Bovine Fetal Fibroblasts Research Articles

DPPA2/4 Promote the Pluripotency and Proliferation of Bovine Extended Pluripotent Stem Cells by Upregulating the PI3K/AKT/GSK3β/β-Catenin Signaling Pathway.

Developmental pluripotency-associated 2 (DPPA2) and DPPA4 are crucial transcription factors involved in maintaining pluripotency in humans and mice. However, the role of DPPA2/4 in bovine extended pluripotent stem cells (bEPSCs) has not been investigated. In this study, a subset of bEPSC-related differentially expressed genes (DEGs), including DPPA2 and DPPA4, was identified based on multiomics data (ATAC-seq and RNA-seq). Subsequent investigations revealed that double overexpression of DPPA2/4 facilitates the reprogramming of bovine fetal fibroblasts (BFFs) into bEPSCs, whereas knockout of DPPA2/4 in BFFs leads to inefficient reprogramming. DPPA2/4 overexpression and knockdown experiments revealed that the pluripotency and proliferation capability of bEPSCs were maintained by promoting the transition from the G1 phase to the S phase of the cell cycle. By activating the PI3K/AKT/GSK3β/β-catenin pathway in bEPSCs, DPPA2/4 can increase the nuclear accumulation of β-catenin, which further upregulates lymphoid enhancer binding factor 1 (LEF1) transcription factor activity. Moreover, DPPA2/4 can also regulate the expression of LEF1 by directly binding to its promoter region. Overall, our results demonstrate that DPPA2/4 promote the reprogramming of BFFs into bEPSCs while also maintaining the pluripotency and proliferation capability of bEPSCs by regulating the PI3K/AKT/GSK3β/β-catenin pathway and subsequently activating LEF1. These findings expand our understanding of the gene regulatory network involved in bEPSC pluripotency.

ZFP57 regulates DNA methylation of imprinted genes to facilitate embryonic development of somatic cell nuclear transfer embryos in Holstein cows.

Aberrant epigenetic nuclear reprogramming, especially imprinting pattern disorders, is one of the major causes of failure of clone development from somatic cell nuclear transfer (SCNT). Previous studies showed that ZFP57 is a key protein required for imprint maintenance after fertilization. In this study, we found that imprinting control regions in several imprinted genes were significantly hypomethylated in cloned embryos compared with in vitro fertilization embryos, indicating a loss of imprinted gene methylation. The ZFP57 expression was capable of maintaining the correct degree of methylation at several imprinting control regions and correcting abnormal hypomethylation. Moreover, we successfully obtained bovine fetal fibroblasts overexpressing ZFP57, which were used as donors for SCNT. Our results demonstrated that overexpression of ZFP57 increased total and trophectoderm cell numbers and the ratio of inner cell mass to total cells, reduced the apoptosis rate and significantly enhanced the development of SCNT blastocysts in vitro, ultimately achieving a degree of methylation similar to that in in vitro fertilization embryos. We concluded that overexpression of ZFP57 in donor cells provided an effective method for enhancing nuclear reprogramming and developmental potential in SCNT embryos. The ZFP57 protein played a key role in maintaining the methylation of imprinted genes during early embryonic development, which may be effective for enhanced SCNT in cattle.

RNA-Seq Analysis Identifies Differentially Expressed Genes in the Longissimus dorsi of Wagyu and Chinese Red Steppe Cattle.

Meat quality has a close relationship with fat and connective tissue; therefore, screening and identifying functional genes related to lipid metabolism is essential for the production of high-grade beef. The transcriptomes of the Longissimus dorsi muscle in Wagyu and Chinese Red Steppe cattle, breeds with significant differences in meat quality and intramuscular fat deposition, were analyzed using RNA-seq to screen for candidate genes associated with beef quality traits. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis showed that the 388 differentially expressed genes (DEGs) were involved in biological processes such as short-chain fatty acid metabolism, regulation of fatty acid transport and the peroxisome proliferator-activated receptor (PPAR) signaling pathway. In addition, crystallin alpha B (CRYAB), ankyrin repeat domain 2 (ANKRD2), aldehyde dehydrogenase 9 family member A1 (ALDH9A1) and enoyl-CoA hydratase and 3-hydroxyacyl CoA dehydrogenase (EHHADH) were investigated for their effects on intracellular triglyceride and fatty acid content and their regulatory effects on genes in lipogenesis and fatty acid metabolism pathways. This study generated a dataset from transcriptome profiling of two cattle breeds, with differing capacities for fat-deposition in the muscle, and revealed molecular evidence that CRYAB, ANKRD2, ALDH9A1 and EHHADH are related to fat metabolism in bovine fetal fibroblasts (BFFs). The results provide potential functional genes for maker-assisted selection and molecular breeding to improve meat quality traits in beef cattle.

Selection Signature and CRISPR/Cas9-Mediated Gene Knockout Analyses Reveal ZC3H10 Involved in Cold Adaptation in Chinese Native Cattle.

Cold stress is an important factor affecting cattle health, production performance, and reproductive efficiency. Understanding of the potential mechanism underlying genetic adaptation to local environments, particularly extreme cold environment, is limited. Here, by using FLK and hapFLK methods, we found that the Zinc finger CCCH-type containing 10 (ZC3H10) gene underwent positive selection in the Menggu, Fuzhou, Anxi, and Shigatse humped cattle breeds that are distributed in the cold areas of China. Furthermore, ZC3H10 expression significantly increased in bovine fetal fibroblast (BFF) cells at 28 °C for 4 h. ZC3H10 knockout BFFs were generated using CRISPR/Cas9. Wild and ZC3H10-deleted BFFs were treated at two temperatures and were divided into four groups (WT, wild and cultured at 38 °C; KO, ZC3H10−/− and 38 °C; WT_LT, wild, and 28 °C for 4 h; and KO_LT, ZC3H10−/− and 28 °C for 4 h. A total of 466, 598, 519, and 650 differently expressed genes (two-fold or more than two-fold changes) were identified by determining transcriptomic difference (KO_LT vs. KO, WT_LT vs. WT, KO vs. WT, and KO_LT vs. WT_LT, respectively). Loss of ZC3H10 dysregulated pathways involved in thermogenesis and immunity, and ZC3H10 participated in immunity-related pathways induced by cold stress and regulated genes involved in glucose and lipid metabolism and lipid transport (PLTP and APOA1), thereby facilitating adaptability to cold stress. Our findings provide a foundation for further studies on the function of ZC3H10 in cold stress and development of bovine breeding strategies for combatting the influences of cold climate.

Isolation, culture, and characterisation of bovine ovarian fetal fibroblasts and gonadal ridge epithelial-like cells and comparison to their adult counterparts.

During ovarian development, gonadal ridge epithelial-like (GREL) cells arise from the epithelial cells of the ventral surface of the mesonephros. They ultimately develop into follicular granulosa cells or into ovarian surface epithelial cells. Stromal fibroblasts arise from the mesonephros and penetrate the ovary. We developed methods for isolating and culturing fetal ovarian GREL cells and ovarian fibroblasts by expansion of colonies without passage. In culture, these two cell types were morphologically different. We examined the expression profile of 34 genes by qRT-PCR, of which 24 genes had previously been studied in whole fetal ovaries. Expression of nine of the 10 newly-examined genes in fetal ovaries correlated with gestational age (MUC1, PKP2, CCNE1 and CCNE2 negatively; STAR, COL4A1, GJA1, LAMB2 and HSD17B1 positively). Comparison between GREL cells and fetal fibroblasts revealed higher expression of KRT19, PKP2, OCLN, MUC1, ESR1 and LGR5 and lower expression of GJA1, FOXL2, NR2F2, FBN1, COL1A1, NR5A1, CCND2, CCNE1 and ALDH1A1. Expression of CCND2, CCNE1, CCNE2, ESR2 and TGFBR1 was higher in the fetal fibroblasts than in adult fibroblasts; FBN1 was lower. Expression of OCLN, MUC1, LAMB2, NR5A1, ESR1, ESR2, and TGFBR3 was lower in GREL cells than ovarian surface epithelial cells. Expression of KRT19, DSG2, PKP2, OCLN, MUC1, FBN1, COL1A1, COL3A1, STAR and TGFBR2 was higher and GJA1, CTNNB1, LAMB2, NR5A1, CYP11A1, HSD3B1, CYP19A1, HSD17B1, FOXL2, ESR1, ESR2, TGFBR3 and CCND2 was lower in GREL cells compared to granulosa cells. TGFβ1 altered the expression of COL1A1, COL3A1 and FBN1 in fetal fibroblasts and epidermal growth factor altered the expression of FBN1 and COL1A1. In summary, the two major somatic cell types of the developing ovary have distinct gene expression profiles. They, especially GREL cells, also differ from the cells they ultimately differentiate in to. The regulation of cell fate determination, particularly of the bi-potential GREL cells, remains to be elucidated.

Efficient Editing of the ZBED6-Binding Site in Intron 3 of IGF2 in a Bovine Model Using the CRISPR/Cas9 System

Background: Insulin-like growth factor 2 is a growth-promoting factor that plays an important role in the growth and development of mammals. A nucleotide substitution in intron 3 of IGF2—which disrupts the ZBED6-binding site—affects muscle mass, organ size, and fat deposition in pigs. The ZBED6-binding site is also conserved in cattle. Methods: In the present study, we introduced mutations in the ZBED6-binding site in intron3 of IGF2 in bovine fetal fibroblasts using the CRISPR/Cas9 system, and investigated the effect of disruption of ZBED6 binding on IGF2 expression. Results: Eleven biallelic-mutant single-cell clones were established, three of which contained no foreign DNA residues. Single-cell clones 93 and 135 were used to produce cloned embryos. Dual-luciferase reporter assay in C2C12 cells demonstrated that the mutation in the ZBED6-binding site increases the promoter 3 activity of bovine IGF2. A total of 49 mutant cloned embryos were transplanted into surrogate cows. Unfortunately, all cloned embryos died before birth. IGF2 was found to be hypomethylated in the only fetus born (stillborn), which may have been due to the incomplete reprogramming. Conclusions: We efficiently constructed IGF2-edited cell lines and cloned embryos, which provided a theoretical basis and experimental materials for beef cattle breeding.

Allele-specific aberration of imprinted domain chromosome architecture associates with large offspring syndrome

SummaryLarge offspring syndrome (LOS) and Beckwith-Wiedemann syndrome are similar epigenetic congenital overgrowth conditions in ruminants and humans, respectively. We have reported global loss-of-imprinting, methylome epimutations, and gene misregulation in LOS. However, less than 4% of gene misregulation can be explained with short range (<20kb) alterations in DNA methylation. Therefore, we hypothesized that methylome epimutations in LOS affect chromosome architecture which results in misregulation of genes located at distances >20kb in cis and in trans (other chromosomes). Our analyses focused on two imprinted domains that frequently reveal misregulation in these syndromes, namely KvDMR1 and IGF2R. Using bovine fetal fibroblasts, we identified CTCF binding at IGF2R imprinting control region but not KvDMR1, and allele-specific chromosome architecture of these domains in controls. In LOS, analyses identified erroneous long-range contacts and clustering tendency in the direction of expression of misregulated genes. In conclusion, altered chromosome architecture is associated with LOS.

N-3 Polyunsaturated Fatty Acid Dehydrogenase Fat-1 Regulates Mitochondrial Energy Metabolism by Altering DNA Methylation in Isolated Cells of Transgenic Cattle.

The fatty acid dehydrogenase fat-1 gene, derived from Caenorhabditis elegans, encodes n-3 polyunsaturated fatty acid dehydrogenase (Δ15 desaturase) and catalyzes the 18–20-carbon n-6 polyunsaturated fatty acids (n-6 PUFA) to generate corresponding n-3 polyunsaturated fatty acids (n-3 PUFA). Subsequently, fat-1 can influence the n-6: n-3 PUFA ratio in fat-1 transgenic cells. This study aimed to explore which processes of energy metabolism are affected exogenous fat-1 transgene and the relationship between these effects and DNA methylation. Compared with the wild-type group, the n-3 PUFA content in fat-1 transgenic bovine fetal fibroblasts was significantly increased, and the n-6 PUFA content and the n-6: n-3 PUFA ratio decreased. In the context of energy metabolism, the increase of exogenous fat-1 transgene decreased ATP synthesis by 39% and reduced the activity and expression of key rate-limiting enzymes in glycolysis, the tricarboxylic acid cycle, and oxidative phosphorylation, thus weakening the cells’ capacity for ATP production. DNA methylation sequencing indicated that this inhibition of gene expression may be due to altered DNA methylation that regulates cell energy metabolism. Exogenous fat-1 transgenic cells showed changes in the degree of methylation in the promoter region of genes related to energy metabolism rate-limiting enzymes. We suggest that alters the balance of n-6/n-3 PUFA could regulate altered DNA methylation that affect mitochondrial energy metabolism.

Function Identification of Bovine ACSF3 Gene and Its Association With Lipid Metabolism Traits in Beef Cattle.

Acyl-CoA synthetase family member 3 (ACSF3) carries out the first step of mitochondrial fatty acid synthesis II, which is the linkage of malonate and, to a lesser extent, methylmalonate onto CoA. Malonyl-coenzyme A (malonyl-CoA) is a central metabolite in mammalian fatty acid biochemistry that is generated and utilized in the cytoplasm. In this research, we verified the relationship between expression of the ACSF3 and the production of triglycerides (TGs) at the cellular level by silencing and over-expressing ACSF3. Subsequently, through Sanger sequencing, five polymorphisms were found in the functional domain of the bovine ACSF3, and the relationship between ACSF3 polymorphism and the economic traits and fatty acid composition of Chinese Simmental cattle was analyzed by a means of variance analysis and multiple comparison. The results illustrated that the expression of ACSF3 promoted triglyceride synthesis in bovine mammary epithelial cells and bovine fetal fibroblast cells. Further association analysis also indicated that individuals with the AG genotype (g.14211090 G > A) of ACSF3 were significantly associated with the fatty acid composition of intramuscular fat (higher content of linoleic acid, α-linolenic acid, and arachidonic acid), and that CTCAG haplotype individuals were significantly related to the fatty acid composition of intramuscular fat (higher linoleic acid content). Individuals with the AA genotypes of g.14211055 A > G and g.14211090 G > A were substantially associated with a larger eye muscle area in the Chinese Simmental cattle population. ACSF3 played a pivotal role in the regulation of cellular triacylglycerol and long-chain polyunsaturated fatty acid levels, and polymorphism could serve as a useful molecular marker for future marker-assisted selection in the breeding of intramuscular fat deposition traits in beef cattle.

Establishment of an Efficient Immortalization Strategy Using HMEJ-Based bTERT Insertion for Bovine Cells.

Immortalized cell lines have been used in a wide range of applications in research on immune disorders and cellular metabolic regulation due to the stability and uniformity of their cellular characteristics. At present, the investigation into molecular functions and signaling pathways within bovine cells remains largely limited by the lack of immortalized model cells. Current methods for immortalizing bovine cells are mainly restricted to the ectopic expression of human telomerase reverse transcriptase (hTERT) through transient transfection or virus-mediated delivery, which have defects in efficiency and reliability. In this study, we identified bovine TERT (bTERT) as a novel potent biofactor for immortalizing bovine cells with great advantages over hTERT, and established an efficient and easily manipulated strategy for the immortalization of bovine primary cells. Through the homology-mediated end-joining-based insertion of bTERT at the ROSA26 locus, we successfully generated immortalized bovine fetal fibroblast cell lines with stable characteristics. The observed limitation of this strategy in immortalizing bovine bone marrow-derived macrophages was attributed to the post-translational modification of bTERT, causing inhibited nuclear localization and depressed activity of bTERT in this terminally differentiated cell. In summary, we constructed an innovative method to achieve the high-quality immortalization of bovine primary cells, thereby expanding the prospects for the future application of immortalized bovine model cell lines.

The effect of CPT1B gene on lipid metabolism and its polymorphism analysis in Chinese Simmental cattle

Carnitine palmitoyltransferase 1B (CPT1B) is a candidate gene that regulates livestock animal lipid metabolism and encodes the rate-limiting enzyme in fatty acid β-oxidation. To explore the effect of this gene on lipid metabolism in cattle, this study examined CPT1B gene polymorphism in Chinese Simmental cattle and the effect of CPT1B on lipid metabolism. The results showed that the triglyceride content increased significantly with increasing CPT1B gene expression in bovine fetal fibroblasts (BFFs) (p < 0.05), while CPT1B knockout led to decreased CPT1B expression and a downward trend in triglyceride levels. Correlation analysis showed a significant association between the g.119896238 G > C locus and Chinese Simmental cattle backfat thickness (p < 0.05). Backfat thickness was significantly greater in individuals with the GC genotype (0.93 ± 0.67 cm) than in those with the CC genotype (0.84 ± 0.60 cm). The g.119889302 T > C locus was significantly correlated with arachidonic acid content in Chinese Simmental cattle (p < 0.05). The arachidonic acid content in the longissimus muscle was significantly higher in CC genotype beef cattle (0.054 g/100 g) than in those with the other two genotypes (0.046 g/100 g, 0.049 g/100 g). These molecular markers can be effectively used for marker-assisted selection in cattle breeding.

Efficient TALEN-mediated gene knockin at the bovine Y chromosome and generation of a sex-reversal bovine

Functional elucidation of bovine Y-chromosome genes requires available genome editing technologies. Meanwhile, it has yet to be proven whether the bovine Sry gene is the main or single factor involved in the development of the male phenotype in bovine. Here, we efficiently knocked out four Y-linked genes (Sry, ZFY, DDX3Y, and EIF2S3Y) in bovine fetal fibroblasts (BFFs) with transcription activator-like effector nucleases (TALENs) individually. Furthermore, we used TALEN-mediated gene knockin at the Sry gene and generated a sex-reversal bovine by somatic cell nuclear transfer (SCNT). The resulting bovine had only one ovary and was sterile. We demonstrate, for the first time, that the Sry gene is an important sex-determining gene in bovine. Our method lays a solid foundation for detecting the biology of the bovine Y chromosome, as it may provide an alternative biological model system for the study of mammalian sex determination, and new methods for the practical application in agricultural, especially for sex predetermination.

LCDM medium supports the derivation of bovine extended pluripotent stem cells with embryonic and extraembryonic potency in bovine-mouse chimeras from iPSCs and bovine fetal fibroblasts.

Cattle have emerged as one of the most important domestic animals widely used for meat, milk, and fur. Derivation of bovine pluripotent stem cells (PSCs) can be applied in drug selecting and human disease modeling and facilitated agriculture-related applications such as production of genetically excellent cattle by gene editing. Extended PSCs (EPSCs), capable of differentiating into embryonic and extraembryonic parts, have been generated in mouse, human, and pig. Whether bovine EPSCs could be generated, and their chimeric competency remains unclear. This study focused on derivation of bovine EPSCs using LCDM medium and exploring the characteristics of EPSCs among different species, including bovine, mouse, and human EPSCs. Here, using LCDM medium (consisting of hLIF, CHIR99021, (S)-(+)-dimethindene maleate, and minocycline hydrochloride) enables the derivation of bovine EPSCs from induced PSCs (iPSCs) and bovine fetal fibroblasts (BFF) with stable morphology, pluripotent marker expression, and invitro differentiation ability. Notably, bovine EPSCs exhibited interspecies chimeric contribution to embryonic and extraembryonic tissues in pre-implantation blastocysts and postimplantation bovine-mouse chimeras. Transcriptome analysis revealed the unique molecular characteristics of bovine EPSCs compared with iPSCs. The similarities and differences in molecular features across bovine, human, and mouse EPSCs were also described by transcriptome analysis. Taken together, the LCDM culture system containing chemical cocktails can be used for the establishment and long-term passaging of bovine EPSCs with embryonic and extraembryonic potency in bovine-mouse chimeras. Our findings lay the foundation of generating PSCs in domestic animals and open avenues for basic and applied research in biology, medicine, and agriculture. DATABASE: Gene expression data of bovine EPSCs and bovine iPSCs are available in the GEO databases under the accession number PRJNA693452.

94 Myostatin gene editing by CRISPR/Cas9 technology of Brangus fetal fibroblasts to produce edited embryos by cloning

Some European cattle breeds, such as Charolais and Maine Anjou, have natural mutations in the myostatin gene (MSTN) that inhibit its expression and result in an increase in muscle mass and protein content. An innovative hallmark would be the invitro introduction of this genotype in South America cattle breeds to improve their commercial value. To achieve this, we aimed to disrupt MSTN gene expression in bovine fetal fibroblasts (BFFs) using CRISPR/Cas9 technology and to generate MSTN-edited embryos by somatic cell nuclear transfer (SCNT). BFFs were isolated from a cloned fetus of a Brangus bull with a prized genetic background and nucleofected with the Cas9 ribonucleoprotein-gRNA complex previously assessed to target exon 2 of the bovine MSTN gene. To evaluate MSTN editing, genomic DNA from the wild-type (WT) and nucleofected BFFs were isolated, exon 2 of MSTN was amplified by PCR, and the PCR product was Sanger sequenced. In all cases, the sequencing results were analysed using the indel Synthego software tool. According to indel analysis, MSTN gene editing efficiency of the BFFs was 58.83%±3.2 (n=6). The resulting edit consisted of insertion of thymine in exon 2 of the MSTN gene that shifted the gene reading frame, introducing a premature stop codon and generating a truncated MSTN protein. The nucleofected BFFs were then used to generate embryos by SCNT, and WT BFFs were included as controls. Embryo cleavage and blastocyst development rates were evaluated at Day 2 and 7, respectively (Chi-squared test, P&amp;lt;0.05). Although lower cleavage rates were obtained in the MSTN-edited BFFs group [65.3% (n=273/418) vs. 87.6% (n=169/193)], no differences were observed at the blastocyst stage [19.1% (n=80/418) vs. 25.4% (n=49/193)]. To confirm the efficiency of MSTN editing in the cloned embryos, 10 blastocysts generated with the MSTN-edited BFFs were individually analysed for MSTN exon 2 sequence as described before. The results showed that 30% of the blastocysts (3/10) presented a homozygous biallelic edition, which consisted of a thymine base insertion, as expected. In summary, the strategy we used allowed production of MSTN null cloned Brangus embryos avoiding putative undesired integration of exogenous DNA into the bovine genome, such as plasmid sequence, regardless of off-target occurrences. We conclude that CRISPR/Cas9 is an efficient technique to disrupts MSTN gene expression in bovine embryos; this work represents a step toward improving the production efficiency of South American cattle breeds.

HMEJ-based safe-harbor genome editing enables efficient generation of cattle with increased resistance to tuberculosis

The CRISPR/Cas9 system has been used in a wide range of applications in the production of gene-edited animals and plants. Most efforts to insert genes have relied on homology-directed repair (HDR)-mediated integration, but this strategy remains inefficient for the production of gene-edited livestock, especially monotocous species such as cattle. Although efforts have been made to improve HDR efficiency, other strategies have also been proposed to circumvent these challenges. Here we demonstrate that a homology-mediated end-joining (HMEJ)-based method can be used to create gene-edited cattle that displays precise integration of a functional gene at the ROSA26 locus. We found that the HMEJ-based method increased the knock-in efficiency of reporter genes by eightfold relative to the traditional HDR-based method in bovine fetal fibroblasts. Moreover, we identified the bovine homology of the mouse Rosa26 locus that is an accepted genomic safe harbor and produced three live-born gene-edited cattle with higher rates of pregnancy and birth, compared with previous work. These gene-edited cattle exhibited predictable expression of the functional gene natural resistance-associated macrophage protein-1 (NRAMP1), a metal ion transporter that should and, in our experiments does, increase resistance to bovine tuberculosis, one of the most detrimental zoonotic diseases. This research contributes to the establishment of a safe and efficient genome editing system and provides insights for gene-edited animal breeding.

Systematic optimization of square-wave electroporation conditions for bovine primary fibroblasts

BackgroundGene transfer by electroporation is an established method for the non-viral mediated transfection of mammalian cells. Primary cells pose a particular challenge for electroporation-mediated gene transfer, since they are more vulnerable than immortalized cells, and have a limited proliferative capacity. Improving the gene transfer by using square wave electroporation in difficult to transfect cells, like bovine fetal fibroblasts, is a prerequisite for transgenic and further downstream experiments.ResultsHere, bovine fetal fibroblasts were used for square-wave electroporation experiments in which the following parameters were systematically tested: electroporation buffer, electroporation temperature, pulse voltage, pulse duration, pulse number, cuvette type and plasmid DNA amount. For the experiments a commercially available square-wave generator was applied. Post electroporation, the bovine fetal fibroblasts were observed after 24 h for viability and reporter expression. The best results were obtained with a single 10 millisecond square-wave pulse of 400 V using 10 μg supercoiled plasmid DNA and 0.3 × 106 cells in 100 μl of Opti-MEM medium in 4 mm cuvettes. Importantly, the electroporation at room temperature was considerably better than with pre-cooled conditions.ConclusionsThe optimized electroporation conditions will be relevant for gene transfer experiments in bovine fetal fibroblasts to obtain genetically engineered donor cells for somatic cell nuclear transfer and for reprogramming experiments in this species.

214 Different pluripotency maintenance supplements affect the reprogramming process and pluripotency state of bovine-induced pluripotent stem cells

After the emergence of induced cell reprogramming, achieved through the addition of Yamanaka transcription factors (Oct4, Sox2, Klf4, and cMyc; OSKM) to somatic cells, the number of studies regarding induction and maintenance of pluripotency has increased greatly. The success of bovine iPSCs (biPSCs) was first described by Summer et al. (2011 J. Anim. Sci. 89, 2708-2716; https://doi.org/10.2527/jas.2010-3666); however, investigations on the pluripotent state of biPSCs are still needed because different protocols and characterisation profiles have since been used. The aim of this study was to produce biPSC lines supplemented with different pluripotency maintenance agents to improve self-renewal and pluripotency maintenance. For that, bovine fetal (50 days) fibroblasts (3×104) were transduced with lentivirus harbouring mouse OSKM transcription factors. The cells were further cultured in reprogramming medium (Dulbecco's modified Eagle's medium/F12 KO and 20% KSR (knockout serum replacement)) supplemented with basic fibroblast growth factor (bFGF), leukemia inhibitory factor (LIF), bFGF+2i or LIF+2i (where 2i inhibitors are PD0325901 and CHIR99021). The capacity for cell reprogramming was analysed by colony formation and maintenance after manually and enzymatic passaging and alkaline phosphatase (AP) activity detection; additionally, pluripotency state was assessed by reverse transcription (RT)-PCR (pluripotency biomarkers: OCT4, NANOG, and SOX2; naïve state: STELLA, LIFr, and ESRRb; primed state: OTX2 and FGF5; and mouse (m)OSKM and invitro differentiation assay (embryoid body formation). Statistical analysis was performed using the JMP software (SAS Institute Inc.). All treatments were successful at generating colonies after 28 days of mOSKM transduction, with 32 colonies in bFGF (0.53% efficiency), 21 colonies in bFGF+2i (0.35% efficiency), 5 colonies in LIF (0.08% efficiency), and 3 colonies in LIF+2i (0.05% efficiency) treatments/groups. As an initial pluripotency test, all colonies were positive for AP activity at passage 3. The colonies were cultured for at least 25 passages (±200 days) except for those from the LIF+2i treatment, which were not able to remain viable after 15 passages. Gene expression analysis of the pluripotency (naïve and primed) biomarkers in biPSCs by RT-PCR revealed that colonies from the bFGF treatment were upregulated in NANOG, OCT4, (pluripotency biomarkers), and STELLA (naïve biomarker) (P&amp;lt;0.05) compared with bFGF+2i and LIF groups. There were no differences in expression of SOX2 (pluripotency biomarker gene) and naïve/primed biomarkers (OXT2, LIFr, and ESRRb) (P&amp;gt;0.05). Additionally, the relative abundance of mOSKM was not different between groups (P&amp;gt;0.05). For further pluripotency analysis, biPS colonies were tested for the invitro differentiation assay, and all colonies tested were able to form embryoid bodies. In conclusion, bovine fetal fibroblasts were successfully reprogrammed when using OSKM in all medium tested; however, LIF+2i treatment did not grow beyond 25 passages. Further tests should be performed to determine the pluripotency status of these biPSCs. We acknowledge FAPESP for funding (grant nos. 2012/50533-2, 2015/26816-5, and 2016/16841-2).

21 The contrasting role of histone methyltransferases during nuclear reprogramming: SUV39H knockdown improves bovine somatic cell nuclear transfer, while the absence of EHMT2 hampers it

The persistence of somatic epigenetic memory is indicated as the main barrier for efficient nuclear reprogramming. The augmented levels of histone methylation on somatic nuclei have been shown as the major regulator of this aberrant remodelling. Although they occupy the same site, H3K9me2 and H3K9me3 are catalysed by different histone methyltransferases (HMTs), EHMT2 and SUV39H, respectively. However, the influence of these HMTs during nuclear reprogramming is unclear. Hence, the main goal of this project was to investigate the role of HMTs responsible for H3K9 methylation during nuclear reprogramming and its consequences on embryo development. For this, we employed a small interfering RNA (siRNA)-mediated knockdown approach targeting EHMT2, SUV39H1, and SUV39H2 in bovine fetal fibroblasts. The RT-qPCR analyses showed ~80% reduction in total RNA after siRNA treatments for the target genes when compared with the control vector. We then quantified the H3K9me2 and H3K9me3 levels by immunostaining. The analysis displayed that H3K9me2 levels were diminished ~50% compared with control, whereas the reduction of H3K9me3 levels was only ~25%. Cells transfected with siRNA targeting EHMT2, SUV39H1, and SUV39H2 (All-siRNA) or control vector (control) were used as a nuclear donor on somatic cell nuclear transfer (SCNT) in five biological replicates. The IVF embryos were used as a biological control for immunostaining analysis. Embryos at both 8- to 16-cell and blastocysts stage (n=10 from 5 replicates) were collected to evaluate the effect of HMT knockdown on H3K9me2 and H3K9me3 levels by immunostaining. We found a reduction of blastocyst rates in the treatment 28±6.3 (mean±s.e.m.) when compared with control 60±4.8 (P=0.004). The immunostaining analysis showed that the levels of H3K9me2 and H3K9me3 were higher in cloned (control) than IVF embryos (P&amp;lt;0.05). Moreover, the All-siRNA group displayed a reduction in H3K9me2 levels compared with the control group and IVF through developmental stages analysed (P&amp;lt;0.05). Differently, H3K9me3 levels were higher in the All-siRNA group at the 8- to 16-cell stage, but no difference was found between treated and control groups at the blastocyst stage. We, therefore, decided to test whether individual knockdown would display a different result. We then used cells transfected with siRNA targeting only EHMT2 (EHMT2-siRNA), targeting SUV39H1 + SUV39H2 (SUV-siRNA), or control vector (control) as a nuclear donor on SCNT in five biological replicates. Surprisingly, the SUV-siRNA group increased blastocyst production 38±4.4 when compared with the control group 29±4.4 (P=0.01), whereas the EHMT2-siRNA showed a reduction in blastocyst rates: 21±5.6 (P=0.04). Our results indicate that EHMT2 has a key role during SCNT, possibly by its crosstalk with other modifications. Even though the SUV39H knockdown induced a small reduction in H3K9me3 levels in the nuclear donor, it was enough to increase the blastocyst rates by 10%. These results will allow us to better understand the complex mechanisms involved in the persistent epigenetic memory during nuclear reprogramming.

Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines

The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of gRNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp gRNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using gRNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively; rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively; all were 0% at the Off-MSTN-2 locus; rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp gRNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.

Wnt3a Activates the WNT-YAP/TAZ Pathway to Sustain CDX2 Expression in Bovine Trophoblast Stem Cells.

Trophoblast stem cells (TSCs), the precursors of placental cells, are effective for studying placental formation in vitro. Using a dual inhibition (2i) medium and mixed L-Wnt3a/mouse embryonic fibroblast feeder cells, we previously established the bovine trophoblast cell line BTS-1. In this study, we used bovine fetal fibroblasts and added Wnt3a to the 2i medium to establish another bovine TSC line (BTSW). BTSW cells expressed pluripotency markers, including NANOG, SOX2, OCT4, TRA-1-60, TRA-1-81, SSEA4, CDH1, and KRT18, and TSC markers CDX2, TEAD4, and ESRRB. Methylation sequencing of the promoter regions of NANOG, OCT4, and CDX2 revealed no significant differences between BTS-1 and BTSW cells. Removal of Wnt3a from the culture medium resulted in downregulation (p < 0.05) of NANOG, OCT4, CDX2, and TSC marker genes, and upregulation of TSC differentiation markers, including MASH2, GCM1, and PAG. Western blotting indicated activation of the WNT-YAP/TAZ signaling pathway in BTS-1 and BTSW cells, consequently activating TEAD4 transcription. However, this pathway was not activated in BCFF cells, an established bovine embryonic stem-like cell line that expresses OCT4, SOX2, and NANOG, but not CDX2. Thus, Wnt3a may play a critical role in bovine TSC maintenance by activating and regulating CDX2 expression through the WNT-YAP/TAZ signaling pathway.