Cas9 Protein Research Articles

Abstract 2634: CRISPR in vivo screen utilizing removable Cas9 system to identify epigenetic immune response modulators in antigen-sensitive mouse syngeneic models

Abstract The application of CRISPR-Cas9 screen in tumor immunology research has promoted the discovery of potential therapeutic targets and provided a deeper understanding of the mechanisms of immunotherapy resistance. Mouse syngeneic tumor model based CRISPR in vivo screen revealed significant features of immunotherapy by better approaching the tumor immune interaction. However, the immunogenicity of CRISPR-Cas9 has been widely observed in a variety of syngeneic models, which greatly limited for the application of CRISPR in vivo screen. Herein, we used two strategies for cancer cell gene editing, Cas9 protein electroporation and loxP-flanked Cas9 with Cre recombinase, to reduce the immunogenicity of CRISPR-Cas9 in CT26 subcutaneous and Renca orthotropic syngeneic models. Encouragingly, we found out that compared with constitutive Cas9-expressing All-In-One based cell pool models, both CT26 subcutaneous model and Renca orthotropic model showed a parental cell tumor comparable growth kinetics and immune checkpoint blockade ICB response by PD-1 antibody treatment. Further immuno-profiling of tumor immune microenvironment indicated limited changes from the parental cell model, which helped the data interpretation of in vivo screen outcome. We then performed a CRISPR in vivo screen by using a focused library against mouse epigenetic regulators in these two models and will discuss the hits from the screen in future. Citation Format: Yuan He, Yafei Liu, Xiao Wang, Xianyi Li, Wenle Dong, Tongrui Hao, Chenyang Zhu, Wenrong Zhou, Zhengang Peng. CRISPR in vivo screen utilizing removable Cas9 system to identify epigenetic immune response modulators in antigen-sensitive mouse syngeneic models [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 2634.

In Silico Modeling of a Mutant Cas9 Protein for High -Fidelity Genome Editing

Introduction: CRISPR/Cas system is a bacterial -acquired immune system against viruses. spCas9 protein -derived from Streptococcus pyogenes is the most common Cas protein used in genome editing. The Cas9 proteins suffer from some problems like unwanted off-target cleavage, which is the major limitation in the application of the CRISPR system, especially for therapeutic issues. The present study aimed to in silico design of a mutant Cas protein to enhance the fidelity of the enzyme. Method: In this study, a new Cas9 protein was designed in silico via the selection of some mutations. The interaction of the mutant and wild -type Cas9 proteins with DNA was determined by molecular docking. Finally, the stability of the mutant and wild -type proteins was evaluated using molecular dynamics. Results: The outcome of this study resulted in designing a mutant Cas9 protein bioinformatically containing 5 amino acid substitutions. Molecular docking scores for the wild -type and mutant proteins were -1073.86 and -349.41, respectively . Conclusion: Molecular docking indicated that the number of hydrogen bonds between protein and DNA reduced in the mutant state. Moreover, based on the molecular dynamic findings, the stability of both mutant and wild -type Cas9 proteins was similar.

Tools and computational resources for the design of CRISPR/Cas9 sgRNA for NPR3 gene knockout in sour orange (Citrus aurantium L.)

Citrus fruits are the most nutritious foods widely used in flavoring, beverages, and medicines due to their outstanding curative effects. Sour orange (Citrus aurantium L.) is the predominant rootstock in most citrus growing areas due to its good agronomic attributes such as high quality, yield and tolerance to various pathogens. However, the citrus tristeza virus (CTV) is the leading epidemic agent of sour and sweet orange. This study aimed to design in silico guide RNA (sgRNA) for CRISPR/Cas9-mediated inactivation of the Nonexpression of Pathogenesis-Related genes 3 (NPR3) in sour orange (CaNPR3). The protein sequence of the CaNPR3 gene is 584 amino acid residues long. The amino acid sequence of the CaNPR3 gene was compared with the homologous sequences of other nearby vegetative species, showing a close similarity with Citrus sinensis and Citrus Clementina with 100% and 97.27%, respectively. CRISPR RGEN Tools provided 61 results for exon two of the CaNPR3 gene, filtering to 19 sequences and selecting four sgRNA sequences for genetic editing, which were: sgRNA 1 (5'-CATCAGGAAAAGACTTGAGT-3'), sgRNA 2 (5'-AGAACCTCAGACAACACACCTT-3'), sgRNA 3 (5'-CATCAGATTTGACCCTGGAT-3') and sgR-NA 4 (5'- TTCTGGAGGGAGGGAGAGAAATGAGGAGG -3'). The predicted secondary structures of the four selected sgRNAs present efficient structures for gene editing of the target gene, allowing it to recognize, interact with Cas9 protein and edit the target region. Keywords: Gene editing, guide RNA, CaNPR3, in silico.

One-step in vivo gene knock-out in porcine embryos using recombinant adeno-associated viruses.

Introduction: Gene-edited pigs have become prominent models for studying human disease mechanisms, gene therapy, and xenotransplantation. CRISPR (clustered regularly interspaced short palindromic repeats)/CRISPR-associated 9 (CRISPR/Cas9) technology is a widely employed tool for generating gene-edited pigs. Nevertheless, delivering CRISPR/Cas9 to pre-implantation embryos has traditionally posed challenges due to its reliance on intricate micromanipulation equipment and specialized techniques, resulting in high costs and time-consuming procedures. This study aims to introduce a novel one-step approach for generating genetically modified pigs by transducing CRISPR/Cas9 components into pre-implantation porcine embryos through oviductal injection of recombinant adeno-associated viruses (rAAV). Methods: We first used rAAV-1, rAAV-6, rAAV-8, rAAV-9 expressing EGFP to screen for rAAV serotypes that efficiently target porcine embryos, and then, to achieve efficient expression of CRISPR/Cas9 in vivo for a short period, we packaged sgRNAs targeting the GHR genes to self-complementary adeno-associated virus (scAAV), and Cas9 proteins to single-stranded adeno-associated virus (ssAAV). The efficiency of porcine embryos -based editing was then validated in vitro. The feasibility of this one-step method to produce gene-edited pigs using rAAV-CRISPR/Cas9 oviductal injection into sows within 24h of conception was then validated. Results: Our research firstly establishes the efficient delivery of CRISPR/Cas9 to pig zygotes, both in vivo and in vitro, using rAAV6. Successful gene editing in pigs was achieved through oviductal injection of rAAV-CRISPR/Cas9. Conclusion: This method circumvents the intricate procedures involved in in vitro embryo manipulation and embryo transfers, providing a straightforward and cost-effective approach for the production of gene-edited pigs.

Tools and computational resources for the design of CRISPR/Cas9 sgRNA for NPR3 gene knockout in sour orange (Citrus aurantium L.)

Citrus fruits are the most nutritious foods widely used in flavoring, beverages, and medicines due to their outstanding curative effects. Sour orange (Citrus aurantium L.) is the predominant rootstock in most citrus growing areas due to its good agronomic attributes such as high quality, yield and tolerance to various pathogens. However, the citrus tristeza virus (CTV) is the leading epidemic agent of sour and sweet orange. This study aimed to design in silico guide RNA (sgRNA) for CRISPR/Cas9-mediated inactivation of the Nonexpression of Pathogenesis-Related genes 3 (NPR3) in sour orange (CaNPR3). The protein sequence of the CaNPR3 gene is 584 amino acid residues long. The amino acid sequence of the CaNPR3 gene was compared with the homologous sequences of other nearby vegetative species, showing a close similarity with Citrus sinensis and Citrus Clementina with 100% and 97.27%, respectively. CRISPR RGEN Tools provided 61 results for exon two of the CaNPR3 gene, filtering to 19 sequences and selecting four sgRNA sequences for genetic editing, which were: sgRNA 1 (5'-CATCAGGAAAAGACTTGAGT-3'), sgRNA 2 (5'-AGAACCTCAGACAACACACCTT-3'), sgRNA 3 (5'-CATCAGATTTGACCCTGGAT-3') and sgR-NA 4 (5'- TTCTGGAGGGAGGGAGAGAAATGAGGAGG -3'). The predicted secondary structures of the four selected sgRNAs present efficient structures for gene editing of the target gene, allowing it to recognize, interact with Cas9 protein and edit the target region. Keywords: Gene editing, guide RNA, CaNPR3, in silico.

Engineering Anti‐CRISPR Proteins to Create CRISPR‐Cas Protein Switches for Activatable Genome Editing and Viral Protease Detection

AbstractProteins capable of switching between distinct active states in response to biochemical cues are ideal for sensing and controlling biological processes. Activatable CRISPR‐Cas systems are significant in precise genetic manipulation and sensitive molecular diagnostics, yet directly controlling Cas protein function remains challenging. Herein, we explore anti‐CRISPR (Acr) proteins as modules to create synthetic Cas protein switches (CasPSs) based on computational chemistry‐directed rational protein interface engineering. Guided by molecular fingerprint analysis, electrostatic potential mapping, and binding free energy calculations, we rationally engineer the molecular interaction interface between Cas12a and its cognate Acr proteins (AcrVA4 and AcrVA5) to generate a series of orthogonal protease‐responsive CasPSs. These CasPSs enable the conversion of specific proteolytic events into activation of Cas12a function with high switching ratios (up to 34.3‐fold). These advancements enable specific proteolysis‐inducible genome editing in mammalian cells and sensitive detection of viral protease activities during virus infection. This work provides a promising strategy for developing CRISPR‐Cas tools for controllable gene manipulation and regulation and clinical diagnostics.

Engineering Anti-CRISPR Proteins to Create CRISPR-Cas Protein Switches for Activatable Genome Editing and Viral Protease Detection.

Proteins capable of switching between distinct active states in response to biochemical cues are ideal for sensing and controlling biological processes. Activatable CRISPR-Cas systems are significant in precise genetic manipulation and sensitive molecular diagnostics, yet directly controlling Cas protein function remains challenging. Herein, we explore anti-CRISPR (Acr) proteins as modules to create synthetic Cas protein switches (CasPSs) based on computational chemistry-directed rational protein interface engineering. Guided by molecular fingerprint analysis, electrostatic potential mapping, and binding free energy calculations, we rationally engineer the molecular interaction interface between Cas12a and its cognate Acr proteins (AcrVA4 and AcrVA5) to generate a series of orthogonal protease-responsive CasPSs. These CasPSs enable the conversion of specific proteolytic events into activation of Cas12a function with high switching ratios (up to 34.3-fold). These advancements enable specific proteolysis-inducible genome editing in mammalian cells and sensitive detection of viral protease activities during virus infection. This work provides a promising strategy for developing CRISPR-Cas tools for controllable gene manipulation and regulation and clinical diagnostics.

Repurposing CRISPR-Cas13 systems for robust mRNA trans-splicing

Type VI CRISPR enzymes have been developed as programmable RNA-guided Cas proteins for eukaryotic RNA editing. Notably, Cas13 has been utilized for site-targeted single base edits, demethylation, RNA cleavage or knockdown and alternative splicing. However, the ability to edit large stretches of mRNA transcripts remains a significant challenge. Here, we demonstrate that CRISPR-Cas13 systems can be repurposed to assist trans-splicing of exogenous RNA fragments into an endogenous pre-mRNA transcript, a method termed CRISPR Assisted mRNA Fragment Trans-splicing (CRAFT). Using split reporter-based assays, we evaluate orthogonal Cas13 systems, optimize guide RNA length and screen for optimal trans-splicing site(s) across a range of intronic targets. We achieve markedly improved editing of large 5’ and 3’ segments in different endogenous mRNAs across various mammalian cell types compared to other spliceosome-mediated trans-splicing methods. CRAFT can serve as a versatile platform for attachment of protein tags, studying the impact of multiple mutations/single nucleotide polymorphisms, modification of untranslated regions (UTRs) or replacing large segments of mRNA transcripts.

An autocatalytic CRISPR-Cas amplification effect propelled by the LNA-modified split activators for DNA sensing.

CRISPR-Cas systems with dual functions offer precise sequence-based recognition and efficient catalytic cleavage of nucleic acids, making them highly promising in biosensing and diagnostic technologies. However, current methods encounter challenges of complexity, low turnover efficiency, and the necessity for sophisticated probe design. To better integrate the dual functions of Cas proteins, we proposed a novel approach called CRISPR-Cas Autocatalysis Amplification driven by LNA-modified Split Activators (CALSA) for the highly efficient detection of single-stranded DNA (ssDNA) and genomic DNA. By introducing split ssDNA activators and the site-directed trans-cleavage mediated by LNA modifications, an autocatalysis-driven positive feedback loop of nucleic acids based on the LbCas12a system was constructed. Consequently, CALSA enabled one-pot and real-time detection of genomic DNA and cell-free DNA (cfDNA) from different tumor cell lines. Notably, CALSA achieved high sensitivity, single-base specificity, and remarkably short reaction times. Due to the high programmability of nucleic acid circuits, these results highlighted the immense potential of CALSA as a powerful tool for cascade signal amplification. Moreover, the sensitivity and specificity further emphasized the value of CALSA in biosensing and diagnostics, opening avenues for future clinical applications.

CRISPR/Cas9-mediated knockout of scarlet gene produces eye color mutants in the soybean looper, Chrysodeixis includens.

The CRISPR/Cas9 technology has greatly progressed research on non-model organisms, demonstrating successful applications in genome editing for various insects. However, its utilization in the case of the soybean looper, Chrysodeixis includens, a notable pest affecting soybean crops, has not been explored due to constraints such as limited genomic information and the embryonic microinjection technique. This study presents successful outcomes in generating heritable knockout mutants for a pigment transporter gene, scarlet, in C. includens through CRISPR/Cas9-mediated mutagenesis. The scarlet locus identified in the genome assembly of C. includens consists of 14 exons, with a coding sequence extending for 1,986 bp. Two single guide RNAs (sgRNAs) were designed to target the first exon of scarlet. Microinjection of these two sgRNAs along with the Cas9 protein into fresh embryos resulted in the successful production of variable phenotypes, particularly mutant eyes. The observed mutation rate accounted for about 16%. Genotype analysis revealed diverse indel mutations at the target site, presumably originating from double-strand breaks followed by the nonhomologous end joining repair, leading to a premature stop codon due to frame shift. Single-pair mating of the mutant moths produced G1 offspring, and the establishment of a homozygous mutant strain occurred in G2. The mutant moths exhibited lightly greenish or yellowish compound eyes in both sexes, confirming the involvement of scarlet in pigmentation in C. includens. Notably, the CRISPR/Cas9-mediated genome editing technique serves as a visible phenotypic marker, demonstrating its proof-of-concept applicability in C. includens, as other pigment transporter genes have been utilized as visible markers to establish genetic control for various insects. These results provide the first successful case that the CRISPR/Cas9 method effectively induces mutations in C. includes, an economically important soybean insect pest.

Genetic Editing with CRISPR Cas9: recent Biomedical and Biotechnological Applications

The use of a novel and powerful technology that allows for the precise editing of the genetic material of various organisms is becoming widespread. This technology derives from bacterial and archaeal defense machinery and is called CRISPR Cas9. Unlike other gene editing tools that exclusively rely on proteins, CRISPR Cas9 utilizes interactions between the target DNA and an RNA sequence that guides the Cas9 enzyme to alter the structure of a target gene. Various genome locations can be edited thanks to the ease of programming different guide RNA sequences, facilitating its use and implementation. Furthermore, the non-active version of the Cas9 protein, guided by its corresponding RNA, can be utilized for visualization processes of genetic material or, more recently, for the regulation of the transcription process. Considering the recent advances and possibilities in biomedical and biotechnological research, we must understand that the exploration of this technology is just beginning, and its eventual applications will influence the world around us on multiple levels. In this review, we describe the biological foundations of the functioning of the Cas9 nuclease, together with selected applications of its use in editing and regulating specific sections of the genetic material of various organisms. We also discuss some bioethical issues surrounding this subject.

CRISPR/Cas9-Mediated Customizing Strategies for Adoptive T-Cell Therapy.

Clustered regularly interspaced short palindromic repeat-associated protein Cas9 (CRISPR/Cas9) technology is at the forefront of cancer immunotherapy innovation, offering precise and personalized treatment strategies. In this review, we discuss CRISPR/Cas9's ability to precisely edit the genome, its impact on immune checkpoint control, and its application in immune cell engineering, where it surpasses traditional gene editing techniques. Originally inspired by bacterial defense mechanisms, this technology has made great strides in cancer immunotherapy as a mechanism to specifically target the PD-1/PD-L1 pathway in immune checkpoint blockades. In addition, CRISPR/Cas9 plays an important role in cancer treatment by facilitating genetic modifications to enhance the properties of adoptive cell therapy, optimizing the therapeutic potential of this approach. This review provides an overview of the development of CRISPR/Cas9, its important role in immune checkpoint control, applications in immune cell engineering, and the current status of clinical trials. However, safety concerns related to off-target effects and unintended mutations require continued research and caution. Continued advances in CRISPR technology hold the promise of revolutionizing the cancer treatment paradigm, providing personalized and effective therapies for patients with various types of cancer.

Comparing robotic and manual injection methods in zebrafish embryos for high-throughput RNA silencing using CRISPR-RfxCas13d.

In this study, the authors compared the efficiency of automated robotic and manual injection methods for the CRISPR-RfxCas13d (CasRx) system for mRNA knockdown and Cas9-mediated DNA targeting in zebrafish embryos. They targeted the no tail (TBXTA) gene as a proof-of-principle, evaluating the induced embryonic phenotypes. Both Cas9 and CasRx systems caused loss of function phenotypes for TBXTA. Cas9 protein exhibited a higher percentage of severe phenotypes compared with mRNA, while CasRx protein and mRNA showed similar efficiency. Both robotic and manual injections demonstrated comparable phenotype percentages and mortality rates. The findings highlight the potential of RNA-targeting CRISPR effectors for precise gene knockdown and endorse automated microinjection at a speed of 1.0s per embryo as a high-throughput alternative to manual methods.

An engineered baculoviral protein and DNA co-delivery system for CRISPR-based mammalian genome editing.

CRISPR-based DNA editing technologies enable rapid and accessible genome engineering of eukaryotic cells. However, the delivery of genetically encoded CRISPR components remains challenging and sustained Cas9 expression correlates with higher off-target activities, which can be reduced via Cas9-protein delivery. Here we demonstrate that baculovirus, alongside its DNA cargo, can be used to package and deliver proteins to human cells. Using protein-loaded baculovirus (pBV), we demonstrate delivery of Cas9 or base editors proteins, leading to efficient genome and base editing in human cells. By implementing a reversible, chemically inducible heterodimerization system, we show that protein cargoes can selectively and more efficiently be loaded into pBVs (spBVs). Using spBVs we achieved high levels of multiplexed genome editing in a panel of human cell lines. Importantly, spBVs maintain high editing efficiencies in absence of detectable off-targets events. Finally, by exploiting Cas9 protein and template DNA co-delivery, we demonstrate up to 5% site-specific targeted integration of a 1.8 kb heterologous DNA payload using a single spBV in a panel of human cell lines. In summary, we demonstrate that spBVs represent a versatile, efficient and potentially safer alternative for CRISPR applications requiring co-delivery of DNA and protein cargoes.

Distribution analysis of TRH in Bactrocera dorsalis using a CRISPR/Cas9-mediated reporter knock-in strain.

Although the study of many genes and their protein products is limited by the availability of high-quality antibodies, this problem could be solved by fusing a tag/reporter to an endogenous gene using a gene-editing approach. The type II bacterial CRISPR/Cas system has been demonstrated to be an efficient gene-targeting technology for many insects, including the oriental fruit fly Bactrocera dorsalis. However, knocking in, an important editing method of the CRISPR/Cas9 system, has lagged in its application in insects. Here, we describe a highly efficient homology-directed genome editing system for B. dorsalis that incorporates coinjection of embryos with Cas9 protein, guide RNA and a short single-stranded oligodeoxynucleotide donor. This one-step procedure generates flies carrying V5 tag (42 bp) in the BdorTRH gene. In insects, as in other invertebrates and in vertebrates, the neuronal tryptophan hydroxylase (TRH) gene encodes the rate-limiting enzyme for serotonin biosynthesis in the central nervous system. Using V5 monoclonal antibody, the distribution of TRH in B. dorsalis at different developmental stages was uncovered. Our results will facilitate the generation of insects carrying precise DNA inserts in endogenous genes and will lay foundation for the investigation of the neural mechanisms underlying the serotonin-mediated behaviour of B. dorsalis.

Subunits of an E3 Ligase Complex as Degrons for Efficient Degradation of Cytosolic, Nuclear, and Membrane Proteins.

Protein degradation is a highly regulated cellular process crucial to enable the high dynamic range of the response to external and internal stimuli and to balance protein biosynthesis to maintain cell homeostasis. Within mammalian cells, hundreds of E3 ubiquitin ligases target specific protein substrates and could be repurposed for synthetic biology. Here, we present a systematic analysis of the four protein subunits of the multiprotein E3 ligase complex as scaffolds for the designed degrons. While all of them were functional, the fusion of a fragment of Skp1 with the target protein enabled the most effective degradation. Combination with heterodimerizing peptides, protease substrate sites, and chemically inducible dimerizers enabled the regulation of protein degradation. While the investigated subunits of E3 ligases showed variable degradation efficiency of the membrane and cytosolic and nuclear proteins, the bipartite SSD (SOCSbox-Skp1(ΔC111)) degron enabled fast degradation of protein targets in all tested cellular compartments, including the nucleus and plasma membrane, in different cell lines and could be chemically regulated. These subunits could be employed for research as well as for diverse applications, as demonstrated in the regulation of Cas9 and chimeric antigen receptor proteins.

Engineering self-deliverable ribonucleoproteins for genome editing in the brain

The delivery of CRISPR ribonucleoproteins (RNPs) for genome editing in vitro and in vivo has important advantages over other delivery methods, including reduced off-target and immunogenic effects. However, effective delivery of RNPs remains challenging in certain cell types due to low efficiency and cell toxicity. To address these issues, we engineer self-deliverable RNPs that can promote efficient cellular uptake and carry out robust genome editing without the need for helper materials or biomolecules. Screening of cell-penetrating peptides (CPPs) fused to CRISPR-Cas9 protein identifies potent constructs capable of efficient genome editing of neural progenitor cells. Further engineering of these fusion proteins establishes a C-terminal Cas9 fusion with three copies of A22p, a peptide derived from human semaphorin-3a, that exhibits substantially improved editing efficacy compared to other constructs. We find that self-deliverable Cas9 RNPs generate robust genome edits in clinically relevant genes when injected directly into the mouse striatum. Overall, self-deliverable Cas9 proteins provide a facile and effective platform for genome editing in vitro and in vivo.

Improving the Efficiency of CRISPR Ribonucleoprotein-Mediated Precise Gene Editing by Small Molecules in Porcine Fibroblasts.

The aim of this study was to verify whether small molecules can improve the efficiency of precision gene editing using clustered regularly interspaced short palindromic repeats (CRISPR) ribonucleoprotein (RNP) in porcine cells. CRISPR associated 9 (Cas9) protein, small guide RNA (sgRNA), phosphorothioate-modified single-stranded oligonucleotides (ssODN), and different small molecules were used to generate precise nucleotide substitutions at the insulin (INS) gene by homology-directed repair (HDR) in porcine fetal fibroblasts (PFFs). These components were introduced into PFFs via electroporation, followed by polymerase chain reaction (PCR) for the target site. All samples were sequenced and analyzed, and the efficiencies of different small molecules at the target site were compared. The results showed that the optimal concentrations of the small molecules, including L-189, NU7441, SCR7, L755507, RS-1, and Brefeldin A, for in vitro-cultured PFFs' viability were determined. Compared with the control group, the single small molecules including L-189, NU7441, SCR7, L755507, RS-1, and Brefeldin A increased the efficiency of HDR-mediated precise gene editing from 1.71-fold to 2.28-fold, respectively. There are no benefits in using the combination of two small molecules, since none of the combinations improved the precise gene editing efficiency compared to single small molecules. In conclusion, these results suggested that a single small molecule can increase the efficiency of CRISPR RNP-mediated precise gene editing in porcine cells.

Advances in application of CRISPR-Cas13a system.

Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs) and CRISPR-associated (Cas) proteins serve as an adaptive immune system that safeguards prokaryotes and some of the viruses that infect prokaryotes from foreign nucleic acids (such as viruses and plasmids). The genomes of the majority of archaea and about half of all bacteria contain various CRISPR-Cas systems. CRISPR-Cas systems depend on CRISPR RNAs (crRNAs). They act as a navigation system to specifically cut and destroy foreign nucleic acids by recognizing invading foreign nucleic acids and binding Cas proteins. In this review, we provide a brief overview of the evolution and classification of the CRISPR-Cas system, focusing on the functions and applications of the CRISPR-Cas13a system. We describe the CRISPR-Cas13a system and discuss its RNA-directed ribonuclease function. Meanwhile, we briefly introduce the mechanism of action of the CRISPR-Cas13a system and summarize the applications of the CRISPR-Cas13a system in pathogen detection, eukaryotes, agriculture, biosensors, and human gene therapy. We are right understanding of CRISPR-Cas13a has been broadened, and the CRISPR-Cas13a system will be useful for developing new RNA targeting tools. Therefore, understanding the basic details of the structure, function, and biological characterization of CRISPR-Cas13a effector proteins is critical for optimizing RNA targeting tools.

Application of CRISPR/Cas9 for Rapid Genome Editing of Pseudorabies Virus and Bovine Herpesvirus-1.

The CRISPR/Cas9 system is widely used to manipulate viral genomes. Although Alphaherpesvirinae genomes are large and complicated to edit, in recent years several Pseudorabies virus (PRV) mutants have been successfully generated using the CRISPR/Cas9 system. However, the application of CRISPR/Cas9 editing on another member of alpha herpesviruses, bovine herpesvirus-1 (BHV-1), is rarely reported. This paper reports a rapid and straightforward approach to manipulating herpesviruses genome using CRISPR/Cas9. The recombinant plasmids contained the left and right arm of the thymidine kinase (TK) gene of PRV or of the glycoprotein I (gI) and glycoprotein E (gE) of BHV-1. Upon the cleavage of the TK or gIgE gene by Cas9 protein, this was replaced by the enhanced green fluorescence protein (eGFP) by homologous recombination. With this approach, we generated recombinant TK-/eGFP+ PRV and gIgE-/eGFP+ BHV-1 mutants and then proceeded to characterize their biological activities in vitro and in vivo. In conclusion, we showed that alpha herpesvirus, including PRV and BHV-1, can be rapidly edited using the CRISPR/Cas9 approach paving the way to the development of animal herpesvirus vaccines.