Branch Dieback Research Articles

First Report of Dieback of Salix acmophylla Caused by Paecilomyces formosus in Iran.

Salix acmophylla Boss. (Brook willow), is native to Iran and mainly grows in natural riparian landscapes. It has excellent potential to use in erosion and phytoremediation projects. Since 2018, dieback has been observed on S. acmophylla at the Gilan-e Gharb forest (34°05'59.9"N, 46°00'52.6"E) in Kermanshah province, Iran. Affected trees showed wilting and yellowing of leaves, cankers, branch dieback, and decline (Fig. 1A, B). Small pieces (5 mm2) from the canker margins of 10 affected tree branches were surface sterilized with 75% ethanol for 30 s and 1% NaClO for 90 s. Subsequently, samples were rinsed three times with sterile H2O, plated on potato dextrose agar (PDA) supplemented with 100 mg/l streptomycin sulfate and 25 μg/mL chloramphenicole, and incubated at 25°C for 5 days. The same fungus was isolated from all samples. Pure cultures were obtained by monosporic isolation. A representative isolate, RU-PaMa-S1, was used for morphological and molecular characterization and deposited in the Fungal Reference Collection of the Ministry of Jihad-e Agriculture at the Iranian Research Institute of Plant Protection, Tehran, Iran. Radial growth of colonies on PDA and Czapek yeast extract agar (CYA) were 30 and 25 mm after seven days at 25 °C in the dark, respectively. Fungal colonies grew more rapidly on malt extract agar (MEA), and reaches a diameter of about 70 mm within 7 days at 25 °C in the dark. Color of colony on MEA, PDA, and CYA was light yellow to yellow-brown, which gets darker upon aging. In biochemical assay, our isolate grow and produced acid in culture on creatine sucrose agar medium. The conidiophore was irregularly branched out with one to seven phialides. The phialides were in whorls or solitary, flask shaped with cylindrical bases, and narrow apices. Conidia were one-celled, hyaline to yellow brown in mass, smooth, and ellipsoidal to cylindrical with truncate ends. Conidia were 3.0-9.6 (4.5) × 1.7-4.0 (2.6) µm (n = 50). Chlamydospores were present in two week old cultures. The morphology matched the description of Paecilomyces formosus (Sakag., May., Inoue and Tada) Houbraken and Samson (Samson et al., 2009). For an accurate identification, genomic DNA of RU-PaMa-S1 was extracted to amplify ITS regions, and β-tub gene with ITS1/ITS4 (White et al. 1990), and βt2a/βt2b (Glass and Donaldson 1995) primers, respectively. The sequences were deposited in GenBank (ITS: OL891502, β-tub OL944475). A BLAST search of GenBank showed that the ITS, and β-tub sequences of RU-PaMa-S1 were similar to those of Paecilomyces formosus. Baed on the multigene phylogeny and morphology, RU-PaMa-S1 isolate was identified as Paecilomyces formosus (Fig. 2). Molecular analyses based on sequencing of the ITS region, and parts of the β-tubulin and calmodulin genes, showed that P. formosus may be composed of three species, including P. maximus, P. lecythidis and P. formosus. However, the three species could be distinguished by only molecular data and not by microscopical examination (Samson et al. 2009). To fulfill Koch's postulates, 10 detached and 10 attached healthy branches from two 20-year-old S. acmophylla plants at the Gilan-e Gharb forest in Kermanshah province, Iran, were inoculated with 5-mm mycelial plugs of 5-day-old culture of RU-PaMa-S1 isolate (Fig. 1 C). Control branches were treated with agar plugs. The detached inoculated branches were stored in sterilized glass jar containing moist sponge and incubated at 25-30°C for 35 days until the appearance of the canker symptoms. After 35 days, inoculated branches were cut from the trees and transferred to the laboratory to check disease development and re-isolation of the pathogen. All inoculated points on detached and intact branches showed lesions similar to those observed on naturally infected trees, whereas controls were symptomless (Fig. 1 D, E). The same fungus was re-isolated from these lesions. P. formosus has been reported to infect a broad range of hosts, including Amygdalus scoparia, Malus domestica, Pistatia vera, and Querqus brantii (Sabbagh and Khosravi Moghaddam 2016; Sabernasab et al. 2019; Azizi et al. 2020). This is the first report of P. formosus on S. acmophylla in Iran and in the world. This finding provides crucial information on this high-risk disease to S. acmophylla and other forest trees and basis for identifying management strategies.

First Report of Root Rot Caused by Phytophthora acerina on Metasequoia glyptostroboides in China.

Metasequoia glyptostroboides Hu & W. C. Cheng (Taxodiaceae), commonly called the Chinese redwood or dawn redwood, is a well-known "living fossil" and rare relict plant species endemic to China, which has been successfully cultivated throughout the world (Ma 2007). In July to September 2020, trees of Chinese redwood which were more than thirty years-old, showed symptoms of decline and death associated with branch dieback, root and collar rot (Fig. 1) in Yangtze River shelter-forests of Jiangling County in Hubei Province, China (112°15'19″E, 30°11'56″N; 40m). Diseased roots and rhizosphere soils were collected in September 2020 and April 2021. Using the baiting method, a homothallic Phytophthora sp. was recovered consistently from diseased roots and soil samples of Chinese redwood. All the isolates of this Phytophthora sp. formed similar colonies on V8 agar and corn meal agar (Fig. 2), and then three representative isolates (L4-5-4, L4-5-5 and L4-5-6) were randomly selected for morphological and molecular identification. In distilled water, semipapillate persistent sporangia were borne in simple sympodial branched sporangiophores. Sporangia were predominantly ovoid (Fig. 3a, d and f), but other shapes were observed including subglobose (Fig. 3b), limoniform (Fig. 3c) or distorted shapes (Fig. 3e), averaging 44.1 ± 7.7 µm (n=102) in length and 32.8 ± 5.2 µm (n=102) in width, with narrow exit pores of 8.0 ± 1.4 µm (n=93) and a length/breadth ratio of 1.3 ± 0.10 (n=102). Chlamydospores were not observed. Oogonia were globose or subglobose, 20.51 to 40.15 µm (av. 33.1 ± 3.9 µm) (n=119) in diameter, with smooth walls and paragynous antheridium (Fig. 3g-i). Oospores were globose or subglobose in elongated oogonia with medium wall thickness of 1.9 ± 0.5 µm (n=36), aplerotic or plerotic and 16.9 to 32.6 µm in diameter (av. 26.6 ± 3.8 µm) (n=40). According to the above morphological characteristics, this Phytophthora sp. was placed in Waterhouse's (1963) group III. The sequences of the internal transcribed spacers (ITS) region of nuclear ribosomal DNA of each isolate (GenBank Accession No. OK087320, OK087321 and OK087322) was 760 bp and had identity of 99.84% with three P. acerina isolates (JX951285, JX951291 and JX951296), while the 800 bp β-tubulin (BTUB) sequences (OK140540, OK140541 and OK140542) showed 99.97% homology to the sequence of P. acerina (KC201283) (Ginetti, Moricca and Squires 2014) (Table 1). The ML phylogenetic trees were established by comparing ITS and BTUB sequences of three Phytophthora strains (L4-5-4, L4-5-5 and L4-5-6) with reference sequences of isolates of Phytophthora in ITS and BTUB in GenBank (Fig. 4-5). Based on the morphological and molecular characteristics, the strains were identified as namely P. acerina. In addition, pathogenicity assays were performed with one of the three strains (L4-5-4) on M. glyptostroboides using both one year old and three years old seedlings. Inoculum was prepared by subculturing agar plugs from edges of CMA cultures into V8 medium plates, incubating at 20 ℃ in darkness for 10 days. Six seedlings planted in pots filled with sterilized soil were inoculated by mycelium plug at root collar and stem wounded by a 8 mm diameter puncher. Six control seedlings were inoculated in the same manner as above, and sterile agar plugs were used. After 35 days, inoculated seedlings all had necrotic lesions at the inoculation sites, and some seedlings had the symptoms of foliage blight and dieback, whereas control seedlings remained healthy (Fig. 6). The number of fibrous roots after inoculation was significantly less than the control, and the roots of inoculated seedlings blackened or even rotted, while there were no obvious symptoms in the control (Fig. 7). Phytophthora isolates recovered from the symptomatic tissues of artificially inoculated plants were identical to isolate L4-5-4 in morphological characters and ITS sequencing. This is the first report of P. acerina causing root rot on the Chinese redwood in China. As only the seedlings were inoculated, further research is needed to address the epidemiology and pathogenicity of P. acerina to adult trees of Chinese red wood.

First Report of Pseudophaeomoniella oleae Causing Wood Streaking and Decay on Olive Trees in Greece.

A survey was conducted in olive orchards (Olea europaea L., cv Koroneiki) showing severe decline in Milatos and Ierapetra (Lasithi, Crete, Greece) in November 2017 and January 2019, respectively. Diseased trees exhibited wilting, yellowing of leaves, twig and branch dieback, and internal discoloration of vascular tissue. Insect infestations were commonly associated with these symptoms. A yeast-like fungus was consistently isolated from discolored vessels previously surface-disinfested with 95% ethanol, on acidified potato dextrose agar (APDA). The fungus yielded several dark brown to black, globose to oval pycnidia with dimensions 120-330 × 90-300 μm (average 179.6 × 143.9 μm), after 25 days of growth on APDA. Emerging colonies were transferred to new PDA and their growth rate was 2.21 mm/day at 24 °C in the dark. The sparse aerial mycelium was initially white, turning into beige-pinkish in the centre after 21 days of growth on PDA. Microscopic observations revealed hyaline, smooth, ampulliform conidiophores, bearing conidia solitary or in slimy heads. Conidia were 1-celled, hyaline, smooth, subcylindrical with obtuse ends, 1.25-5.75 × 0.75-2.00 μm (average 3.12 × 1.16 μm) in size. Light to dark brown pycnidia, semi-immersed in PDA, with dimensions 150-490 × 90-320 μm (average 297.7 × 231.0 μm) were evident in 3-week-old cultures. Colony morphology and microscopic features were similar to Pseudophaeomoniella oleae (Crous et al. 2015). DNA from two representative isolates (EML1 and DRAGVR1) was extracted and their internal transcribed spacer region (ITS) of ribosomal DNA, actin (ACT) and translation elongation factor 1-alpha (TEF1-α) genes were amplified using the primer pairs ITS1/ITS4 (White et al. 1990), ACT-512F/ACT-783R and EF1-728F/EF1-986R (Carbone and Kohn 1999), respectively. PCR products were sequenced and deposited in GenBank (accession Nos. MZ854242-MZ854243, OK143463-OK143464 and OK143465-OK143466). BLAST search revealed high similarity to GenBank sequences of the ex-type strain of P. oleae for ITS (≥99.50%, NR_137966.1 and KP635972.2), ACT (100%, KP635974.1), and TEF-1a (98.32%, KP635968.1). Based on morphology and phylogenetic analysis of the ITS region, the fungus was identified as P. oleae. Ten 3-year-old olive trees of each of the cvs Amfissis and Koroneiki were artificially inoculated by drilling a 3-mm-diameter hole into the trunk and injecting 50 μl of a 1 × 107 ml-1 conidia suspension of the isolate DRAGVR1 (Markakis et al. 2017). Another ten trees of each cv treated similarly with sterilized distilled water served as controls. Potted trees were kept under ambient conditions. Fourteen months post inoculation, longitudinal and transverse sections of inoculated trunks revealed wood discoloration extending above and below the inoculation point in both cultivars, whereas no leaf symptoms were observed. P. oleae was steadily re-isolated from symptomatic wood tissue and identified by colony morphology. Neither symptoms nor positive isolations were observed in controls. To our knowledge, this is the first report of wood streaking and decay caused by P. oleae in olive trees in Greece. Although the fungus has been isolated previously from decayed olive trees showing vascular wilt in Italy (Crous et al. 2015), this is the first experimental evidence of the pathogenic potential of the species on olive trees worldwide. This disease could potentially be an increasing problem in olive tree growing areas and result in severe crop losses. Hence, effective management practices should be investigated and applied.

First Report of Collar Canker and Dieback of Camellia sinensis Caused by Fusarium solani Species Complex in Henan, China.

Tea (Camellia sinensis) is a significant commercial crop cultivated in China. A collar canker and dieback disease of tea has recently been reported in Sri Lanka (Sinniah et al. 2017). During the Spring of 2020, tea bushes with symptoms of fewer leaves, yellowing of leaves with cankers having cracks and peeling of bark, premature falling in the early stage and progressive dieback of branches followed by death of the whole tree that were partially covered with white-colored mold were observed in tea plantations over a 200 hm2 area in Xinyang, Henan Province, China (Figure 1A). To determine the causative agent, dead tea plant stems with white-colored mold were collected, cut into small pieces and surface-sterilized with 75% ethanol, followed by rinsing twice with sterile distilled water and then air-drying. The pieces were placed on potato dextrose agar (PDA) and incubated at 28℃ for 7 days. A total of 19 fungal colonies were isolated and transferred to fresh PDA. Single-spore isolates were made for each and all were observed to produce white flocculent mycelium with the reverse side being pale yellow on PDA. The appearance of a representative strain, XYWLD-07, on PDA is shown (Figure 1B and 1C). Macroconidia (14.26 to 42.13 × 3.53 to 6.79μm) and microconidia (6.93 to 11.85 × 2.72 to 6.33μm) were observed in the cultures (Figure 1E). The genomic DNA from XYWLD-07 was extracted and the internal transcribed spacer region (ITS) of ribosomal DNA, beta-tubulin, translation elongation factor 1-alpha (TEF- 1α), RNA polymerase I beta subunit (RPB1) and RNA polymerase II beta subunit (RPB2) genes were amplified using the primer pairs ITS1/ITS4 (5'- CTTGGTCATTTAGAGGAAGTAA -3'/5'- TCCTCCGCTTATTGATATGC -3') (Gardes & Bruns 1993) , Bt-F/Bt-R (5'- AACATGCGTGAGATTGTAAGT -3'/5'- TCTGGATGTTGTTGGGAATCC -3'), EF-1/EF-2 (5'- ATGGGTAAGGARGACAAGAC -3'/5'- GGARGTACCAGTSATCATGTT -3'), RPB-1F/1R (5'- TTTTCCTCACAAAGGAGCAAATCATG -3'/5'- GTTCACCCAAGATATGGTCGAAAGCC -3') and RPB2-5F2/11aR (5'- GGGGWGAYCAGAAGAAGGC -3'/5'- GCRTGGATCTTRTCRTCSACC -3') (O'Donnell et al. 2010), respectively. The PCR products were sequenced and deposited in GenBank (Accession Nos. MZ411431, MZ439920, OL982608, OM069738 and OM265212), respectively. BLASTn against NCBI nr and Fusarium-ID database revealed that the ITS sequence had 99.65% homology with BLAST sequences of F. solani (GenBank Accession Nos. JN882257.1 and JN882255.1), the beta tubulin sequence had 96.92% similarity with BLAST sequences of F. solani (KU983876.1 and MN692929.1), TEF- 1α gene sequence had 99.15% and 99.29% homology with BLAST sequences of F. solani (KM096405.1 and KM096409.1), RPB1 gene sequence had 99.32% and 99.41% homology with BLAST sequences of F. solani (KU974331.1 and MT305119.1) and RPB2 gene sequence had 98.15% and 98.20% homology with BLAST sequences of F. solani (MT305182.1 and MT305177.1), respectively. Furthermore, TEF- 1α, RPB1 and RPB2 gene sequences had more than 98.52% match with F. solani sequences in Fusarium-ID databases. To test for pathogenicity, the inoculum was grown for 10 days at 25°C on 200g sterilized boiled wheat grain and sand (3:1, v/v) with 20-ml spore suspension (107 conidia /ml) of strain XYWLD-07. Two-year tea seedlings were planted in pots of autoclaved soil with 5% (m/m) strain XYWLD-07 inoculum but controls were grown in autoclaved soil with only sterile wheat/sand mix. The experiment was performed five times. After 30 days, collar canker symptoms appeared on inoculated tea branches, whereas the control was asymptomatic (Figure 1F). The fungal pathogen was reisolated from the symptomatic tea tissues and again identified as F. solani based on the above analysis of the five gene sequences (Figure 1D). F. solani has been previously identified as causal agent of collar canker and dieback of C. sinensis in Sri Lanka (Sinniah et al. 2017) and India (Sarmah et al. 2017).To our knowledge, this is the first report of F. solani causing collar canker and dieback of C. sinensis in China. As this disease could result in death of tea bushes, effective management strategies should be investigated and applied.

First report of fig tree dieback caused by Lasiodiplodia theobromae in Tunisia

AbstractIn Tunisia, common fig (Ficus carica L., Moraceae) is a very ancient fruit crop, very important and still regaining interest. It is cultivated throughout Tunisia from the south to the north and from the east to the west. In July 2020, a severe unusual branch dieback and stem canker was observed on fig cv. ‘Zidi’ trees in a commercial orchard in north‐eastern Tunisia. Disease incidence was 50% and symptoms observed on the 10‐year‐old infected trees included wilt, defoliation, branch dieback and trunk and shoot cankers. The current study aimed to characterize the pathogen (s) associated with observed fig dieback and to study their pathogenicity. The causal agent has been identified as belonging only to the species Lasiodiplodia theobromae based on morphological characters and phylogenetic analyses, using combined sequences of ITS, tef1 and β‐tubulin (tub2) genes. Pathogenicity tests performed on 1‐year‐old detached and green shoots demonstrated that L. theobromae was pathogenic to common fig cv. ‘Zidi’. Symptom development was visible after 7–15 days of incubation at 25°C showing the aggressive behaviour of L. theobromae towards fig shoots. Cvs. ‘Chetoui’, ‘Zidi’, ‘Bidhi Bghal’ and ‘Bither Abyadh’ were less susceptible compared to the more susceptible cvs. ‘Soltani’ and ‘Bidhi 2’. To our knowledge, this study is the first report on common fig canker and dieback disease caused by L. theobromae in Tunisia and Africa. Considering the severe and rapid progress of this disease, prevention and management strategies should be implemented urgently to reduce its incidence and reduce fig tree losses.

First Report of Dieback Caused by Phytophthora ramorum on Golden Chinquapin, Chrysolepis chrysophylla, in California.

Golden or giant chinquapin, Chrysolepis chrysophylla (Fagaceae), is a slow growing, evergreen shrub or tree, native to the west coast of the US. In April 2015, several declining chinquapin trees were identified on Bolinas Ridge near Mt. Tamalpais in Marin Co. CA, a Phytophthora ramorum infested region. Branch dieback was observed but no bole or branch cankers were observed. Discolored xylem tissue (5-mm2) was cultured on corn meal agar selective medium, CMA-PARP. An organism morphologically resembling P. ramorum was isolated from one water sprout piece. The ITS sequences obtained from pure cultures, symptomatic branches, and water sprouts were identical, and one was deposited into GenBank. The ITS sequence and cox2 sequence obtained from a culture were a 100% match to the ex-type of P. ramorum. Koch's postulates were tested on 3 small plants (0.5m tall, 3.8-liter pots). Plants were inoculated with 6-mm plugs taken from the margin of a 7-day-old P. ramorum colony, growing on V8 juice agar. Plugs were placed on wounded stems, approximately 2 cm above the soil line, and wrapped in Parafilm. An equal number of plants were treated with uncolonized V8 agar plugs as controls. The potting mix of 2 additional plants of the same size was infested with 200 ml of a zoospore suspension (105 spores ml-1) which was drenched around the base of the stem. Each base was scored with a razor blade before applying the suspension. Two plants were scored and drenched with sterile water as controls. After 7 days, plug-inoculated plants began to wilt and leaves began to turn grayish green. After 15 days, plants began to collapse and isolations were made from stem cankers and roots onto CMA-PARP. After 12 days, leaves of plants that were soil-drenched with zoospores were a dull green color and after 38 days, dry and brittle. Lesions were seen on the roots and stems when isolations were made at 35 days. P. ramorum was consistently isolated from stems of wound-inoculated plants and from roots and stems of soil-inoculated plants. No P. ramorum was isolated, nor symptoms were observed on any control plants. P. ramorum causes sudden oak death on many members of the Fagaceae as well as ramorum blight on more than 130 hosts (Cobb et al., 2020). To our knowledge, this is the first official detection of P. ramorum causing disease on C. chrysophylla in wildlands. Unlike other Fagaceae hosts of P. ramorum, external bole cankers were not seen on infected chinquapin trees. Branch isolations onto PARP media was difficult and detection by PCR from symptomatic vascular tissue was more efficacious. Losses of chinquapin in US forests due to P. ramorum would reduce forest diversity and could cause the loss of habitat for many animal species.

First Report of Pleurostoma richardsiae Associated with Twig and Branch Dieback of Olive Trees in Spain.

Pleurostoma richardsiae has been described as an olive tree pathogen causing decline and brown wood streaking (Carlucci et al., 2013). A survey was carried out in plots under olive cultivation (Olea europaea L., cv. Picual; 10 year-old plants) at La Garrovilla, (Spain) in September 2020, in which a putative Verticillium wilt had been visually diagnosed. In Plot 1 (2.6 ha; 741 plants), 20.4% of the plants exhibited wilt, foliar browning and leaf drop, twig, and branch dieback. While the level of incidence in plots 2 (4.8 ha; 1368 plants), 3 (3.20 ha; 912 plants), and 4 (1.85 ha; 527 plants) was 25.0%, 19.5%, and 42.9% respectively, which meant for that harvest an average reduction in olive production, and an economic loss, of 30.2%. Three trees from each plot were uprooted and analyzed. Five out of 12 intriguingly showed brown streaking under the bark extending from the root system and ascending up the trunk, a symptom that is never associated with Verticillium dahliae wich does not produce necrosis and cankers in the wood (López-Escudero and Mercado-Blanco, 2011). Samples from the 5 tree trunks showing necrosis were taken to the lab and surface sterilized. Small pieces of discolored wood were placed onto malt extract agar plates containing chloramphenicol (0.25 g/L) and incubated for 21 days at 25°C in darkness. The growing fungal colonies were then transferred to potato dextrose agar (PDA). Isolates were identified by micromorphological characteristics, according to Vijaykrishna et al. (2004), as P. richardsiae. Colonies on PDA were cottony, brown with whitish edge, and produced abundantly two types of conidia: brown (spherical or subglobose), or hyaline (allantoids to cylindrical) that appeared on septated and inconspicuous phialides respectively. Identification was confirmed by amplification and sequencing of the internal transcribed spacer (ITS) region using ITS1/ITS4 primers (White et al., 1990), and partial sequencing of the β-tubulin gene using T1 (O'Donnell and Cigelnik, 1997) and Bt2b (Glass and Donaldson, 1995) primers. ITS sequence showed a 99.82% identity with that of P. richardsiae IFM51337 (CBS406.93 type strain; GenBank AB364703.1), whereas β-tubulin sequence exhibited a 99.77% identity with P. richardsiae CBS406.93 β-tubulin gene (GenBank MT501304.1). ITS and β-tubulin sequences were deposited in GenBank (MZ519916 and MZ542764 respectively). The P. richardsiae isolate has been deposited in the Spanish Type Culture Collection (CECT 21196). Pathogenicity tests were conducted on 1-year old potted olive plants cv. Picual, maintained in a growth chamber at 25ºC and 12-h dark/12-h light. Twelve plants were inoculated in a wound made in the stem with a scalpel, and mycelial plug (5 mm diameter) from 15-day-old PDA plates were inserted into the wound. Another set of 12 plants were inoculated with sterile agar plugs and used as negative control plants. Four months after inoculation, 66% of the plants inoculated with mycelia plugs, showed wilting, necrosis under the bark, or even had died. P. richardsiae was successfully reisolated from necrotic areas in 75% of the plants inoculated with mycelia plugs. A total of 10 reisolates were identified as P. richardsiae by the above molecular techniques to confirm Koch's postulates. No symptoms were observed in the negative control plants and the pathogen was not re-isolated from them either. To our knowledge, this is the first report of P. richardsiae associated with twig and branch dieback of olive trees in Spain.

First report of Neoscytalidium novaehollandiae associated with branch dieback and stem cankers on plum in Turkey

First report of Neoscytalidium novaehollandiae associated with branch dieback and stem cankers on plum in Turkey

Sooty canker, a destructive disease of banyan (Ficus benghalensis L.) trees in landscapes of Kish Island (Iran)

Ficus benghalensis L (banyan tree) has been planted as ornamental tree in parks, landscapes as well as along roads and streets in many southern cities of Iran. During field surveys conducted in Kish Island (Hormozgān province) an unusual decline was noticed on F. benghalensis. Affected trees exhibited bark necrosis, peeled off bark and cankers on branches and aerial roots, yellowing and defoliation, branch dieback and eventually death. A black sooty mass of fungal spores under the bark as well as wood discoloration in cross sections were also observed on infected parts of trees and pruning wood debris. Samples were collected from all affected parts of trees showing disease symptoms, pruning wood debris as well as rove arthropods in close proximity to the trees for the presence of fungal inoculum. In this study 239 Botryosphaeriaceae-like isolates were obtained from discoloured wood tissues, pruning wood debris and from the bodies of collected arthropods. Based on morphological characteristics and DNA sequence data of ITS and tef-1α gene regions, isolates were identified as Lasiodiplodia theobromae and Neoscytalidium dimidiatum. Pathogenicity of both species was performed on the branches of banyan trees and L. theobromae was more virulent, based on the length of necrotic lesions in the wood, than those of N. dimidiatum. This study is the first report of N. dimidiatum associated with sooty canker and dieback of F. benghalensis worldwide. Our study showed for the first time that L. theobromae and N. dimidiatum can also be associated with some arthropods. Our outcomes can improve the management strategies of trunk diseases caused by Botryosphaeriaceae species on ornamental trees in landscapes.

First report of the fungus Gnomoniopsis smithogilvyi causing cankers on sweet chestnut (Castanea sativa) in Ireland

In autumn 2020 cankers and branch dieback (Figure 1) were found in a five-year-old gene bank plantation of Castanea sativa in Wicklow, Ireland. The planting material had been imported as grafted saplings from the United Kingdom. Isolations were made from the cankers by surface sterilising the outer bark near the cankers with 70% ethanol. Pieces (5 × 5 × 5mm) of woody material were removed and soaked in 2% NaOCl for one minute, followed by two one-minute distilled water washes. After dabbing dry using paper towels the pieces were placed aseptically onto the surface of malt extract agar (MEA; Difco™) and incubated at 21°C in the dark for three weeks. After several days, hyphal tips were taken from the fungal colonies and transferred onto 2% potato dextrose agar (PDA; DifcoTM). DNA was extracted from the mycelium of seven-day old cultures and the ITS region was sequenced using primers ITS5 and ITS4. Gnomoniopsis smithogilvyi (syn. G. castaneae) (Figure 2) was detected. Microscopic observations agreed with the published descriptions of Shuttleworth et al. (2012) and Visentin et al. (2012). The ITS sequences were deposited in GenBank under the accession numbers OM683278 and OM683279. Sixty three-year-old C. sativa saplings were inoculated with either of two G. smithogilvyi isolates, or a control sterile PDA plug (Table 1). After surface sterilising with 70% ethanol, a stem wound was made using a sterile 6 mm cork borer, 10 cm above soil level. A 6 mm mycelial plug of a three-week-old isolate of G. smithogilvyi was placed onto the wound. This was then covered in moist sterilised cotton wool, wrapped in plastic film, and covered by aluminium foil. Control plants were inoculated with sterile PDA plugs. Treatments were randomised and grown outside, between mid-August to mid-November (mean temperature 14.9°C; mean relative humidity 85.5%). After six weeks dark necrotic lesions (Figure 3; Table 1) were observed on all saplings which had been inoculated with G. smithogilvyi isolates, and G. smithogilvyi was re-isolated from all lesions. Gnomoniopsis smithogilvyi caused girdling on numerous saplings (Figure 4). The identity of the reisolated colonies was confirmed as G. smithogilvyi by morphological assessment and ITS sequencing, fulfilling Koch's postulates. All control saplings were found to be asymptomatic, and no G. smithogilvyi was isolated from these (0/8 attempted re-isolations). Gnomoniopsis smithogilvyi causes cankers on C. sativa hybrids in Spain, and on C. sativa in five European countries (Shuttleworth et al., 2016; Lewis et al., 2017; Lione et al., 2019). It also causes chestnut rot in C. sativa in Australia, France, Italy, New Zealand, Portugal and Switzerland (Visentin et al., 2012; Shuttleworth et al., 2016; Coelho & Gouveia, 2021). This is the first report of G. smithogilvyi causing cankers on C. sativa in Ireland. Follow up surveys and tests are planned to fully understand the distribution of G. smithogilvyi in Ireland.

Nutrient Deficiency Induces Branch and Shoot Dieback in Robusta Coffee

In southern Sumatra, Robusta coffee is grown mainly in mountain regions, undulating and steep lands, and marginal soils. Management of soil nutrients is a key issue to maintain sustainable coffee production. This survey was conducted at the field of Farmer Training Center (FTC), at Pulau Panggung Village, Semendo Darat Laut Sub-district, Muara Enim District of South Sumatra Province, Indonesia. The trees of seven coffee clones were randomly sampled. The soil of 0-20 cm depth and full-grown leaves from middle branches was compositely sampled. The results of soil analysis and visual symptoms showed a deficiency of macro nutrient including N, P, K, and Mg that coincident with a high incidence of dieback symptoms. We observed that branch dieback incidence was 62-100% with severity score 1.0-2.5 and shoots dieback incidence was 15-50% with severity score 1.0-3.0. Local coffee clone showed a better tolerance on branch and shoots dieback and higher yield potential based on number of fruits and pinhead fruit per bunch. The results of observation on leaf symptoms of nutrient deficiency, slow plant growth, dieback incidence, plant death, and low plant population showed as a failure of coffee establishment induced by low soil fertility and poor plant management.

Multigene characterization of 'Candidatus Phytoplasma ulmi'‐related isolates associated with elm yellows disease of Ulmus minor Mill. in Poland

Abstract‘Candidatus Phytoplasma ulmi’, associated with elm yellows, shoot proliferation and dieback of elm (Ulmus) species trees was reported in United States of America and in many European countries. Until now its presence in elm trees in Poland has not been detected. In 2017–2018, during visual inspection of elm trees grown in four areas of southern Silesia Province leaf yellowing, shoot proliferation, phloem necrosis and dieback of branches were observed on European field elm trees grown in nature reserve close to the border with the Czech Republic. Phloem tissue from shoots collected from six symptomatic and twenty asymptomatic trees was used for extraction nucleic acids. Nested PCR with primer pairs amplifying 16Sr RNA sequences of phytoplasmas resulted in specific products for samples from six symptomatic trees however the restriction fragment length polymorphism (RFLP) and phylogenetic analyses of the sequenced products did not allow to clearly classify newly detected isolates within the elm yellows group (16SrV). The isolates found in Poland clustered on the boundary of the 16SrV‐A and 16SrV‐C ribosomal subgroups. Sequence analyses of less conservative genes rpl22‐ rps3 and secY confirmed the affiliation of the phytoplasma isolates found in Poland to ‘Candidatus Phytoplasma ulmi’; however, the significant nucleotide changes in signature sequences for all three genes were shown compared with EY1T reference strain. Surprisingly, the newly detected isolates shared a common origin and were phylogenetically closer to EY1‐SRB and EY10‐SRB strains from Serbia as well as NK16 strain from Croatia strains than to the EYCZ1 strain from the Czech Republic. This is the first report on detection and molecular characterization of ‘Candidatus Phytoplasma ulmi’ in Poland based on sequence analysis of three genetic locus.

Tamarisk biocontrol alters bird community composition in the absence of cottonwood and willow vegetation

AbstractInvasive plants threaten biodiversity worldwide, but control of non-native species may affect native species in complex ways. Non-native tamarisk (Tamarix spp.) is widespread in western U.S. riparian environments, and tamarisk beetles (Diorhabda spp.), a tamarisk-specific herbivore, were subsequently introduced as biocontrol. The primary effect of biocontrol is defoliation and branch dieback, with repeated defoliation killing the plant. We investigated the initial stages of site recovery after biocontrol and how tamarisk decline affected birds, their arthropod prey, and microclimate. We compared avian community diversity and composition, arthropod abundance, humidity, and temperature at sites along the Virgin River in Nevada and Arizona, USA characterized as either mixed native vegetation, tamarisk-dominated, or tamarisk-dominated where the majority of tamarisk died from biocontrol. We compared avian communities sampled after biocontrol to counts at the same locations before biocontrol. Prior to biocontrol, community compositions of all but one site grouped together using unbiased clustering algorithms. Following biocontrol, tamarisk-dominated sites grouped separately, and mixed sites grouped with the pre-biocontrol cluster. Comparison of pre- and post-biocontrol communities showed 7 common species declined by ≥30% in dead tamarisk sites, while one species did so at mixed sites and 3 at tamarisk-dominated sites. Individual census points in dead tamarisk had significantly lower Simpson diversity than the same points censused before biocontrol, unless native vegetation was present, suggesting tamarisk death was the cause of dominant species abundance changes. Tamarisk-dominated sites were hotter and drier than sites with native vegetation and supported fewer non-tamarisk-obligate arthropods, consistent with the hypothesis that bird reductions were driven by changes in microclimate and prey abundance. How long these effects last will depend upon the rate of native vegetation recovery after biocontrol, therefore we recommend monitoring sites to determine the trajectory of vegetative recovery and considering the need and feasibility of active restoration in those sites with slow or no native regeneration.

Occurrence of twig blight and branch dieback of walnut caused by Botryosphaeriaceae species in Turkey

Occurrence of twig blight and branch dieback of walnut caused by Botryosphaeriaceae species in Turkey

New report of Biscogniauxia rosacearum as a pathogen on almond trees in Iran

Biscogniauxia species are known as fungal trunk pathogens on various tree species in the world. During a survey of trunk diseases of fruit trees conducted in Iran, a branch dieback was observed on almond trees in Kerman province (in the Southeast of Iran). Evaluation of symptomatic branches revealed wood discoloration in cross-sections and the presence of fruiting bodies of an ascomycete fungus on their bark. A total of 31 fungal isolates were obtained, 13 isolates recovered from necrotic wood tissues and 18 isolates from fruiting bodies. These isolates were subjected to morphological analysis as well as sequencing analysis of the partial ITS-rDNA and beta tubulin gene sequences. These fungal isolates were identified as Biscogniauxia rosacearum. Results of the pathogenicity tests showed that this species is pathogenic on almond shoots. Based on our knowledge, this is the first report of this species on almond trees in Iran and in the world.

First report of Pestalotiopsis biciliata causing dieback on Quercus coccifera and Pistacia lentiscus in Tunisia

Species of Pestalotiopsis occur commonly as plant pathogens. Accordingly, the aim of this study was to identify the causal agent of a shrub disease in northeastern and northern Tunisian forests. Field surveys showed a progressive dieback of branches, twig blight and trunk cankers on Pistacia lentiscus and Quercus coccifera. Pestalotiopsis spp. were the main fungi consistently isolated from these shrub species. Morphological identification and phylogenetic analysis of the internal transcribed spacer (ITS) region of the nuclear ribosomal DNA and partial sequence of the translation elongation factor 1-alpha gene (tef1-α) identified the isolated fungi as Pestalotiopsis biciliata. This identification was confirmed by PCR analysis and Sanger sequencing, and demonstrated further using Koch’s postulates. To the best of our knowledge, this is the first report of P. biciliata associated with branch dieback and stem canker on Quercus coccifera and Pistacia lentiscus in Tunisia.

Candidatus phytoplasma malaysianum (16SrXXXII) associated with Elaeocarpus sylvestris decline in South Korea

Phytoplasma has been newly detected in Elaeocarpus sylvestris, a tree species that grows on the island of Jeju, South Korea. Various symptoms of infection of E. sylvestris have appeared since 2013, including loss of leaf coloration, such as yellowing, darkening and branch dieback. We analyzed leaves and seeds of E. sylvestris sequences infected by phytoplasma, and found partial 16S rRNA sequences to be 99.5%, and secA genes 98.2% correlated with Malaysian periwinkle virescence group strain ELY-BN1, MaPV, MOP, MYD, and TtWB. Analyzing these sequences and through the virtual restriction fragment length polymorphism (virtual-RFLP), we report here the first occurrence of Elaeocarpus decline associated with a phytoplasma strain belonging to 16SXXXII groups, as well as the first detection of phytoplasma in the seeds of E. sylvestris in South Korea.

Neofusicoccum mediterraneum Is Involved in a Twig and Branch Dieback of Olive Trees Observed in Salento (Apulia, Italy).

Olive trees are infected and damaged by Botryosphaeriaceae fungi in various countries. The botryosphaeriaceous fungus Neofusicoccum mediterraneum is highly aggressive and is a major concern for olive groves in Spain and California (USA), where it causes ‘branch and twig dieback’ characterized by wood discoloration, bark canker, and canopy blight. During surveys of olive groves in Apulia (southern Italy), we noticed that—in some areas—trees were heavily affected by severe branch and twig dieback. In addition, chlorosis and the appearance of red-bronze patches on the leaf preceded the wilting of the foliage, with necrotic leaves persisting on the twigs. Given the severity of the manifestation in zones also subject to olive quick decline syndrome (OQDS) caused by Xylella fastidiosa subsp. pauca, we investigated the etiology and provide indications for differentiating the symptoms from OQDS. Isolation from diseased wood samples revealed a mycete, which was morphologically and molecularly identified as N. mediterraneum. The pathogenicity tests clearly showed that this fungus is able to cause the natural symptoms. Therefore, also considering the low number of tested samples, N. mediterraneum is a potential causal agent of the observed disease. Specifically, inoculation of the twigs caused complete wilting in two to three weeks, while inoculation at the base of the stem caused severe girdling wedge-shaped cankers. The growth rate of the fungus in in vitro tests was progressively higher from 10 to 30 °C, failing to grow at higher temperatures, but keeping its viability even after prolonged exposure at 50 °C. The capacity of the isolate to produce catenulate chlamydospores, which is novel for the species, highlights the possibility of a new morphological strain within N. mediterraneum. Further investigations are ongoing to verify whether additional fungal species are involved in this symptomatology.

Characterization and pathogenicity of Diplodia seriata causing branch canker on Pinus pinea in Tunisia

Several species of Botryosphaeriaceae family are among the most aggressive pathogens associated with botryosphaeria dieback of agricultural and forestry trees. Particularly, Diplodia spp. having a cosmopolitan distribution, are well-known as virulent of woody plant hosts including Pinus spp. In recent years, symptoms of canopy wilt, branch dieback, necrosis, and trunk cankers have been noticed on Pinus pinea trees in Tunisian forests. However, this has been less welldocumented in North Africa and especially in Tunisia. The aim of this study is to characterize the causal agent of P. pinea dieback in northeastern Tunisian forest. A collection of thirty-eight isolates obtained from symptomatic branches of P. pinea trees was identified as Diplodia seriata by means of morphological characteristics, and phylogenetic analysis of the internal transcribed spacer (ITS) region of the nuclear ribosomal DNA. A pathogenicity test was conducted on 3-years-old P. pinea seedlings, confirmed the virulence of the fungus. To the best of our knowledge, this is the first record of D. seriata associated with branch canker on P. pinea in Tunisia.

Phytophthora cactorum causing bleeding canker of Acer x freemanii in southern Idaho.

Since 2018, bleeding cankers have been observed on maple trees in multiple home gardens in southwest Idaho. The cankers ooze a dark sap and and are approximately 10 cm to 35 cm in diameter. Cankers typically occur on the main trunk but are also present on scaffold branches in severe infecrions. Symptoms of foliar chlorois, branch dieback, and premature autumn senescence were also associated with the disease. Phytophthora DNA was detected in symptomatic material from five trees using real-time PCR (Miles et al., 2017). In July 2019 recovery of a causal agent from a symptomatic Acer x freemanii tree was attempted. Excisions were made from the interface of healthy and diseased tissue around the cankers using a chisel. The tissue was then placed in sealed plastic ziplock bags at 4°C for 7 days. Hyphae were then removed with forceps and placed onto potato dextrose agar (PDA) amended with penicillin G (0.2 g/liter) and streptomycin sulfate (0.8 g/liter). Colonies resembling Phytophthora cactorum were consistently observed after 5 days at 21°C. Tentative P. cactorum identification was based on the presence of abundant papillate and caducous sporangia on a short pedicel; sporangia were approximately 30 μm long and 26 μm wide (Bush et al., 2006; Hudler, 2013). Individual hyphal tips were transferred to fresh PDA plates and sequencing of both the rDNA ITS region and Cytochrome c oxidase subunit I (COI) was completed for a representative isolate (D19-130). DNA extraction, PCR and sequencing were as previously described (Woodhall et al. 2013; Robideau et al., 2011). The resulting DNA sequences for rDNA ITS (MW315449) and COI (MW881040) were both 100% identical (723/723 bp and 728/728 bp) with sequences from cultures previously identified as P. cactorum (MH171627 and MH136858). To determine pathogenicity, 14 month-old maple (A. x freemanii) trees in individual containers with potting mix were wounded 15 mm above the soil line with a single 10 mm incision using a sterile razor blade and inoculated by placing a 10 mm2 fully colonized PDA plug of isolate D19-130 on the wound. The inoculum and wound were then covered with a damp cotton ball that was secured loosely with parafilm. Control plants consisted of uninoculated plants and wounded plants inoculated with a PDA agar plug. Each treatment was replicated five times and placed in a controlled environment chamber set at 24ºC and 90% relative humidity. All treatments were sprayed with water daily to ensure the cotton balls remained damp. After 8 weeks, black lesions, up to approximately 25 mm above the soil line, were observed on the stem base of all P. cactorum-inoculated plants. No black lesions were observed on non-inoculated plants or plants inoculated with a PDA agar plug. P. cactorum was isolated from lesions, as described above, except polystyrene foam boxes containing moist paper towels were used instead of bags. This report confirms P. cactorum as a causal agent of bleeding canker of maple in Idaho for the first time. It has been shown that several Phytophthora species can infect maple (Jung and Burgess, 2009; Huddler, 2013). P. cactorum has a wide host range but certain strains have been associated with lethal bleeding stem cankers in maple and other deciduous trees worldwide (Huddler, 2013). Knowledge of the causal agent of bleeding canker on maple will help determine appropriate disease management practices.