Calopogonium Mucunoides Research Articles

PEMANFAATAN POME SEBAGAI PUPUK ORGANIK PADA LAHAN PASCATAMBANG BATUBARA The Application of POME (Palm Oil Mill Effluent) as Organic Fertilizer for Ex-Coal Mine Soil

Processing of palm oil generates enormous quantities of wastewater commonly called palm oil mill effluent (POME). The aim of the research was to evaluate the effect of POME as organic fertilizer on Melaleuca cajuputi seedling. The research was conducted at PT. Bukit Asam from November 2016 until March 2017. POME used was from PT. Bumi Sawindo Permai at Tanjung Enim, South Sumatera. POME from Fat pit, cooling pond, anaerob pond and maturity pond were applied to seedlings at nursery with different concentrations of POME Fat pit (625, 417, and 208 mL), Cooling pond (695, 463, dan 232 mL), Anaerob pond (738, 492, dan 246 mL), and Maturity pond (968, 645, dan 323 mL). The result showed that POME from Anaerob pond 246 mL increased the growth of M. cajuputi with plant high 47.35 cm and stem diameter 5.57 mm and total dry weight of CM (Calopogonium mucunoides) was 26.83 g.Key words: ex-coal mine soil, Melaleuca cajuputi, POME

Isolation of Rhizobium Bacteria from Forage Legumes for the Development of Ruminant Feed

The aimed of the study was to explore the presence of Rhizobium bacteria along the northern coast of Central Java, to develop a saline-resistant legumes. Rhizobium bacteria is a mutualistic bacterium capable of symbiosis with legumes so that legumes crop yields increase. The research begins with sampling of soil and root nodule of forage legumes along the Northern Coast of Central Java including Tegal, Pekalongan, Semarang, Demak, Pati. Soil samples were analysed for salinity, Total Dissolved Solids, and pH. Rhizobium bacteria were isolated from the acquired root nodule, then identified by biochemical test to ensure that the isolates obtained were Rhizobium bacteria. The results showed that the five districts/municipal sites sampled by the soil have very low salinity to very high levels. The highest level of soil salinity was found in Demak (Sayung) which has an electrical conductivity value (EC) of 17.77 mmhos/cm. The EC values of legumes overgrown soils showed a low salinity level while bare soils have high salinity levels. Feed crops legumes that could be found in the northern coast of Central Java were Centrosema pubescens, Calopogonium mucunoides, Leucaena leucocephala, and Sesbania grandiflora. The study obtained 6 kinds of isolates of rhizobium bacteria isolated from forage legumes, included 1) Centrosema pubescens isolated from Pekalongan, 2) Centrosema pubescens isolated from Tegal, 3) Calopogonium mucunoides isolated from Pekalongan, 4) Leucaenaleucocephala isolated from Tegal, 5) Leucaena leucocephala isolated from Semarang, 6) Sesbania grandiflora isolated from Tegal.

Soil microbial communities under cacao agroforestry and cover crop systems in Peru

Cacao (Theobroma cacao) trees are grown in tropical regions worldwide for chocolate production. We studied the effects of agroforestry management systems and cover cropping on soil microbial communities under cacao in two different replicated field experiments in Peru. In the first experiment, two agroforestry systems, Improved Traditional Agroforestry System (ITAS) and Improved Natural Agroforestry System (INAS), were compared. ITAS was a ‘slash and burn’ system in which all native vegetation was removed prior to replanting with cacao and other trees while INAS used selective removal of uneconomical trees followed by cacao planting. Soil microbial communities were analyzed by phospholipid fatty acid (PLFA) analysis and terminal restriction fragment length polymorphism (TRFLP) analysis. Soils in the ITAS system had altered microbial community structure and a lower Gram-negative to Gram-positive ratio when compared to soils in the INAS system. However, soil microbial community structure was also affected by a large soil pH gradient (three pH units) across this experiment. In the cover crop experiment, five cover crops, Arachis pintoi (perennial peanut), Calopogonium mucunoides (calopo), Canavalia ensiformis (jackbean), Centrosema macrocarpum (centro), and Callisia repens (callisia), and two controls (one with and one without nitrogen fertilization), were compared. Cover cropping with centro or perennial peanut increased the Gram-negative to Gram-positive ratio, while centro reduced the fungal biomass. Microbial community structure was significantly affected by cover cropping. Our results indicate that management systems and cover cropping can affect soil microbial community structure in tropical agroforestry systems, but the effects of soil edaphic properties must be considered as well.

Contribution of legumes on phosphoric absorption by Panicum maximum cv Riversdale in intercropping system

Phosphorus availability in soil as a mobile mineral influences forage growth. The purpose of doing this research is to enhance the soil phosphorus availability and grass production of Panicum maximum cv Riversdale by intercropping system with legums. The experiment was conducted based on with randomized design with five treatments of mixcropping of: (i) Gliricidia sepium + P. maximum; (ii) Calliandra calothyrsus + P. maximum; (iii) Leucaena leucocephala cv Taramba + P. maximum; (iv) Calopogonium mucunoides + P. maximum; (v) P. maximum as negative control. Plants were grown in pots with split-root technique using partition with a whole to allow some legume roots grew in the grass side. After growing for three months, on the legume areas 32P isotop solution was injected for 50 ml (11.23 μci/ml). After 21 days incubation samples were collected from both soil areas and both plants. The translocation of 32P was determined using geiger counter from legumes into the grass and the concentration of 32P was also determined in all plants. Forage productions was determined both in the legumes and grass. Result showed that soil phosphorus concentration in the grass area was significantly improved by intercropping with G. sepium and C. callothyrsus, while the one with L. leucocephala was similar, and the one with C. mucunoides was significantly lower than that of negative control (without legume). Detection of 32P showed that there was P translocation in the system. P. maximum grass production depending on kind of legumes (P<0.05) those with G. sepium was significantly higher, L. leucocephala and C. callothyrsus were not significantly higher, while the one with C. mucunoides was 26.2% lower from the control although not significantly. However, C. mucunoides produced the highest forage from the legume plant. It is concluded that grass-legume intercropping had a positive impact on phosphorus soil concentration in the grass area and grass production. Kind of legumes influenced the effectivity.

VARIETAL RESPONSE OF BAMBARA GROUNDNUT (VIGNA SUBTERRANEA) TO MULCHING AND AMF INOCULATION IN CENTRAL NIGERIA

A trial was carried out in pots at the University of Abuja, Teaching and Research Farm (TRF) to evaluate the response of Bambara groundnut varieties (TVSu 460, TVSu 617, TVSU 622) to mulch and mycorrhizal inoculation. Arbuscular mycorrhizal fungal inoculum (Glomus mosseae) and leguminous mulch (Calopogonium mucunoides Desv) were respectively applied at 10 g and 100 g per pot, 2 weeks after planting. The experiment was laid out in a factorial combination in a completely randomized design with 3 replications. Plant biomass and nodulation were assessed at harvest and subjected to analysis of variance using statistical package Genstat Discovery Edition. The study revealed that combined application of mulch and G. mosseae increased the fresh root weight for all varieties ranging from 10.3 - 62.5 %. G. mosseae inoculation significantly increased the nodulation and root weight of TVSu 617 and TVSu 622 but TVSu 460 was not favored by inoculation. The enhanced shoot and root weight recorded under mulch and mycorrhizae treatments on Bambara groundnut varieties particularly could be as a result of an improved soil environment occasioned by these treatments.

Estimating leaf area of warm‐season perennial legumes

AbstractRefining mathematical models may decrease labour and generate accurate estimates of leaf area in warm‐season perennial legumes. The aim of this study was to assess the use of mathematical models to determine the leaf area of four tropical forage legumes. Perennial legumes (Arachis pintoi, Stylosanthes spp., Calopogonium mucunoides and Neonotonia wightii) were collected, and an elliptical model and a corrected elliptical model were used to estimate leaf area. For comparison, linear models were also generated based on the leaflet area. The elliptical model was suitable for the initial forage peanut leaflets, while the corrected elliptical model proved suitable for estimating the area of the initial leaflets of all species as well as the terminal leaflets of forage peanut and stylo. The elliptical model could be used to estimate the area of both the initial and terminal leaflets only in stylo. Models were generated to estimate leaf area of all legumes requiring only the measurement of length and width from a single initial leaflet. In all of the studied legumes, the leaflet pairs were symmetrical, meaning the corrected elliptical model allows for the estimation of the leaflet area of each plant.

Selection and characterization of coal mine autochthonous rhizobia for the inoculation of herbaceous legumes

Coal open pit mining in the South of Santa Catarina state (Brazil) was inappropriately developed, affecting approximately 6.700ha. Re-vegetation is an alternative for the recovery of these areas. Furthermore, the use of herbaceous legumes inoculated with nitrogen fixing bacteria is motivated due to the difficulty implementing a vegetation cover in these areas, mainly due to low nutrient availability. Therefore, the aim of this work was to evaluate, among 16 autochthonous rhizobia isolated from the coal mining areas, those with the greatest potential to increase growth of the herbaceous legumes Vicia sativa and Calopogonium mucunoides. Tests were conducted in greenhouse containing 17 inoculation treatments (16 autochthonous rhizobia + Brazilian recommended strain for each plant species), plus two treatments without inoculation (with and without mineral nitrogen). After 60 days, nodulation, growth, N uptake, and symbiotic efficiency were evaluated. Isolates characterization was assessed by the production of indole acetic acid, ACC deaminase, siderophores, and inorganic phosphate solubilization. The classification of the isolates was performed by 16S rDNA gene sequencing. Only isolates UFSC-M4 and UFSC-M8 were able to nodulate C. mucunoides. Among rhizobia capable of nodulating V. sativa, only UFSC-M8 was considered efficient. It was found the presence of more than one growth-promoting attributes in the same organism, and isolate UFSC-M8 presented all of them. Isolates were classified as belonging to Rhizobium, Burkholderia and Curtobacterium. The results suggest the inoculation of Vicia sativa with strain UFSC-M8, classified as Rhizobium sp., as a promising alternative for the revegetation of coal mining degraded areas.

Effect of mulch types on nutrient composition, maize (Zea mays L.) yield and soil properties of a tropical Alfisol in Southwestern Nigeria

Field investigations were carried out to evaluate the influence of shrub and herbaceous mulch types on soil properties and nutrient composition of maize (Zea mays L.) at the Teaching and Research Farm of the Federal University of Technology, Akure in the rainforest zone of southwestern Nigeria in 2013 and 2014 respectively. The shrub mulch; Gliricidia sepium and Tithonia diversifolia, herbaceous mulch; Calopogonium mucunoides and Moringa oleifera were applied at the rate of 5 t ha-1. Application of NPK (20:10:10) fertilizer at the rate of 200 kg ha-1 was included as the standard treatment for the experiments. The treatments were laid out in randomized complete block design (RCBD) with three replication. The growth, agronomic parameters and nutritional quality of maize (Zea mays L.) were monitored and determined in both experiments. Results indicated that herbaceous mulch types and NPK fertilizer significantly (P<0.05) increased the number of leaves, plant height and leaf area when compared with the control in both years. Significant increases in yield parameters over the control were obtained for the NPK fertilizer treatment. In 2013 and 2014 cropping season NPK 20-10-10 treatment significantly produced the highest cob yield but was not significantly higher than the yield from Gliricidia sepium treatment in 2014. Soil organic carbon, total nitrogen (N), potassium (K), and exchangeable cations were positively stimulated by herbaceous mulches while residual phosphorus (P) was increased by NPK fertilizer treatment. Mulched treatments significantly increased crude protein, carbohydrate, nitrogen, phosphorus and ash content of maize grain in both years of cropping season thereby improving nutritional content of maize grain. Therefore, shrub and herbaceous mulch treatments applied at 5t/ha-1 could be applied alternatively in lieu of scarce and expensive inorganic fertilizer for improved maize yield, soil properties and nutrient composition.

Effect of Quercetin and Pectinase on Spore Germination and Hyphal Growth of Arbuscular Mycorrhizal Fungi and Biomass Production of Nicotiana tabacum L. and Calopogonium mucunoides desv

Effect of Quercetin and Pectinase on Spore Germination and Hyphal Growth of Arbuscular Mycorrhizal Fungi and Biomass Production of Nicotiana tabacum L. and Calopogonium mucunoides desv

Biological Nitrogen Fixation by Legumes and N Uptake by Coffee Plants

Green manures are an alternative for substituting or supplementing mineral nitrogen fertilizers. The aim of this study was to quantify biological N fixation (BNF) and the N contribution derived from BNF (N-BNF) to N levels in leaves of coffee intercropped with legumes grown on four family farms located in the mountainous region of the Atlantic Forest Biome in the state of Minas Gerais, Brazil. The following green manures were evaluated: pinto peanuts (Arachis pintoi), calopo (Calopogonium mucunoides), crotalaria (Crotalaria spectabilis), Brazilian stylo (Stylosanthes guianensis), pigeon pea (Cajanus cajan), lablab beans (Dolichos lablab), and velvet beans (Stizolobium deeringianum), and spontaneous plants. The experimental design was randomized blocks with a 4 × 8 factorial arrangement (four agricultural properties and eight green manures), and four replications. One hundred grams of fresh matter of each green manure plant were dried in an oven to obtain the dry matter. We then performed chemical and biochemical characterizations and determined the levels of 15N and 14N, which were used to quantify BNF through the 15N (δ15N) natural abundance technique. The legumes C. mucunoides, S. guianensis, C. cajan, and D. lablab had the highest rates of BNF, at 46.1, 45.9, 44.4, and 42.9 %, respectively. C. cajan was the legume that contributed the largest amount of N (44.42 kg ha-1) via BNF.C. cajan, C. spectabilis, and C. mucunoides transferred 55.8, 48.8, and 48.1 %, respectively, of the N from biological fixation to the coffee plants. The use of legumes intercropped with coffee plants is important in supplying N, as well as in transferring N derived from BNF to nutrition of the coffee plants.

Manure effect on the incidence of rose diseases in the Integrated Production System

ABSTRACT Deficiency, excess or imbalance in the combinations of nutritional elements can influence the response of plants to pathogen infection by either increasing the level of defense or favoring the occurrence of diseases. The rose is susceptible to several pathogens and the consumer market requires flower stalks with no level of damage. Therefore, in the production of roses the application of pesticides is performed in a preventive and intensive way, which causes environmental contamination. This study evaluated the effects of chemical fertilization management and intercropping with green manure on the incidence and severity of downy mildew and powdery mildew in rosebushes grown in an Integrated Production System. The experiment was conducted in a greenhouse with 'Carolla' rosebushes. The experimental design was a randomized block with split plot in space, with eight treatments and four replications. The treatments consisted of four percentages of chemical fertilizer (25%, 50%, 75% and 100%), based on fertilization recommended for culture of rosebushes in the state of Minas Gerais, versus the presence or absence of green manure (Calopogonium mucunoides). Treatments that did not receive 100% of the chemical fertilizer had been incremented with two types of bio-fertilizers applied monthly, Bokashi (16 g/plant, applied to soil) and Supermagro (5% applied to leaves). Assessments of disease were carried out weekly on the central leaves of the productive flower stalks. In the integrated management of disease, preventive applications were made with alternative products and biological pesticides, such as neem oil (Azadirachta indica), sodium bicarbonate, bordeaux mixture, infusion of Equisetum sp., raw milk, silicon and bio-fertilizers. The alternative pesticides were efficient; however, despite reducing the frequency of application, spraying with chemical pesticides was necessary. None of the treatments related to chemical fertilization and intercropping with green manure influenced the incidence and severity of downy mildew and powdery mildew in 'Carolla' rosebushes.

Agronomic characteristics and yield of organic maize straw intercropped with perennial green manures

ABSTRACT Maize intercropped with perennial green manure is an option to promote soil coverage, control weeds and recycle soil nutrients, in an organic system. This study aimed at evaluating the agronomic characteristics and yield of grains and organic maize straw intercropped with perennial green manures sown at different maize growth stages. A 3 x 2 + 1 factorial design was used, with three perennial species of green manure - calopogonium (Calopogonium mucunoides Desv.), tropical kudzu [Pueraria phaseoloides (Roxb.) Benth] and perennial soy [Neonotonia wightii (Wight &amp; Arn) Lackey] - and two green manure sowing times - at the maize V4 (four expanded leaves) and VT (bolting) stages - plus a control treatment (maize monoculture). A randomized blocks design, with four replications, was used. Soil coverage, production of green manures dry matter and weeds, and maize growth and production variables were evaluated. The sowing of green manures at the V4 stage had a higher percentage of soil coverage, in relation to the VT stage. Calopogonium, when compared to the other green manure species, had the highest percentage of soil coverage (35.63 %) and dry matter (1.0 Mg ha-1). Perennial green manures grown intercropped with maize did not affect growth, grain yield and maize straw. However, they were not effective in suppressing weeds.

Utilizing coir geotextile with grass and legume on soil of Cerrado, Brazil: An alternative strategy in improving the input of nutrients in degraded pasture soil?

Inappropriate management practices on Cerrado soil cause some of the most important negative impacts on this ecosystem, especially converting native vegetation on pastures and crops plantation. Significantly losses of natural Cerrado have been reported and current remaining natural vegetation area is smaller than other land cover. Therefore, sustainable practices are required to recover and protect the biome. For that reason this work aimed to evaluate the effect of grass and legumes species on coir geotextile during a seasonal cycle of rain and drought on soil of abandoned pasture of Cerrado in southeastern Brazil. Several soil parameters were examined, including their physical and chemical compositions, microbial biomass-C (SMB-C), and microbial viability. The plant species used were Andropogon gayanus (CGG—Coir Geotextile Grass) and Calopogonium mucunoides and Arachis pintoi (CGL—Coir Geotextile Legumes). In general, CGL had more beneficial effects on soil fertility than CGG in terms of total soil organic carbon and total nitrogen. The CGL treatment showed SMB-C values twice those of the control, and 28% higher than CGG. Microbial populations (actinobacteria and fungi) increased in CGG and CGL, being the better improvement on microbial growth observed on CGL. Actinobacteria was the most prevalent group both on the soil surface and at greater depths. Our results indicated that Calopogonium mucunoides is a very aggressive species and inhibits the growth of Arachis pintoi. The appropriate use of geotextiles, associated with non-weed and non-alien vegetation, represents a viable technique for improving total SOC and SMB-C, nutrients as nitrogen and phosphorus, and increase the microbial populations.

PH effects on nodulation and biological nitrogen fixation in Calopogonium mucunoides

Calopogonium mucunoides Desv. is able to form nodules, root organs in which biological nitrogen fixation takes place, after a symbiotic interaction with soil bacteria known as rhizobia. Such distinct advantage of some legume species faces different environmental abiotic factors such as acid and alkaline pH conditions of soil. Nodulation and symbiotic nitrogen fixation response in different pH ranges were determined under greenhouse conditions. Plants were cultivated in vermiculite and treated with nutritive solution adjusted to pH 4.0, 5.5, and 7.0, and after three months, the following variables were measured: nodule number, nitrogen fixation, tissue protein, amino acids, total ureides, allantoin, and allantoate. The number of nodules and nitrogen fixation were enhanced under acidic conditions, but nitrogenase activity was drastically decreased at pH 7.0. Acidic conditions decreased the amount of protein, amino acids, total ureides, allantoate, and allantoin in leaves and nodules, but at pH 5.5, only protein content was decreased. Symbiosis with C. mucunoides and biological nitrogen fixation were kept under acidic conditions, but it was negatively affected under conditions that are near to neutral. It is reasonable to conclude that the association between C. mucunoides and nitrogen-fixing bacteria from “Cerrado” evolved in this context, which is supported by the difficulties faced to keep interaction under pH near neutrality.

Morphology of Some Species in the Subfamily Papilionoideae

Morphological study of ten species in the subfamily Papilionoideae was carried out with the view to documenting diagnostic characters that would distinguish or group the species. The species studied belong to four tribes, namely: tribe Desmodieae – Desmodium tortuosum (Sw.) DC., Desmodium scorpiurus (Sw.) Desv., Desmodium adscendens (Sw.) DC., tribe Phaseoleae – Cajanus cajan (L.) Millsp., Calopogonium mucunoides Desv., Centrosema molle (Mart.) ex. Benth., Mucuna pruriens (Linn.) Walp., Vigna unguiculata (Linn.) Walp., tribe Crotalarieae – Crotalaria retusa Linn., tribe Robinieae – Gliricidia sepium (Jacq.) Walp. Qualitative and quantitative traits which had not been documented in previous works, especially in Nigeria, were studied. These include plant life span; leaf/leaflet apex, base, margin and pubescence; stem type, colour, shape and pubescence; sepal colour and pubescence; nature of margin of petal standard and presence or absence of pedicel; fruit colour, pubescence, tip and shape; seed colour, shape, surface and presence or absence of prominent hilum on the seed; number of seeds per fruit; pedicel length; length and width of petal standard, keel and wing. Characters of taxonomic value documented in this study were leaf type, leaf shape, leaf base, petiole type, stem type, seed shape, petal standard length, petal keel length and petal wing width. Data were subjected to one - way analysis of variance using Duncan’s multiple range test. It was noted that the important characters that can be used in establishing taxonomic relationship in the sub-family Papilionoideae were leaf type, leaf shape, leaf base, petiole type, stem shape, petal colour, petal margin and seed shape.

First Report of Macroptilium yellow spot virus in Desmodium glabrum in Brazil

HomePlant DiseaseVol. 100, No. 3First Report of Macroptilium yellow spot virus in Desmodium glabrum in Brazil Previous DISEASE NOTES OPENOpen Access licenseFirst Report of Macroptilium yellow spot virus in Desmodium glabrum in BrazilR. S. Fontenele, R. Poppiel, V. O. R. L. Matos, F. Costa, J. C. Faria, and S. G. RibeiroR. S. FonteneleSearch for more papers by this author, R. PoppielSearch for more papers by this author, V. O. R. L. MatosSearch for more papers by this author, F. CostaSearch for more papers by this author, J. C. Fariahttp://orcid.org/0000-0002-8125-7654Search for more papers by this author, and S. G. RibeiroSearch for more papers by this authorAffiliationsAuthors and Affiliations R. S. Fontenele R. Poppiel V. O. R. L. Matos , Embrapa Recursos Genéticos e Biotecnologia, Brasília, Brazil F. Costa , Instituto Agronômico de Pernambuco, Recife, Brazil J. C. Faria , Embrapa Arroz e Feijão, Goiânia, Brazil S. G. Ribeiro , Embrapa Recursos Genéticos e Biotecnologia, Brasília, Brazil. Published Online:29 Jan 2016https://doi.org/10.1094/PDIS-09-15-1086-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Macroptilium yellow spot virus (MaYSV) is a begomovirus (family Geminiviridae) described infecting common beans (Phaseolus vulgaris) and other leguminous noncultivated hosts in northeastern Brazil (Ramos-Sobrinho et al. 2014; Silva et al. 2012). In a recent virus survey in common beans and associated noncultivated plants in the state of Pernambuco, four Desmodium glabrum plants presenting yellow mosaic, leaf curling, rugosity, and leaf deformation symptoms were collected at the periphery of a bean field in Caruaru, in August 2013. Total DNA was extracted and a PCR reaction using universal degenerate begomovirus primers pAL1v1978 and pAR1c496 (Rojas et al. 1993) amplified fragments of the expected size of ∼1.2 kb. The sequences of the amplicons were nearly identical, and BLASTn comparisons suggested the infection of the four plants by MaYSV. To obtain full-length viral DNA components, genomic DNA from two samples was amplified by rolling-circle amplification (RCA) (Inoue-Nagata et al. 2004) and concatemer products were digested with HindIII and KpnI restriction enzymes rendering ∼2.6-kb fragments which were cloned into pBluescript II KS(+). Four independent DNA-A clones obtained from the two samples were sequenced using primer walking and had identities higher than 99% among them (GenBank Accession Nos. KT779561, KT779562, KT779564, and KT779565). Species Demarcation Tool (SDT) (v.1.0) (Muhire et al. 2014) analysis resulted in identities varying from 87 to 99% with DNA-A from different MaYSV isolates from common bean, lima bean, Macroptilium lathyroides, Calopogonium mucunoides, and Canavalia spp. collected in the states of Alagoas, Paraíba, and Sergipe (Silva et al. 2012), confirming that the D. glabrum plants were infected by MaYSV. DNA-B was amplified by PCR from total plant DNA using primers MaYSV-B-F (5′ACATACGTAATTGAAGACTGTTGGT3′) and MaYSV-B-R (5′ACGTACGTAGAGTCTCAGCGTGATG3′) overlapping in a SnabI restriction site present in most MaYSV DNA-B cloned in our laboratory. The resulting ∼2.6-kb PCR fragments were cloned into pTOPO2.1. Four DNA-B clones (KT779558, KT779559, KT779560, and KT779563) retrieved from the same plants from which DNA-A clones were obtained were completely sequenced. The DNA-B clones had identities ranging from 92 to 100% among them and shared 92 to 99% identity with genomic MaYSV DNA-B isolates from common bean and Macroptilium spp. Desmodium glabrum is a widely distributed neotropical plant occurring from Mexico to Argentina. In Brazil, D. glabrum can be found as invasive plants in northeastern, central, and southeastern regions in open fields, pasture areas, riparian forests, and also in anthropized and degraded areas. To date, MaYSV has been described only in Brazilian northeastern states; however, pervasive plants such as D. glabrum as well as other reported leguminous noncultivated MaYSV hosts may facilitate the spread of MaYSV to cultivated legume crops such as common bean and soybean in the main cultivated areas.

English

The search management for alternatives that reduce the use of mineral fertilizers is important for agricultural sustainability. Therefore, we sought to identify two legume species that are grown as cover crops with banana (Musa spp.) cultivar Prata-ana and spontaneous plant compositions that enable further reduction in the use of inputs. A randomized block design in a split plot arrangement with five replications was used. The plots were formed at four irrigation depths: 50, 75, 100 and 125% of crop evapotranspiration. Subplots were formed by three plant cover types associated with bananas: Tropical kudzu (Pueraria phaseoloides Benth.), calopo (Calopogonium mucunoides Desv.) and spontaneous vegetation, which primarily consist of Panicum maximum Jacq. The biomass production of the cover crops was measured 105, 200 and 400 days after planting (DAP); the total input of N was also measured (105 DAP). The measurements of leaf gas exchange and relative index of chlorophyll were recorded at 200 DAP. Tropical kudzu is better acclimated to a shaded environment, as demonstrated by evaluations of dry matter production, leaf gas exchange and the input of N. Thus, this crop may be a good alternative for supplying N to bananas irrigated under Brazilian semi-arid conditions. Key words: Water management, Musa sp., cover crops, photosynthesis.

Evaluation of Tropical Grasses on Mine Revegetation for Herbage Supply to Bali Cattle in Sorowako, South Sulawesi, Indonesia

The aim of this study was to evaluate forage quality and absorption of heavy metals in grasses of grazing lands in mine revegetation area. Grazing land was dominated by Brachiaria decumbens (BD), which occupied about 87% in the pasture’ syielding ability of 14.8 Mg DM/ha/year, followed by Centrocema pubescens (CP), Calopogonium mucunoides (CM) and Imperata cylindrica (IC) at 6, 4 and 3%, respectively. Both of in vitro dry matter digestibility and organic matter digestibility were the highest in BD and CM, followed by CP and the lowest in IC. Structural carbohydrates of cellulose and hemicelluloses were the highest in BD, contrary to Acid Detergent Lignin (ADL) concentration, which was the highest in IC and the lowest in BD, while CP and CM showed the middle in ADL and cellulose concentrations among the four forage species. Heavy metals of nickel (Ni), chromium (Cr) and lead (Pb) were detected in the order of Ni > Cr > Pb in the grasses examined and harvested on mine-revegetation area in Sorowako, Indonesia.

Ammonium Oxidizing Bacteria Activity and Nitrification Rate in Oil Contaminated Wetland Soil under Remediation with Nutrient Supplements and Leguminous Plants

Previous investigation on the impact of crude oil on the growth of tropical legumes and its effect on nitrogen dynamics in wetland ultisol showed that oil contamination reduced N uptake by plants but increased N accumulation in soil microbial biomass. Moreover, the presence of hydrocarbons widened the C/N ratio in soil and led to more available N being immobilized by soil microorganisms. The present study was carried out to evaluate the activity of ammonium oxidizing bacteria (AOB) and their nitrification potential rate (NPR) in wetland soil under a remediation course. Mineralization studies showed that ammonium-N levels decreased while nitrate-N increased progressively in the uncontaminated soil (control) cultivated with leguminous plants (cover crops) during the 12 weeks remediation period. However, the remediated soils were affected in different ways. The experimented soil cultivated with Centrosema pubescens had higher mineral nitrogen (NH4-N, NO3-N, NO2-N, Total N and P) than soil cultivated with Calopogonium mucunoides and Pueraria phaseoloides. AOB counts recorded were in the ranged, 2.25 × 102 - 2.66 × 105, 2.31 × 102 - 2.11 × 104 and 4.25 × 102 - 2.98 × 104 respectively. The highest NPR was found in uncontaminated soil (11.68 - 60.92 nmol N/g dry weight soil (DWS)) followed by soil treated with poultry manure (9.65 - 24.86 nmol N/g DWS/h), NPK (7.88 - 39.45 nmol N/g DWS/h) and in the oil-contaminated soil (0.11 - 1.87 nmol N/g DWS/h). The relations between NH4-N concentration and NPR in soil cultivated with Centrosema (r = 0.852), Calopogonium (r = 0.745) and Pueraria (r = 0.722) were positively significant at 95% confidence limit. Similarly the relations between AOB density and NPR for Centrosema (r = 0.654; P = 0.05), Calopogonium (r = 0.588; P = 0.05) and Pueraria (r = 0.518; P = 0.05) were significant. The findings imply that nitrification potential of crude oil- contaminated soil differs significantly with the nutrient amendment/treatment technique adopted for remediation. Our research has shown that treatment of uncontaminated soil with cover crops increased AOB and nitrification rate. More so, contaminated soil treated with poultry manure and NPK-fertilizer, cultivated with covers crops resulted in remarkable reduction in hydrocarbons content and increased population of nitrifiers and nitrification potential rates of wetland soil over time. However, contaminated soil treated with poultry manure and cultivated with Centrosema pubescens is more effective in bioremediation of crude oil-contaminated soil.

Temperature and humidity of soil covered with perennial herbaceous legumes in the semiarid region of Minas Gerais, Brazil

Agricultural sustainability of areas in semiarid region, is directly related to soil management, emphasizing especially the continuous coverage strategy. In this sense, this study aimed to evaluate the influence of perennial legumes on soil coverage, temperature and moisture in the semiarid region of Minas Gerais, Brazil. The study used a randomized blocks experimental, with 9 m 2 , design and treatments consisted of bare soil cultivated with the following legumes: tropical kudzu ( Pueraria phaseoloides ), calopo ( Calopogonium mucunoides ), perennial peanut ( Arachis pintoi ), perennial soybean ( Glycine wightii ) and stylosanthes Campo Grande (mixture of Stylosanthes capitata and Stylosanthes macrocephala ), with four replications. Soil coverage, temperature and moisture rates were evaluated. Due to the soil protection provided by the biomass production, the use and management of cover plants in semiarid region of Minas Gerais contributed to the temperature reduction and to the conservation of soil moisture, both essential for the agricultural production in this region. Calopo, tropical kudzu and perennial peanut provided greater soil coverage and, consequently, they provided greater reduction in temperature and higher moisture retention in soil. In more advanced stages of the cycle, the perennial soybean also provided good soil coverage, temperature reduction and moisture retention in the soil.