparatively less pronounced and adopts a groove binding mode. It was also supported by ferrocyanide quenching analysis. All these findings univocally provide detailed insight into the binding specificity of harmine, to single stranded poly (rA) over other RNA motifs, probably suggesting a self-structure formation in poly (rA) with harmine and its potential as a lead compound for RNA based drug targeting.

Guest‐Facilitated Heteroleptic Assembly of Helical Anionocages Enables Reversible Chirality Modulation

AbstractWe report a novel strategy for reversible modulation of the supramolecular chirality based on guest‐facilitated heteroleptic assembly of helical anionocages. Two triple‐stranded helical anionocages including a chiral cage 1 (A2L13) and a crown ether functionalized achiral cage 2 (A2L23) were synthesized by anion coordination of bis‐monourea‐based ligands and PhPO32−. Both cages exhibited favorable binding with tetraethylammonium TEA+ and cobaltocenium Cob+ (endo‐guest, bound in the cavity). Additionally, cage 2 could reversibly release and recapture the guests through binding the exo‐guest potassium ions (K+) in the crown ethers and subsequent removal of the K+ by [2,2,2]‐cryptand. The circular dichroism (CD) spectrum of cage 1 was not significantly affected by guest encapsulation or mixing with the “empty” cage 2. However, in the presence of both cage 2 and an endo‐guest/exo‐guest, the Cotton effects were reversed at 391 nm and significantly enhanced at 310 nm. This observation was attributed to the guest‐facilitated formation of heteroleptic cages that enabled effective chirality transfer from the chiral to the achiral ligands. The CD changes induced by K+ could be fully reversed by removing it with [2,2,2]‐cryptand. Sequential addition and removal of K+ allowed reversible modulation of the chirality for at least 10 cycles without significant attenuation.

Guest-Facilitated Heteroleptic Assembly of Helical Anionocages Enables Reversible Chirality Modulation.

We report a novel strategy for reversible modulation of the supramolecular chirality based on guest-facilitated heteroleptic assembly of helical anionocages. Two triple-stranded helical anionocages including a chiral cage 1 (A2 L1 3 ) and a crown ether functionalized achiral cage 2 (A2 L2 3 ) were synthesized by anion coordination of bis-monourea-based ligands and PhPO3 2- . Both cages exhibited favorable binding with tetraethylammonium TEA+ and cobaltocenium Cob+ (endo-guest, bound in the cavity). Additionally, cage 2 could reversibly release and recapture the guests through binding the exo-guest potassium ions (K+ ) in the crown ethers and subsequent removal of the K+ by [2,2,2]-cryptand. The circular dichroism (CD) spectrum of cage 1 was not significantly affected by guest encapsulation or mixing with the "empty" cage 2. However, in the presence of both cage 2 and an endo-guest/exo-guest, the Cotton effects were reversed at 391 nm and significantly enhanced at 310 nm. This observation was attributed to the guest-facilitated formation of heteroleptic cages that enabled effective chirality transfer from the chiral to the achiral ligands. The CD changes induced by K+ could be fully reversed by removing it with [2,2,2]-cryptand. Sequential addition and removal of K+ allowed reversible modulation of the chirality for at least 10 cycles without significant attenuation.

Kinetics of Structural Transitions Induced by Sodium Dodecyl Sulfate in α-Chymotrypsin.

The temporal changes in circular dichroism at 222 and 260 nm were recorded by using stopped-flow spectroscopy after mixing α-chymotrypsin solutions with sodium dodecyl sulfate solutions. Simultaneously with the circular dichroism signal, the fluorescence emission was recorded. Changes in the secondary and tertiary structures of chymotrypsin induced by sodium dodecyl sulfate are characterized by either three or four one-way reactions with relaxation amplitudes and times precisely determined by an advanced numerical procedure of Kuzmič. Quantitatively, transitions within the secondary and tertiary structures of the protein are significantly different. Moreover, changes in the tertiary structure depend on the type of recorded signal (either circular dichroism or fluorescence) and the wavelength of the incident radiation. The latter observation is particularly interesting as it indicates that the contributions of protein's different tryptophans to the total recorded fluorescence depend on the excitation wavelength. We present several results justifying this hypothesis.

Magnetic field caused enhanced absorption and circular dichroism of an achiral plasmonic nanostructure.

In this paper, modulation of light-matter interactions by a magnetic field is used to generate circular dichroism (CD) from an achiral plasmonic nanostructure. Theoretical investigations show an increase in light absorption by the nanostructure in the presence of a magnetic field. The achiral nanostructure exhibits CD in external magnetic field parallel to circularly polarized light (CPL) incidence. The CD emergence is caused by modulation of electron motion to reduced/enhanced frequencies under CPL incidence. Compared to previous studies, in this paper the mechanism of CD emergence, and the physical reasoning behind the change in CD due to change in magnetic field direction and intensity, are explained. CD intensity increases with increasing magnetic field intensity, while CD sign changes on magnetic field direction reversal. Varying structural parameters significantly influences CD intensity. This study can be helpful in magneto-optics and in magneto-chiral applications.

Interaction of isoquinoline alkaloids with pyrimidine motif triplex DNA by mass spectrometry and spectroscopies reveals diverse mechanisms

Isoquinoline alkaloids represent an important class of molecules due to their broad range of pharmacology and clinical utility. Prospective development and use of these alkaloids as effective anticancer agents have elicited great interest. In this study, in order to reveal structure-activity relationship, we present the characterization of bioactive isoquinoline alkaloid-DNA triplex interactions, with particular emphasis on the sequence selectivity and preference of binding to the two types of DNA triplexes, by electrospray ionization mass spectrometry (ESI-MS) and various spectroscopic techniques. The six alkaloids, including coptisine, columbamine, epiberberine, berberrubine, jateorhizine, and fangchinoline, were selected to explore their interactions with the TC and TTT triplex DNA structures. Berberrubine, fangchinoline, coptisine, columbamine, and epiberberine have preference for TC rich DNA sequences compared to TTT rich DNA triplex based on affinity values in MS. The experimental results from different fragmentation modes in tandem MS, subtractive and hyperchromic effects in UV absorption spectra, fluorescence quenching and enhancement in fluorescence spectra, and strong conformational changes in circular dichroism (CD) hinted that the interaction between isoquinoline alkaloid-TC/TTT DNA had diverse mechanisms including at least two different binding modes: the electrostatic binding and the intercalation binding. Interestingly, columbamine, berberrubine, and fangchinoline can stabilize TTT triplex as inferred from optical thermal melting profiles, while it was not the case in TC triplex. These results provide new insights into binding of isoquinoline alkaloids to pyrimidine motif triplex DNA.

A Spectroscopic Approach to Unravel the Local Conformations of a G-Quadruplex Using CD-Active Fluorescent Base Analogues.

The formation of a stable G-quadruplex (GQ) can inhibit the increased telomerase activity that is common in most cancers. The global structure and the thermal stability of the GQs are usually evaluated by spectroscopic methods and thermal denaturation properties. However, most biochemical processes involving GQs might require local conformational changes at the guanine tetrad (G4) level. These local conformational changes of individual G4 layers during protein and drug interactions have not yet been explored in detail. In this study, we monitored the local conformations of individual G4 layers in GQs using 6-methylisoxanthopterine (6MI) chromophores, which are circular dichroism (CD)-active fluorescent base analogues of guanine, as local conformational probes. A synthetic, tetramolecular, parallel GQ with site-specifically positioned 6MI monomers or dimers was used as the experimental construct. Analytical ultracentrifugation studies and gel electrophoretic studies showed that properly positioned 6MI monomers and dimers could form stable GQs with CD-active fluorescent G4 layers. The local conformation of individual fluorescent G4 layers in the GQ structure was then tracked by monitoring the absorbance, fluorescence intensity, thermal melting, fluorescence quenching, and CD changes of the incorporated probes. Overall, these studies showed that site-specifically incorporated fluorescent base analogues could be used as probes to monitor the local conformational changes of individual G4 layers of a GQ structure. This method can be applied to explore the details of small molecule-GQ interaction at the level of the individual G4 layers, which may prove to be useful in designing drugs to treat GQ-related genetic disorders, cancer, and aging.

A Biophysical Analysis on the Effect of Ligands on Fluorescently Active G‐quadruplex Structures

The formation of G‐quadruplex (GQ), a non‐canonical nucleic acid secondary structure, can inhibit the elevated telomerase activity that is common in most cancers. The global structure and the thermal stability of the GQs are usually evaluated by spectroscopic methods and thermal denaturation properties. However, most of the biochemical processes involving GQs involve local conformational changes of GQs at the guanine tetrad (G4) level. Previously we developed a method to study the local conformations of individual G4 layers in GQs that uses 6‐methylisoxanthopterine (6MI), a Circular Dichroism (CD)‐active fluorescent base analogue of guanine. Using this method here we explore the local conformational changes of individual G4 layers in GQ‐drug interactions. Experiments were performed with human telomeric 22AG sequence (5′‐AGGGTTAGGGTTAGGGTTAGGG‐3′) where guanines at the positions 3,9,15 and 21 were site‐specifically replaced by 6MI monomers. The CD and fluorescence properties of the GQ structures with and without the ligands were characterized under various conditions. Thermal denaturation studies showed that properly positioned 6MI monomers and dimers in a GQ forming sequence can form stable GQs with CD‐active fluorescent G4 layers. The local conformation of individual fluorescent G4 layers in the GQ structure was then monitored by following the fluorescence intensity and circular dichroism changes of the incorporated probes. The results showed the interaction of ligands with the fluorescent G4 layer varied depending on the functional groups as well as the bulkiness of the ligand suggesting that there are multiple ways of G4‐ligand interaction.

Probing the tunability of magnetism with external pressure in metastable Sr2NiIrO6 double perovskite

In ${\mathrm{Sr}}_{2}{\mathrm{NiIrO}}_{6}$ long-range Ir-Ir antiferromagnetic exchange interactions have been reported to overcome the ferromagnetic Ni-Ir interactions hampering the otherwise expected ferromagnetic behavior. Prompted by this, a combination of x-ray absorption spectroscopy and x-ray diffraction at high pressure is used here to investigate the interplay between the magnetic structure of the Ir sublattice and lattice degrees of freedom. The compression of ${\mathrm{Sr}}_{2}{\mathrm{NiIrO}}_{6}$ drives an unexpected nonmonotonic change of the x-ray magnetic circular dichroism (XMCD) spectra: The intensity first decreases in the 0- to 18-GPa range, then shows an increase in the 18- to 30-GPa range and again decreases for higher pressures. The XMCD intensity, a measure of the net magnetization in the Ir sublattice, however, is found to remain very low in the whole pressure range so the observed changes do not correspond with a transition from antiferromagnetic to ferromagnetic or ferrimagnetic order. The evolution of the XMCD is better explained in terms of a weakening/strengthening of the long-range antiferromagnetic (AFM) Ir-Ir interaction between ferromagnetic planes associated with the reduction of the lattice parameters. In particular, a correlation can be established between the evolution of the $b$/$a$ ratio and the weakening/strengthening of the AFM interaction.

Tunable terahertz circular dichroism based on graphene-metal hybrid metasurface

Chiral metasurface shows a strong ability to control circularly polarized electromagnetic waves, and the introduction of dynamic-manipulation will further expand the application potential for chiral meta-devices. In this paper, we propose a new scheme to realize tunable chiral terahertz devices. By introducing patterned monolayer graphene into the reflective chiral metal meta-atoms, the chiral terahertz response of the metasurface is efficiently and dynamically adjusted, and its reflective circular dichroism value gradually changes from -0.7 to -0.2. In addition, the change of the incident angle may cause the symbol inversion of circular dichroism and change it from single-band to multi-band. We analyze the physical mechanism of tunable chiral response caused by Fermi level of graphene and the principle of the dynamic change of reflection circular dichroism. The proposal of this scheme provides a new idea for the dynamic tuning of chiral metasurfaces and promotes the development of tunable terahertz meta-devices.

Soft X-ray absorption spectroscopy and magnetic circular dichroism under pulsed high magnetic field of Ni-Co-Mn-In metamagnetic shape memory alloy

In this study, X-ray absorption spectroscopy (XAS) experiments for Ni45Co5Mn36.7In13.3 metamagnetic shape memory alloy were performed under high magnetic fields up to 12 T using a pulsed magnet. Field–induced reverse transformation from martensite phase to austenite phase caused considerable changes in the magnetic circular dichroism (MCD) signals and the magnetic moments of the Mn, Ni, and Co with ferromagnetic coupling were determined. The spin magnetic moment, Mspin, and orbital magnetic moment, Morb, of Mn atom in the induced austenite ferromagnetic phase, estimated based on the sum-rule analysis, were 3.19 and 0.08 μB, respectively, resulting in an Morb / Mspin ratio of 0.03. In the element-specific magnetization curves obtained at 150 K, metamagnetic behavior associated with the field–induced reverse transformation was clearly observed and the transformation magnetic fields could be detected. There was almost no change in the magnetically averaged XAS spectrum for Mn-L2,3 edges between in the martensite and in the magnetic field-induced austenite phases, however, it was visible for Ni. This implies that Ni 3d-electrons mainly contribute to martensitic transformation.

High-field soft-x-ray dichroism of a hard ferrimagnet with easy-plane anisotropy

We performed soft x-ray spectroscopic studies of the ferrimagnet ${\mathrm{TbFe}}_{5}{\mathrm{Al}}_{7}$ with strong easy-plane anisotropy in pulsed magnetic fields up to 29 T along with bulk magnetization and magnetostriction measurements. We observed pronounced amplitude changes of x-ray magnetic circular dichroism and x-ray absorption spectra at the field-induced magnetic transition. This microscopically evidences the simultaneous rotation of the Tb $4f$ and Fe $3d$ magnetic moments from a collinear ferrimagnetic order along the [100] axis to a state with the moments close to [010], the other easy-axis direction of the tetragonal lattice in magnetic fields applied along the [100] axis. We determined the magnetic-anisotropy constant of ${\mathrm{TbFe}}_{5}{\mathrm{Al}}_{7}$ by simulating the high-field macro- and microscopic magnetization process using a two-sublattice model.

Circular dichroism of doped carbon nanotubes

Circular dichroism (CD) of a doped carbon nanotube is calculated as a function of wavelength for several values of the Fermi energy. In the calculation of CD, we consider the so-called depolarization effect by taking account of the dielectric function that suppresses or enhances the electric field inside the undoped or doped nanotube, respectively. Because of the induced electric current of the carriers, the CD of a doped carbon nanotube becomes much larger than that of an undoped nanotube when we select the light-propagating direction parallel to the nanotube axis. The sign of CD changes for enantiomer pair of nanotubes or for type-I and type-II semiconductor nanotubes or by changing the Fermi energy, which is useful for identifying nanotubes in the device.

Ethanol shock enhances the recovery of anthocyanin from lowbush blueberry

Deactivation of polyphenol oxidase (PPO) in natural products is essential for downstream processing of functional molecules used as food or food additives, particularly those served as antioxidants. In the present work, we identified two proteins with PPO activity from lowbush blueberry using ammonium sulphate precipitation and chromatography procedures. Deactivation of these proteins was studied using aqueous solutions of ethanol of different concentrations. The PPO activity was recovered after ethanol removal for the protein samples previously soaked in a low concentration ethanol solution. A complete and unrecoverable deactivation of the proteins was achieved using ethanol with concentration over 70% (v/v), as manifested by the significant changes in circular dichroism (CD) and fluorescence spectroscopy measurements. Based on these findings, we propose a new extraction process for blueberry anthocyanin, in which an ethanol shock, i.e. soaking blueberry fruit in a 70% (v/v) ethanol solution for 1 h, is implemented before subsequent procedures. This new process increases the anthocyanin yield by 55% in comparison to that without the ethanol shock.

Pressure dependence of vibrational optical activity of model biomolecules. A computational study.

Change of molecular properties with pressure is an attracting means to regulate molecular reactivity or biological activity. However, the effect is usually small and so far explored rather scarcely. To obtain a deeper insight and estimate the sensitivity of vibrational optical activity spectra to pressure-induced conformational changes, we investigate small model molecules. The Ala-Ala dipeptide, isomaltose disaccharide and adenine-uracil dinucleotide were chosen to represent three different biomolecular classes. The pressure effects were modeled by molecular dynamics and density functional theory simulations. The dinucleotide was found to be the most sensitive to the pressure, whereas for the disaccharide the smallest changes are predicted. Pressure-induced relative intensity changes in vibrational circular dichroism and Raman optical activity spectra are predicted to be 2-3-times larger than for non-polarized IR and Raman techniques.

Mutation of leucine 20 causes a change of local conformation indirectly impairing the DNA binding of SP_0782 from Streptococcus pneumoniae

SP_0782 from Streptococcus pneumoniae is a dimeric PC4-like protein binding single-stranded DNA (ssDNA), and is potentially involved in maintenance of genome stability and natural transformation. SP_0782 binds with different lengths of ssDNA in various patterns through accommodating nucleotides differently in its two DNA-binding regions (DBRs). Here, we report the characterization of a novel site, leucine 20 (L20), which is not located in the DBRs but impairs the DNA binding when mutated to alanine (L20A). The L20A mutation markedly reduced the DNA-binding affinity of SP_0782 for ssDNA dT19G1, and affected the formation of high-order SP_0782:dT19G1 complexes. The side chain of L20 shows interactions with several residues at the backside of the DBRs in apo SP_0782 structure, and the L20A mutation led to a change of circular dichroism (CD) spectrum and broad chemical shift perturbations (CSPs) in NMR spectrum compared with the wild type. The most affected residues in NMR spectrum included F39 and R49 located in DBR2, as well as K60 in DBR1, which was suggested to be important for cooperative binding of ssDNA by the two subunits in SP_0782 dimer. Thus, the L20A mutation caused a local conformational change of SP_0782, which exerted an indirect effect on the DNA-binding interface and therefore impaired the affinity for ssDNA dT19G1. Interestingly, this L20 site is conserved in bacterial but not eukaryotic PC4-like proteins, suggesting an evolutionary divergence. This study provides an insight into the structure-function relationship of SP_0782, and an amino-acid site probably targeted for inhibiting bacteria selectively.

Molecular Interaction of Amino Acid-Based Gemini Surfactant with Human Serum Albumin: Tensiometric, Spectroscopic, and Molecular Docking Study.

Binding effect and interaction of N,N′-dialkyl cystine based gemini surfactant (GS); 2(C12Cys) with human serum albumin (HSA) were systematically investigated by the techniques such as surface tension measurement, UV−visible spectroscopy, fluorescence spectroscopy, circular dichroism (CD) spectroscopy, and molecular docking studies. The surface tension measurement exhibited that HSA shifted the critical micelle concentration of the 2(C12Cys) GS to the higher side that confirms the complex formation among 2(C12Cys) GS and HSA which was also verified by UV–visible, fluorescence, and CD spectroscopy. Increase in the concentration of 2(C12Cys) GS increases the absorption of the HSA protein but has a reverse effect on the fluorescence intensity. The analysis of UV–visible study with the help of a static quenching method showed that the value acquired for the bimolecular quenching constant (kq) quenches the intrinsic fluorescence of the HSA protein. Synchronous fluorescence spectrometry declared that the induced-binding conformational changes in HSA and CD results explained the variations in the secondary arrangement of the protein in presence of 2(C12Cys) GS. The present study revealed that the interaction between 2(C12Cys) GS and HSA is important for the preparation and properties of medicines. Molecular docking study provides insight into the specific binding site of 2(C12Cys) GS into the sites of HSA.

The Effect of Dimethyl Sulfoxide on the Lysozyme Unfolding Kinetics, Thermodynamics, and Mechanism.

The thermal stability of proteins in the presence of organic solvents and the search for ways to increase this stability are important topics in industrial biocatalysis and protein engineering. The denaturation of hen egg-white lysozyme in mixtures of water with dimethyl sulfoxide (DMSO) with a broad range of compositions was studied using a combination of differential scanning calorimetry (DSC), circular dichroism (CD), and spectrofluorimetry techniques. In this study, for the first time, the kinetics of unfolding of lysozyme in DMSO–water mixtures was characterized. In the presence of DMSO, a sharp decrease in near-UV CD and an increase in the fluorescence signal were observed at lower temperatures than the DSC denaturation peak. It was found that differences in the temperatures of the CD and DSC signal changes increase as the content of DMSO increases. Changes in CD and fluorescence are triggered by a break of the tertiary contacts, leading to an intermediate state, while the DSC peak corresponds to a subsequent complete loss of the native structure. In this way, the commonly used two-state model was proven to be unsuitable to describe the unfolding of lysozyme in the presence of DMSO. In kinetic studies, it was found that even high concentrations of DMSO do not drastically change the activation energy of the initial stage of unfolding associated with a disruption of the tertiary structure, while the enthalpy of denaturation shows a significant dependence on DMSO content. This observation suggests that the structure of the transition state upon unfolding remains similar to the structure of the native state.

Co-delivery of curcumin and piperine in zein-carrageenan core-shell nanoparticles: Formation, structure, stability and in vitro gastrointestinal digestion

Core-shell biopolymer nanoparticles were fabricated using a hydrophobic protein (zein) as the core and a hydrophilic anionic polysaccharide (ι-carrageenan) as the shell. The outer layer was physically cross-linked using cationic calcium ions to form salt bridges between the anionic carrageenan molecules. The potential of using these core-shell nanoparticles to co-deliver two important nutraceuticals (curcumin and piperine) was also investigated. A combination of electrostatic attraction, hydrogen bonding, and hydrophobic interactions was shown to be responsible for the assembly of the curcumin-piperine-loaded nanoparticles. Low levels of calcium ions (0–2 mM) led to the formation of small nanoparticles with compact structures, whereas higher levels (2–5 mM) promoted particle aggregation. The structural organization and morphology of the core-shell nanoparticles also depended on calcium levels, as seen by changes in circular dichroism, fluorescence spectroscopy, and electron microscopy. The core-shell nanoparticles were shown to be effective at retarding the photo- and thermal-degradation of the encapsulated curcumin and piperine. In addition, the core-shell nanoparticles could delay the release of the nutraceuticals under in-vitro gastrointestinal conditions, which may improve their oral bioavailability. In summary, core-shell nanoparticles assembled from zein and ι-carrageenan may be effective co-delivery systems for curcumin and piperine.