Tools and computational resources for the design of CRISPR/Cas9 sgRNA for NPR3 gene knockout in sour orange (Citrus aurantium L.)

Abstract

Citrus fruits are the most nutritious foods widely used in flavoring, beverages, and medicines due to their outstanding curative effects. Sour orange (Citrus aurantium L.) is the predominant rootstock in most citrus growing areas due to its good agronomic attributes such as high quality, yield and tolerance to various pathogens. However, the citrus tristeza virus (CTV) is the leading epidemic agent of sour and sweet orange. This study aimed to design in silico guide RNA (sgRNA) for CRISPR/Cas9-mediated inactivation of the Nonexpression of Pathogenesis-Related genes 3 (NPR3) in sour orange (CaNPR3). The protein sequence of the CaNPR3 gene is 584 amino acid residues long. The amino acid sequence of the CaNPR3 gene was compared with the homologous sequences of other nearby vegetative species, showing a close similarity with Citrus sinensis and Citrus Clementina with 100% and 97.27%, respectively. CRISPR RGEN Tools provided 61 results for exon two of the CaNPR3 gene, filtering to 19 sequences and selecting four sgRNA sequences for genetic editing, which were: sgRNA 1 (5'-CATCAGGAAAAGACTTGAGT-3'), sgRNA 2 (5'-AGAACCTCAGACAACACACCTT-3'), sgRNA 3 (5'-CATCAGATTTGACCCTGGAT-3') and sgR-NA 4 (5'- TTCTGGAGGGAGGGAGAGAAATGAGGAGG -3'). The predicted secondary structures of the four selected sgRNAs present efficient structures for gene editing of the target gene, allowing it to recognize, interact with Cas9 protein and edit the target region. Keywords: Gene editing, guide RNA, CaNPR3, in silico.