Mediterranean Spotted Fever Research Articles

Mediterranean spotted fever in Algerian children

Mediterranean spotted fever (MSF) is a potentially life-threatening zoonosis caused by Rickettsia conorii and transmitted by the brown dog tick Rhipicephalus sanguineus [1]. Although MSF is one of the oldest recognised rickettsioses, there have been few reports about this rickettsiosis in North Africa [1,2]. The present work on MSF cases occurring in children is a subset of a larger study conducted within all age categories.

Diagnostic value of ocular examination in Mediterranean spotted fever

Mediterranean spotted fever (MSF), also named boutonneuse fever or tick-borne rickettsiosis, is endemic in Mediterranean countries [1] The aetiologic agent for this infection is Rickettsia conorii, a strictly intracellular alpha-proteobacterium. The pathophysiologic hallmark of R. conorii infection is the invasion of vascular endothelial cells by the organism, causing endothelial injury and tissue necrosis. Ocular involvement in rickettsioses has not been frequently reported and most published studies were single case reports. Data from recent prospective studies show that patients with acute MSF frequently exhibit ocular posterior segment changes that are commonly asymptomatic and self-limited [2,3]. These include retinitis, retinal vascular lesions, optic nerve changes, and numerous other findings. The aim of the present study was to better ascertain the frequency of retinitis and the role of fundus examination in the clinical diagnosis of MSF.

Influence of temperature on the attachment of Rhipicephalus sanguineus ticks on rabbits

The impact of climate on the vector’s behaviour of the worldwide brown dog tick, Rhipicephalus sanguineus, is a cause of concern. This tick has become the most widespread tick throughout the world due to its specialised feeding on domestic dogs. In addition to the dog’s pathogens, Babesia canis and Ehrlichia canis, Rh. sanguineus is known to transmit two life-threatening rickettsial diseases to humans, Mediterranean spotted fever (MSF) caused by Rickettsia conorii in the old world, and Rocky Mountain spotted fever (RMSF) caused by Rickettsia rickettsii in America [1]. Rh. sanguineus also transmits Rickettsia massiliae, a worldwide emerging pathogen with a single documented case of infection [2]. Rh. sanguineus lives in peridomestic environments shared with dogs but is known to have a low affinity for humans, particularly in temperate countries. Hosts other than dogs are usually only infested when dogs are present to maintain a tick population. However, in 2003, 22 Rh. sanguineus were found attached to an alcoholic homeless person who died of MSF in Marseille. This heavy infestation was associated with the highest summer temperatures noted in France during the past 50 years [1]. Also, the cases of MSF recognised in Oran, Algeria, in 1993 peaked in 2005 together with the hottest summer of the past decades [3]. More recently, maximum temperature levels during the previous summer were associated with increases in MSF incidence in Sardinia [4]. In this work we have tested the influence of increased temperatures on the attachment of Rh. sanguineus larvae, nymphs and adult ticks on a rabbit, an unusual host.

Transmission of Rickettsia conorii conorii in naturally infected Rhipicephalus sanguineus

Rickettsia conorii conorii is the causative agent of Mediterranean spotted fever (MSF) a life-threatening zoonosis that is endemic in Mediterranean countries [1]. In the early 1930s, Olmer supposed that the vector of disease was the brown dog tick, Rhipicephalus sanguineus. In 1932, Blanc and Caminopetros demonstrated that larvae, nymphs, adults, and over winter unfed males and females could act as vectors of MSF [2]. It was also shown that when eggs or larvae obtained from infected Rh. sanguineus females, were crushed and used to inoculate humans, the patients contracted MSF. These data suggest that transovarial transmission of the MSF agent occurs in ticks. However, we are unaware of any well-documented demonstration of transovarial transmission rate of R. conorii in Rh. sanguineus (TOT, the proportion of infected females giving rise to at least one positive egg or larva), or the filial infection rate (FIR, proportion of infected eggs or larvae obtained from an infected female). Although it is not known, infection with R. conorii is maintained over several generations of Rh. sanguineus. Furthermore, a high mortality of Rh. sanguineus group ticks infected with R. conorii by several methods has been recently reported [3,4]. Our aim was to examine the vertical transmission of R. conorii in naturally infected Rh. sanguineus ticks, to establish a colony of infected ticks and to study the maintenance of infection through several generations. MATERIAL AND METHODS

Improvement of RNA purification from infected tissues to explore the in vivo host–pathogen interactions with microarrays

Rickettsiae are Gram-negative alpha proteobacteria and arthropod-borne disease agents of spotted fevers and typhus [1]. Because of their obligate intracellular lifestyle, the molecular mechanisms involved in their pathogenicity are still poorly understood. To circumvent the difficulties in working with these bacteria, rickettsial genomes have been sequenced, thus allowing further postgenomic studies. DNA microarrays can be considered as powerful tools to understand the host–pathogen interactions in the course of infectious diseases. Exploring the RNA profiles of both host and pathogen promises to improve our knowledge of the infectious process, thus favouring the development of preventive or therapeutic strategies [2]. While published studies mainly focused on the eukaryotic response, the complementary picture, i.e. the bacterial response, was poorly analysed because of several technical limitations [3]. The transcriptomic analysis of R. conorii was recently performed by microarrays [4]. This bacterium is responsible for Mediterranean spotted fever (MSF), a disease characterised by a skin lesion called eschar caused by the bite of its vector, the brown dog tick, Rhipicephalus sanguineus [5]. The aim of this work was to analyse the transcriptome pattern of rickettsiae within such eschars using the same strategy based on the removal of eukaryotic contaminants coupled with subsequent random amplification of cDNA. Our goal was also to recover eukaryotic RNA from the same sample, thus considering both sides of the host–pathogen interaction. Preliminary assays were performed using rabbit eschars generated by the sub-cutaneous inoculation of purified bacteria (not shown). Human eschars were collected by sterile scalpel excision from patients suffering from MSF and immediately placed at 4 C overnight in 1 mL of RNA Later (Qiagen, Valencia, California, USA) before storage at )80 C. The biopsies were rapidly decontaminated by a 5-min incubation in iodated alcohol and 1 min washing in nuclease free water. The tissues excised in small pieces were mechanically lysed with tungsten beads and using the Mixer Mill MM3 (Qiagen), before enzymatic digestion with proteinase K. The total RNA was extracted from resulting lysates using the RNeasy Micro kit (Qiagen). Eukaryotic RNA was removed from the total RNA sample using the MicroEnrich Kit (Ambion, Austin, Texas, USA) as described [4]. To recover the eukaryotic RNA from the same sample, the beads were then mixed in TE buffer pH 8 and heated for 1 min at 95 C. The supernatants were collected and precipitated with alcohol. The bacterial RNA was retro-transcribed using random primers and amplified with the Genomiphi kit (GE Healthcare, Piscataway, New Jersey, USA), while human RNA was amplified using poly d(T) primers with T7 polymerase (Agilent, Santa Clara, California, USA). To check for the quality of amplification, PCR were performed on cDNA using primers targeting the rrs gene from R. conorii (FGGCTCAGAACGAACGCTATC ⁄R-GTTAGCTGCGAAACCGAAAG) and the eukaryotic actin gene (F-GGACTTCGAGCAAGAGATGG ⁄R-AGCACTGTGTTGGCGTACAG), respectively. Hybridisations of prokaryotic cDNA were achieved following Cy3 or Cy5 labelling of R. conorii from eschars and using bacteria grown in vero cells as control. R. conorii microarrays were obtained from Agilent (‘Custom microarray’ design) and processed as described [6]. Hybridisations of human microarrays (Agilent) were performed with one colour labelling as recommended. The electrophoregrams obtained with the Bioanalyzer (Agilent) indicated that the extraction of Corresponding author and reprint requests: P. Renesto, Universite de la Mediterranee, URMITE IRD-CNRS 6236, Faculte de Medecine, 27 Bd Jean Moulin, 13385 Marseille, cedex 05, France E-mail: patricia.renesto@univmed.fr

Experimental infection of Rhipicephalus sanguineus with Rickettsia conorii conorii

Little is known about the relationships between Rickettsia conorii conorii, the agent of Mediterranean spotted fever (MSF), and its main vector, the brown dog tick Rhipicephalus sanguineus [1]. Matsumoto et al. recently reported a high mortality of Rh. sanguineus group ticks infected with R. conorii conorii by several methods including the use of a bacteraemic rabbit [2]. It had been speculated that reasons for this reduction in fitness might include the geographic origin of the ticks, which came from Thailand where R. conorii conorii has not been reported, or was associated with the pathogen load acquired during laboratory experiments. Here we present complementary experiments to test these hypotheses.

Effects of Rickettsia conorii infection on the survival of Rhipicephalus sanguineus ticks

Rickettsia conorii conorii is the aetiologic agent of boutonneuse fever, also known as Mediterranean spotted fever or Marseilles fever in the Mediterranean area where it is endemic. The brown dog tick, Rhipicephalus sanguineus, is recognised as the principal vector of R. conorii [1,2]. Although a few experimental studies have suggested transovarial and transstadial transmission of R. conorii in Rh. sanguineus [3], there are practically no data available on the efficiency of such transmission or on this vector–pathogen interaction. One recent publication evaluated several methods for infecting Rh. sanguineus with R. conorii, but reported high mortality in infected ticks [4], which may have resulted from incompatibility between the particular rickettsial isolate and the source of ticks used, or from the manipulation itself. In an effort to establish a laboratory colony of Rh. sanguineus persistently infected with R. conorii for studying agent transmission, we assessed the effects of R. conorii infection on the survival of Rh. sanguineus larvae.

Tick-Borne Rickettsiosis in Traveler Returning from Honduras

Tick-Borne Rickettsiosis in Traveler Returning from Honduras

Characterization of Rickettsial Diseases in a Hospital‐Based Population in Central Tunisia

In Tunisia, 2 rickettsial groups, spotted fever group and typhus group, have been described since the beginning of the 20th century. Mediterranean spotted fever (MSF), also known as Boutonneuse fever, caused by Rickettsia conorii and transmitted by the dog tick Rhipicephalus sanguineus, is the most frequent rickettsial infection observed. Its seroprevalence in our region is 9% among blood donors and 23% in hospitalized febrile patients. Typhus group rickettsioses, caused by R. typhi and R. prowazekii, are less frequently reported than in the 1970s. Only sporadic cases of typhus were reported in the last decade. However, R. typhi antibodies were present in 3.6% among healthy people and 40% in patients with acute fever of undetermined origin. In the unit of Infectious Diseases at Farhat Hached University Hospital in Sousse, during 2007, 5% of hospitalized patients had eruptive fever, and half of the cases met clinical criteria of MSF and/or were confirmed by rickettsial serology. The majority of cases (90%) were noted in hot seasons, and contact with domestic animals was found in 76%. The most common symptoms were fever (present in all cases), skin rash (in 85% to 98% of cases), and headache (in 69.5% of cases). The clinical triad (fever + rash +"tache noire") was noted in 32 to 61%. Normal blood cells or leukopenia, cytolysis, and thrombopenia were the most frequent biological abnormalities. Complications and malignant forms of rickettsial infections were reported in 3.5 to 6% among hospitalized adult patients. When specific serology was performed, MSF was confirmed in 15%, and we noted an emergence of murine typhus (MT) mistaken for R. conorii or viral infection. Rickettsia felis was identified in 1 patient, whereas 17% of cases remained undetermined. Rickettsia conorii Malish was identified by PCR in skin biopsies. Doxycycline was the antibiotic of choice for rickettsial infections; it was prescribed in the majority of patients, associated with fever defervescence, in a mean of 72 hours. The mean length of stay among hospitalized patients with rickettsial infections was 5.9 days. In conclusion, in our region, MSF and murine typhus are endemic. Doxycycline should be prescribed in patients with acute fever and skin rash, especially in hot seasons. These rickettsioses were characterized by benign prognosis. More skin biopsies are needed to identify other SFG rickettsies.

Relevance of Gamma Interferon, Tumor Necrosis Factor Alpha, and Interleukin-10 Gene Polymorphisms to Susceptibility to Mediterranean Spotted Fever

The acute phase of Mediterranean spotted fever (MSF) is characterized by dramatic changes in cytokine production patterns, clearly indicating their role in the immunomodulation of the response against the microorganism, and the differences in cytokine production seem to influence the extent and severity of the disease. In this study, the single nucleotide polymorphisms (SNPs) of tumor necrosis factor alpha (TNF-alpha) -308G/A (rs1800629) and interleukin-10 (IL-10) -1087G/A (rs1800896), -824C/T (rs1800871), and -597C/A (rs1800872) and the gamma interferon (IFN-gamma) T/A SNP at position +874 (rs2430561) were typed in 80 Sicilian patients affected by MSF and in 288 control subjects matched for age, gender, and geographic origin. No significant differences in TNF-alpha -308G/A genotype frequencies were observed. The +874TT genotype, associated with an increased production of IFN-gamma, was found to be significantly less frequent in MSF patients than in the control group (odds ratio [OR], 0.18; 95% confidence interval [95% CI], 0.06 to 0.51; P corrected for the number of genotypes [Pc], 0.0021). In addition, when evaluating the IFN-gamma and IL-10 genotype interaction, a significant increase of +874AA/-597CA (OR, 5.31; 95% CI, 2.37 to 11.88; P(c), 0.0027) combined genotypes was observed. In conclusion, our data strongly suggest that finely genetically tuned cytokine production may play a crucial role in the regulation of the immune response against rickettsial infection, therefore influencing the disease outcomes, ranging from nonapparent or subclinical condition to overt or fatal disease.

Mediterranean spotted fever with encephalitis

Rickettsia conorii infection is endemic in the Mediterranean basin, where it is known as Mediterranean spotted fever, also known as Boutonneuse fever and Marseilles fever. We report the case of a 66-year-old diabetic man who presented a severe form of the disease, complicated by acute renal failure, thrombocytopenia and encephalitis. Diagnosis was confirmed by indirect immunofluorescence assay. Despite appropriate treatment, severe neurological sequelae have remained. Medical literature on encephalitis caused by R. conorii is also reviewed.

Global Importance of Ticks and Associated Infectious Disease Agents

Ticks are medically important ectoparasites that have global distribution. They live in diversified habitats, have close contact with a wide range of vertebrate hosts, and can transmit a variety of disease agents to human beings, domesticated animals, and wildlife. Tick-borne infections can cause acute or chronic illnesses, such as Lyme disease, relapsing fever, Crimean Congo hemorrhagic fever, human babesiosis, Texas cattle fever, Rocky Mountain spotted fever, ehrlichiosis, Boutonneuse fever, tularemia, Colorado tick fever, and encephalitis. Human fatalities have been reported for some of these diseases. Certain tick species are also suspected vectors of Bartonella organisms. Having high reproductive potential, few natural parasites and predators, the ability to live several months or years, and relatively broad host ranges, ticks are well adapted for survival and difficult to control. Certain practices, however, such as early removal of attached ticks from skin, use of repellents, and landscape modifications near human dwellings can reduce tick bites and risk of infection.

Ocular Manifestations of Rickettsiosis: 1. Mediterranean Spotted Fever: laboratory analysis and case reports

Rickettsiae are short, pleomorphic but usually rod-shaped or coccobacillary Gram-negative bacteria that grow strictly in eukaryotic cells (obligate intracellular parasites). They have the ability to multiply in one or more arthropods and to exist in natural reservoirs of one or several warm-blooded animal hosts, including humans. Rickettsiae are divided into 5 groups: 1) Spotted fever group, including R. rickettsii, R. conorii, and R. akari; 2) Typhus group, including R. prowazekii and R. typhi; 3) Scrub typhus (R. tsutsugamushi); 4) Q fever (Coxiella burnetii); 5) Neorickettsiosis. In the Spotted fever group, R. rickettsii is the etiological agent of Rocky Mountain spotted fever, transmitted by the bite of a tick, whereas R. akari is the etiological agent of rickettsialpox, transmitted by the bite of a mite. Rickettsia conorii, the most widespread rickettsia of the spotted fever group, is the etiological agent of Mediterranean spotted fever (MSF) in humans. The brown dog tick, Rhipicephalus sanguineous, is the prevalent vector. The disease is normally transmitted by tick bite, but it may also be acquired through the skin or eye when the ticks are crushed. The disease is endemic during the spring and summer in most of the regions bordering on the Mediterranean and Black seas, in Kenya and other parts of central Africa, South Africa, and certain parts of India. MSF varies in severity but is seldom fatal. The incubation period is 5-7 days and the onset is sudden in about 50% of cases. The duration of disease is 7-14 days. The clinical signs and symptoms include fever (up to 40°C), headache, chills, myalgias, arthralgias, malaise, and anorexia. Maculopapular rash, involving also the palms of the hands and the soles of the feet, is a hallmark of rickettsial infection, but usually follows systemic symptoms. Its absence should not rule out a possible rickettsial etiology, especially during the first week of illness. 1 Conjunctivitis with petechial lesions on the bulbar conjunctiva and pharyngitis are common. Most patients with MSF present with a “tache noir”, a small crust surrounded by a violet erythemic halo, that represents the typical appearance of the MSF entrance site caused by the tick bite; however, its absence should not exclude a possible infection. Less common clinical signs include hepatomegaly and hepatitis, splenomegaly, mild pulmonary involvement, and CNS impairment. The ocular manifestations of MSF are usually limited to petechial lesions on the bulbar conjunctiva due to local vasculitis with conjunctivitis. Parinaud's oculoglandular syndrome, corneal ulcers, uveitis, retinal vasculitis, endophthalmitis, and anterior ischemic optic neuropathy have also been described. Various laboratory procedures can be used for diagnosing MSF, including isolation of R. conorii by culture, serologic testing (indirect immunofluorescence assay, IFA), immunohistochemical detection of R. conorii in skin biopsy, and PCR amplification of rickettsial DNA from tissue specimen. Detection of specific IgM and IgG anti-R. conorii by IFA is used regularly by most laboratories. Demonstration of IgM titers of ≥1:64 and IgG titers of ≥1:128 and/or a fourfold rise in IgG titer is considered evidence of R. conorii infection. The standard treatment for MSF is oral doxycyclyne (100 mg daily) for 10-14 days.

Malignant Boutonneuse fever with multiple organ failure: a three-case series

Rickettsia conorii infection, the agent of Boutonneuse fever, presents usually in a form considered benign, with serious complications in less than 10% of patients. Its mechanism of infection consists of vascular endothelial invasion by the microorganism and subsequent vasculitis and tissue necrosis. The process is usually localized or limited to the skin but can progress with malignant severe systemic involvement [1,2].

Relative chemokine and adhesion molecule expression in Mediterranean spotted fever and African tick bite fever

Mediterranean spotted fever (MSF) caused by Rickettsia conorii (R. conorii) is a potential lethal disease while African tick bite fever (ATBF) caused by Rickettsia africae is a self-limiting flu-like illness. We hypothesized that different inflammatory potential in endothelial cells could contribute to the different clinical features in these rickettsioses. We analyzed the effect of heat-inactivated R. africae and R. conorii on the mRNA and protein levels of monocyte chemoattractant protein (MCP)-1, interleukin (IL)-8 and adhesion molecules in endothelial cells. Serum samples from patients with MSF (n=16) and ATBF (n=15) were collected before and after therapy. R. conorii induced a marked increase in MCP-1, IL-8, and adhesion molecules in endothelial cells, involving toll-like receptor 4 activation. In contrast, R. africae induced MCP-1 expression, but only modest or no responses were seen on IL-8 and adhesion molecules. Comparable to the in vitro response, levels of IL-8 and adhesion molecules showed no or only a modest increase in ATBF patients while these inflammatory markers were markedly elevated during MSF. Our findings suggest a superior inflammatory potential of R. conorii as compared to R. africae in endothelial cells, potentially related to the more severe inflammation in MSF comparing ATBF.

Fatal Case of Israeli Spotted Fever after Mediterranean Cruise

To the Editor: Israeli spotted fever (ISF) is caused by Rickettsia conorii subsp. israelensis. This recently described subspecies is genetically close to R. conorii subsp. conorii, the agent of Mediterranean spotted fever (MSF) (1,2). ISF is likely transmitted by the dog tick Rhipicephalus sanguineus (3). This tick, which is also the vector of R. conorii subsp. conorii, has low affinity for hosts other than dogs. Therefore, like MSF, cases of ISF will likely be sporadic (4,5). ISF was first reported in Israel (1) and was also recently described in Portugal and Italy (6–8). The clinical manifestations of ISF are similar to those of other spotted fever group infections, but an inoculation eschar is rarely observed and a history of tick exposure is not always present (4–6,9). The incubation period is ≈7–8 days after the tick bite (4).

Atrial fibrillation in Mediterranean spotted fever

Mediterranean spotted fever (MSF) is a tick-borne acute febrile disease caused by Rickettsia conorii and characterized by fever, maculo-papular rash and a black eschar at the site of the tick bite ('tache noir'). We describe the case of a 58-year-old man affected by MSF who developed atrial fibrillation. The patient presented himself to the hospital after 7 days of fever, malaise and severe headache. Cardiac auscultation revealed a chaotic heart rhythm and an electrocardiogram confirmed atrial fibrillation with a fast ventricular response. Diagnosis of MSF was made after the appearance of a maculo-papular skin rash, and treatment with oral doxycycline was started. An immunofluorescence antibody test confirmed R. conorii infection. The patient recovered after 7 days of treatment. Cardiac arrhythmia is a rare complication of MSF. Inflammation may play a role in the pathogenesis of atrial fibrillation. R. conorii is an intracellular bacterium which could trigger atrial fibrillation. Our patient was previously healthy and had no reported history of cardiac disease. This suggests that heart function should be monitored in MSF patients even in the absence of underlying risk factors.

Mediterranean spotted fever in Algeria — new trends

Mediterranean spotted fever (MSF) due to Rickettsia conorii is the most important tick-borne disease occurring in North Africa. However, there are only a few fragmentary reports on the epidemiology and clinical aspects of rickettsioses in North Africa, and cases are still rarely documented. We report herein a prospective study conducted in Oran, the second largest city in Algeria. This disease has not been properly described in Oran or in other Algerian cities. A total of 167 cases of Mediterranean spotted fever were documented for the first time by the use of reference methods including immunofluorescence serology and Western blot and absorption studies, including isolation in culture by the shell-vial techniques, and molecular tools. Although some aspects of MSF were found to be in accordance with the general epidemiology of the disease, uncommon aspects were found, including increased incidence and the presence of multiple inoculation eschars in 12% of patients. The role of climatic changes in alterations of host-seeking and feeding behaviors of the vectors, including the brown dog tick Rhipicephalus sanguineus, is discussed. Also, 49% of patients were hospitalized with a severe form. The global death rate was 3.6%, but it was 54.5% in patients hospitalized with major neurological manifestations and multiorgan involvement. The present report gives a unique panel of clinical aspects of MSF as well as new trends in this disease. Entomological, climatic, and molecular studies are needed to better understand both epidemiological and clinical aspects of MSF.

Questions on Mediterranean spotted fever a century after its discovery.

Mediterranean spotted fever (MSF) was first described in 1910. Twenty years later, it was recognized as a rickettsial disease transmitted by the brown dog tick. In contrast to Rocky Mountain spotted fever (RMSF), MSF was thought to be a benign disease; however, the first severe case that resulted in death was reported in France in the 1980s. We have noted important changes in the epidemiology of MSF in the last 10 years, with emergence and reemergence of MSF in several countries. Advanced molecular tools have allowed Rickettsia conorii conorii to be classified as a subspecies of R. conorii. New clinical features, such as multiple eschars, have been recently reported. Moreover, MSF has become more severe than RMSF; the mortality rate was as high as 32% in Portugal in 1997. Whether Rhipicephalus sanguineus is the only vector and reservoir for R. conorii conorii is a question not yet answered.

Moisture requirements for activity/survival of the gulf coast tick, Amblyomma maculatum Koch (Acari: Ixodidae), based on a water balance study of all life cycle stages

To provide information pertaining to features fundamental for survival, activity and spread of the Gulf Coast tick Amblyomma maculatum Koch (Acari: Ixodidae), vector of agents of human spotted fever rickettsiosis (boutonneuse fever) and canine hepatozoonosis, we determined water balance characteristics for each life stage, supplementing earlier work on adults, for a more comprehensive evaluation through the life cycle. The water balance profile of A. maculatum follows a consistent developmental pattern where the egg is the major water-conservation stage, the larva emphasizes water gain (water vapor absorption from drier air; low critical equilibrium activity, CEA), the adult emphasizes water retention (low net transpiration rate) and the nymph is transitional. A. maculatum in the various stages shares a similar dehydration tolerance limit, CEA, percentage body water content and inability to drink free water from droplets with other ticks. The low net transpiration rate of A. maculatum is the distinguishing feature, classifying A. maculatum as xerophilic compared to other tick species and their corresponding stages. Of importance, the low net transpiration rate of A. maculatum does not match the humid environment (predicting high net transpiration rate) where this tick is distributed, rather it reflects conditions of the microhabitat and slightly altered behaviors relevant to drying out that permit survival in the larger areas that they occupy. Thus, the view that net transpiration rate is an indicator of habitat preference in terms of moisture requirements needs to be modified. Ticks operate on a smaller scale (i.e., microhabitat), indicating a need for direct field observations.