The paper covers the following several plants with edible and medicinal uses in the Zugdidi Botanical Garden: 1. Pomegranate-Punica granatum 2. Walnut tree- Juglans regia 3. Candy tree Hovenia-Hovenia Thunb. 4. Ordinary chestnut- Castanea sativa mil. 5. Laurel- Laurocesus. The aforementioned plants grow well in the soil and climate conditions of the Zugdidi Botanical Garden. The later was constructed in 1840 by the last ruler of Samegrelo, Davit Dadiani in honor of his wife, Ekaterine Chavchavadze. From the outset the aforementioned Ruler looked after the Garden and later, he entrusted his wife Ekaterine with the Garden. The Queen took a high interest in the Garden. First, she brought in an Italian gardener and later, tasked him to bring almost every exotic plant from Europe. The later included a few variety of plants from the French King Louis-Philippe’s Gardens of Versailles. The paper covers those plants of the Dadiani with edible and medicinal uses which are included in the Red Data Book as well as in the Global Red List. The paper provides description of dissemination area of these plants, their bio-morphological characteristics, chemical constituents and utilization in medicine with the purpose of treating various diseases.

From November 2024 to March 2025, the Natural History Museum, London (NHM), supported by the UK Department for Culture, Media and Sport (DCMS), led a national programme to explore a new model for deploying artificial intelligence (AI) across the UK cultural and heritage sector. Inspired by the Museum’s in-house AI Lab Programme (Poon 2024), which has successfully applied AI to research, collections management, and public engagement within the NHM (e.g., Poon and Leong 2024, Salili-James 2024, He et al. 2024, Zhang et al. 2025c, Gallois et al. 2025), this national initiative extended that model to a broader institutional landscape. The programme examined how AI can support biodiversity research, collections management, accessibility, and public engagement, while addressing the practical realities of AI adoption, scalability, and long-term sustainability. In partnership with the Zoological Society of London, Lyme Regis Museum, National Museums Liverpool, the Royal Agricultural University, and the Royal Botanic Garden Edinburgh, the programme delivered five AI pilot projects. Each project developed an AI-driven solution to a critical challenge: automated species classification of illegally traded snake goods (Leong et al. 2025a); automatic data extraction from index cards (Leong et al. 2025a); AI-generated alt-text for digital collections (van Schalkwyk et al. 2025); a conversational chatbot trained on herbarium data (Zhang et al. 2025b); and a herbarium digitisation quality-control tool (Zhang et al. 2025a), respectively. These pilots demonstrated how AI can deliver both operational efficiencies and public benefit. Automated transcription and text extraction have streamlined digitisation efforts, reducing the time and resources required for archival documentation. AI-driven image processing has enhanced the quality control mechanisms for digitisation, ensuring higher standards in digital preservation. Computer Vision models have provided new capabilities in species classification and object identification, offering valuable insights for conservation and research. Additionally, AI-powered accessibility tools, such as automated alt-text generation and chatbot interaction, have improved inclusivity by making collections more accessible to diverse audiences. By engaging partners of different scales, locations, disciplines, and specialisations, the programme provided a rare opportunity to test AI in diverse institutional environments. This diversity enabled robust evaluation of prototypes and fostered knowledge exchange, skills development, and capacity building across the sector. Crucially, the collaborative model demonstrated the importance of co-design: tools developed in close dialogue with institutional priorities were more readily embedded in existing practices and had clearer pathways to sustainable integration. Beyond technical outcomes, the programme highlighted sector-wide considerations for responsible AI adoption. These included: the need for consistent data standards to support model training and interoperability; designing systems that augment, rather than replace, professional expertise; ensuring infrastructure and training are in place to support long-term use; and transitioning from short-term pilots to sustainable, maintainable solutions. Collectively, the five projects suggest how the sector might progress from isolated experimentation to a coordinated ecosystem of digital innovation. Although the pilots are at proof-of-concept stage, the projects have already demonstrated measurable improvements in workflows, data quality, and accessibility. They provide a framework that other organisations can adapt, offering practical entry points into AI adoption. At the same time, the work underscores the importance of continued investment in digital transformation to ensure that heritage institutions can keep pace with rapid technological change. In summary, the NHM-DCMS AI Pilot Programme has shown that AI can be responsibly deployed in culture and heritage when solutions are co-created with institutional partners, tailored to local contexts, and designed with flexibility for future use. While still early in development, the programme has established a strong foundation for future work, charting a path towards AI applications that improve efficiency, inclusivity, and engagement across museums, galleries, and research collections in the UK and beyond.

Small’s blueberry ( Vaccinium smallii ) is a berry shrub species widely distributed in northern Japan, Sakhalin Island, the Kunashir and Iturup islands, and the Sovetsko-Gavansky district of Khabarovsk Krai. This study presents the first investigation of V. smallii coenopopulations on Sakhalin Island. Research focused on native plants, selected forms exhibiting economically valuable traits, and introduced cultivars maintained at the Sakhalin Botanical Garden Department of the Botanical Garden-Institute, Far Eastern Branch of the Russian Academy of Sciences. Field studies on Sakhalin Island, complemented by stationary research at the Botanical Garden conducted since 2019, have characterized the species’ biology. V. smallii shows a preference for well-lit habitats, a late vegetation and flowering onset that reduces late frost damage, low soil and moisture requirements, disease and pest resistance, and successful acclimatization in full-light experimental plots. The fruits exhibit superior quality compared to several cultivated species, with notable variability in key traits, indicating high potential for introduction into cultivation and selection research. Analysis revealed a more than 15-fold difference in sugar content and 4,1-fold difference in vitamin C infruits between typical and selected fruit forms. Therefore, the introduction of V. smallii into cultivation is a timely and important objective. Future research on high-value selected forms under both natural and cultivated conditions, combined with parallel efforts to develop improved varieties, will advance the cultivation of V. smallii as a promising novel berry crop.

To obtain a high yield of each crop, a decisive factor is high indicators of germination energy and laboratory germination of their seeds. In the article on the example of four species of ornamental plants Lilium pensylvanicum, Delphinium grandiflorum, Scutellaria crassifolia and Bergenia crassifolia the course and results of calculations to establish the timing of determining the germination energy of their seeds are outlined. In general, the main sowing qualities of 24 species of ornamental plants recommended for wide propagation for landscaping of settlements of Yakutia were determined. The work was carried out on the basis of the collection of natural flora of Yakutia at the Botanical Garden of the Institute of Biological Problems of Cryolithozone SB RAS. Seeds of different years of collection were tested. In total, the number of samples ranged from 5 Dianthus superbus to 55 Papaver nudicaule subsp. gracile. It is shown that the character of germination of seeds of the studied species is ambiguous, the terms of determining the germination energy of their seeds are also different, which vary from 3 days for Dianthus versicolor to 15 days for Aquilegia sibirica. Statistical and mathematical processing of experimental data using MS Excel program was carried out. The obtained data are of considerable interest for use in ornamental floriculture, research work in the study of seed quality, as well as in other experiments in the practice of seed science.

Larch (genus Larix Mill.) is one of the key representatives of coniferous trees in the boreal forests of Siberia, which plays a very important ecological and economic role. The formation of entomofauna specific to larch in green areas is an area of scientific interest and requires study. Therefore, the purpose of the research was to identify and determine the species composition of larch pests in the plantations of the Central Siberian Botanical Garden SB RAS. As part of the research, a complex of phytophages was identified and divided into pests of fruits and seeds: (Lasiomma laricicola Karl., Dioryctria adietella Denis & Schiffermuller), pests of needles: (Diprion pini L., Adelges laricis Vallot.) and pests of kidneys: (Dasineura laricis F. Low.). As a result of our research, it was revealed that the most common species are Adelges laricis Vallot., Dasineura laricis F. Low., Diprion pini L., which were found during examinations on more than 5 samples of larch of different origin (Larix sibirica Ledeb., Larix gmelinii Rupr., Larix gmelinii Rupr., Larix decidua, Larix kampferi). Rare specimens (Lasiomma laricicola Karl.) were found on two species of larch Larix cajanderi Mey. and Larix sibirica Ledeb. A very rare species of phytophagus, Dioryctria adietella Denis & Schiffermuller, was found on a single sample of Larix sibirica Ledeb. As a result of the research, entomophages, representatives of the orders Coleoptera, Neuroptera, Hymenoptera, Diptera, have been identified, which can potentially be used to protect larch from populations of the most dangerous pests, contributing to the preservation of decorative plants and improving the aesthetic appearance of plantings.

Study was carried out to determine the phenological characteristics of prominent tree species in the urban forests of Srinagar city in India from 2023 to 2024 at three sites viz, Shalimar Bagh, Botanical Garden and Iqbal Park. Phenology of five deciduous species namely Platanus orientalis, Salix babylonica, Salix alba, Juglans regia and Ginkgo biloba was recorded in all the seasons at all the three sites following the Observational and Herbarium approaches. All phenological stages occurred earlier in 2024 than 2023, with leafing concentrated in early March–April and defoliation in late September–early December. Greatest advances were in vegetative bud initiation (1–2 months earlier across species), followed by leafing, flowering, and defoliation in P. orientalis (16, 10–20, and 8 days earlier). Juglans regia showed minimal shifts (3–4 days or on time). Salix alba had the earliest bud break (early March) and longest growing season (to early December), while Ginkgo biloba was latest to bud.

Documented living plant collections distinguish botanic gardens from other green spaces and horticultural landscapes. With more than 3,500 collections worldwide, these institutions steward at least 105,634 species-around 30% of all land plant diversity-while fulfilling amenity, educational, scientific and conservation roles. However, twenty-first-century challenges demand a re-evaluation of how these collections are documented and managed. We argue that meeting these emerging needs requires higher standards of coordinated information management and innovation in data infrastructures across the global network. This Perspective critically examines data management practices of living collections supporting scientific research and conservation, from institutional to global levels. We identify the renewed demands on living collections, highlight exemplar global data infrastructures, define data challenges inherent to living collections and explore how current systems fall short in enabling a connected global system. Finally, we outline a vision for high-performance collections, fully integrated into a robust global data ecosystem.

Context Agathis australis (kauri) is endemic to New Zealand (NZ) and classified as Endangered by the International Union for the Conservation of Nature. Although still the main priority, in situ conservation alone is no longer sufficient to safeguard species from extinction, especially when they are threatened by climate change and pathogens. Ex situ conservation provides opportunities to maintain plants as seeds, tissue culture or living collections in botanic gardens or germplasm repositories. Aims The current study aimed to quantify the production of viable seed in ex situ collections of A. australis growing at the Ōtari Native Botanic Garden and optimise seed banking methods. Methods Cones were collected from six specimens over 5 years and the production of viable seeds quantified. Seed germination protocols were established, the impact of desiccation assessed and the role of storage temperature (5°C, −18°C and −196°C) on seed viability evaluated. Lastly, the fatty acid profiles of fresh and stored seed were determined. Key results Viable seed production varied significantly between individual trees and years. Seeds were not desiccation sensitive but to maintain viability, it was essential to store seeds at −18°C or −196°C. Seeds had high amounts of long-chain fatty acids which increased following storage. Conclusion Ex situ collections of A. australis are a valuable tool for the development of conservation methods such as seed collection, germination and seed banking. Implications This study provides essential information to maximise the contribution of ex situ living collections for research into phenology, seed physiology and germplasm storage, which can guide integrated conservation and restoration actions for Agathis species.

A comprehensive study of 11 paniculate phlox cultivars (Phlox paniculata L.) was conducted for the first time for the soil and climatic conditions of the Middle Volga region. The research was performed on plants introduced at the Cheboksary Branch of the Federal State Budgetary Institution for Science Main Botanical Garden named after N. V. Tsitsin Russian Academy of Sciences in 2020–2024. The aim of the study was to select the best specimens for industrial propagation and cultivation. The ornamental value of the phlox cultivars and their economically valuable traits were analyzed. Furthermore, the resistance of the cultivars to a range of adverse climatic factors in the introduction region was evaluated. Detailed phenological descriptions and morphological profiles were compiled for each cultivar, enabling a comparative analysis across multiple parameters. Specifically, key biometric indicators were established, including bush height, inflorescence length and diameter, and flower diameter. The study of decorative traits was based on the following plant qualities: bush – height, density, habit; strength and decorative quality of the peduncle; number of flowers per peduncle; inflorescence – structure, shape, size (length-to-diameter ratio), color; fragrance; originality; plant condition; the stability in the ground. The investigation of agronomic and biological qualities of the phloxes focused on: general condition and stability of plants within a cultivar; development and growth rate; ability for vegetative propagation; degree of disease damage. Observations indicated that the studied cultivars varied significantly: height – from 55 to 125 cm, inflorescence size – from (12x12) to (21x13) cm, the number of flowers per inflorescence – from 13 to 37, flower size – from 3.4 to 4.4 cm, color – from white and pink to purple and red-violet. Moreover, variation was noted in the degree of resistance to fungal diseases. Cecil Hanbury, Novinka, and Tchayka cultivars were distinguished by a high degree of resistance to pathogenic fungi. September Glow and Pougatchov were identified as the most susceptible cultivars to diseases. Elbrus and Ottly Ideal were cultivars with early flowering periods from the first ten days of July until July 15. The remaining cultivars belonged to mid-season types – from the second ten days of July until August 5. Specimens with a flowering period exceeding 35 days were classified as long-flowering – Marija Scharonova, Novinka, and Cecil Handbury. Consequently, the following cultivars were identified as the most promising for introduction into cultivation under soil and climatic conditions of the Middle Volga region: Cecil Handbury, Elbrus, Marija Scharonova, Novinka, Tchayka, and Violetta Gloriosa.

This article studies the biocenotic relationships of harmful organisms in the artificial ecosystems of the Main Botanical Garden of RAS. The research was conducted in 2021–2024. The study emphasizes the importance of monitoring research in the context of phytosanitary destabilization of ecosystems under the influence of anthropogenic factors. Monitoring of harmful organism biodiversity revealed an uneven distribution of pathogen-entomological complexes. Their species spectrum, the prevalence of specific components, and the multiplicity of their manifestations varied depending on the ecosystem type, its balance, and stability. The determination of the structure of these entomo-pathogenic complexes showed that they include background, dominant, and crop-specific atypical harmful species. Their composition and dominance structure differed across ecosystem types, comprising from two to five or more components. Variations in the dominance spectrum of individual harmful species were recorded on plants of the same taxonomic rank but located in different biocenoses. The pathogen complexes of most plant species form an associated system of pathogens from the divisions Deuteromycota, Ascomycota, and Basidiomycota, together with phytophagous insects from the orders Coleoptera, Hemiptera, Thysanoptera, and Lepidoptera. The taxonomic composition of both pathogens and phytophages remained unchanged, with no evidence of an expanding dominant species spectrum. Variation was noted in accordance with the parameters of phenology and migration (for phytophagous insects). The maximum infectious load was characterized for the phylloplane, whose microbiota was represented by obligate and facultative parasites, as well as facultative saprotrophs. An analysis of the composition of dominant parasitic complexes was conducted on plants from more than 75 genera. Transformations in the structure of pathogen-entomological complexes were recorded in representatives of 5 families of flowering plants. Depending on the ecosystem type, the proportion of parasitic complexes in a state of population equilibrium during the specified period ranged from 45 % to 75 %. Critical zones of destabilization in biocenotic interactions were identified in the consortia of 6 plant species: Acanthus L., Aesculus L., Amorpha L., Clematis L., Humulus L., and Sida L.

Primulina tabacum Hance is a widespread ornamental and medicinal plant of tropical and subtropical regions (Li et al. 2023). In 23 May 2023, symptoms including stunting, yellowing of leaves, and severe root galls were observed in P. tabacum growing in the Guilin Botanical Garden, China (GPS 25°15′0″ N; 110°16′50″ E). The investigated area of P. tabacum was approximately 0.8 ha, we evaluated 12 P. tabacum plants within the sampled area and found a root galling incidence of 50%, with an average gall index of 3.5 (on a scale of 0 to 10) (Bridge and Page, 1980). Nematode egg masses were collected from infected roots of P. tabacum, and nematodes at different stages were collected using the shallow dish method for morphological identification. Females were globular to pyriform, with perineal patterns characterized by an oval or nearly circular shape as a whole, the dorsal arch was usually high, the lateral lines were wavy. The tail of the second-stage juvenile (J2) was very slender with a sharp tip. Morphological measurements of females (n = 15): body length = 687.3 ± 24.4 μm, body width = 532.4 ± 28.4 μm, stylet length = 14.4 ± 0.6 μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 5.4 ± 0.2 μm. The measurements of J2s (n = 20): body length = 412.3 ± 16.1 μm, body width = 16.8 ± 1.1 μm, stylet length = 12.6 ± 0.5 μm, DGO length = 3.7 ± 0.2 μm. Average tail length = 57.4 ± 3.8 μm. The observed typical characteristics of M. enterolobii were consistent with those previously described by Yang & Eisenback (1983) and Bulletin (2016). J2s hatched from a single egg mass were used for DNA extraction and molecular identification. The specific primers of M. enterolobii Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) were used to validate the identity of the species (Long et al 2006). Consistent with that previously described, the target amplification product was about 236 bp, and no product was amplified from the M. incognita or M. javanica (Chen et al. 2023). The rDNA-ITS region was obtained and sequenced by PCR amplification using V5367/26S (Vrain et al. 1992). The target product was 769 bp (GenBank accession no. PX285227), which was 99.87%-100% homologous to the M. enterolobii rDNA-ITS sequence available in the GenBank (OR789453, MT406251). Additionally, we amplified the D2A-D3B fragment of the 28S rRNA gene using the primers D2A/D3B (De Ley et al. 1999). The target product was 759 bp (GenBank accession no. PX287183), which was 100% homologous to those M. enterolobii 28S rRNA sequences available in the GenBank (MF467276, KX823403). Pathogenicity of M. enterolobii on P. tabacum plants was confirmed by Koch's Postulates. Approx 2000 J2s were inoculated on each plant (n=12), grown at 26℃ in sterilized soil. All inoculated plants developed root knots and egg massess after two months, whereas non-inoculated controls (n=12) remained healthy. The average root knots rating was 4.8. Approximately 60 ± 20 egg masses formed at the root, confirming the pathogenicity of M. enterolobii on P. tabacum. To our knowledge, this is the first report of M. enterolobii parasitizing P. tabacum in China. China is the center of origin and a main distribution area for P. tabacum, harboring abundant wild germplasm resources. The intensive cultivation of this prized specimen necessitates robust phytosanitary strategies focusing on prevention, strict quarantine, and careful management to mitigate biosecurity risks. This finding has important implications for control of M. enterolobii threatening P. tabacum in China.

The career of Eugène (Eugenio) Autran (1855–1912) was marked by two profound changes. The first occurred when he transitioned from working in industry to becoming a full-time naturalist, taking-up the position of curator at the Boissier Herbarium in Geneva, Switzerland in 1888, as well as becoming editor of its in-house journal, the Bulletin de l'Herbier Boissier. The second change came twelve years later when he abruptly left and emigrated to Argentina, apparently under something of a cloud. There, he worked at the Pharmacology Museum at the University of Buenos Aires, where his role included editing the Trabajos del Museo de Farmacología and working for the Ministry of Agriculture. Autran also helped establish the Buenos Aires Botanical Garden and was involved in the creation of Argentina's national parks. Although he is mainly remembered as a botanist, his first interest was actually entomology. Before leaving Switzerland, he donated an extensive collection of Hemiptera to the Muséum d'histoire naturelle de Genève (MHNG). Despite his sudden departure, Autran continued to send specimens (and publications) to the museum from Argentina and apparently enjoyed good relations with Genevan scientists.

ABSTRACT Allium blandum belongs to a polymorphic species complex A. carolinianum , which is currently under taxonomic disentangling. We define its morphological characters and type locality in the Himalayas on the border between India and China. Its surviving original material is limited to the color illustration prepared by Indian artist Gorachand for Nathaniel Wallich and preserved in the Kew Botanic Gardens, which was reproduced with minor technical alterations in the protologue. The original illustration is designated here as lectotype of the name.

The Indonesian Island of Sulawesi is home to a number of members of the ginger family, Zingiberaceae, with unusual turquoise flowers not found anywhere else. A recent paper reinstating Hellwigia, using molecular evidence, placed these "jade gingers" in this genus. During a joint expedition between the Royal Botanic Garden Edinburgh and Bogor Botanical Gardens 26 years ago, an interesting jade ginger was collected at Mt. Sojol. This is similar to two other named species from Sulawesi, H. coeruleoviridis and H. glacicaerulea, in having unusual dimorphic, turquoise-bluish green flowers but differs from both in the much shorter ligule without a demarcation line and is described here as Hellwigia opalina. In preparation for this, all available material of jade gingers from Sulawesi was examined, and all except the collections from Mt. Sojol had a long ligule with a demarcation line similar to H. coeruleoviridis and H. glacicaerulea. It is, however, questionable whether the identification by R.M. Smith of several collections from Lore Lindu National Park, Central Sulawesi, matches the type of H. coeruleoviridis, which was lost in Berlin during the Second World War. Until this species has been recollected at its type locality, here identified as Mt. Tentolomatinan, 300 km away, the identification cannot be easily ascertained. Rhizomes from Mt. Sojol were cultivated in botanic gardens, and plants cultivated at the Royal Botanic Garden flowered several times, which enabled detailed studies and dissection of both flower morphs. This is usually impossible during fieldwork and emphasizes the importance of cultivation of gingers-not just for ex situ conservation but also for research purposes. Detailed photographs taken of the cultivated plants were used to obtain a better morphological understanding and to illustrate Hellwigia opalina in the present paper.

Abstract Indigenous peoples and local communities play a pivotal role in addressing the climate and biodiversity crises. The South Rift Association of Land Owners (SORALO) is a community‐driven organization representing 30 Indigenous Maasai communities in Kenya, which cultivates resources to support communal landscape management. The Cincinnati Zoo & Botanical Garden (CZBG) is an Association of Zoos and Aquariums (AZA)‐accredited zoological facility and has partnered with SORALO since its inception in 2004. This study evaluates the strengths and challenges of the SORALO‐CZBG partnership using the PARTNERS framework and examines its alignment with the Naivasha Vision—principles established by African conservation leaders in 2023 at the African Community Conservation Forum. We conducted eight semi‐structured interviews with SORALO and CZBG staff (four from each organization) and analysed them through thematic analysis and constant comparative methodology. The analysis shows the PARTNERS framework is an effective tool for evaluating the strengths and opportunities for growth between an international conservation partner and a community‐based conservation organization. The SORALO‐CZBG partnership is aligned with the Naivasha Vision and has strengths in all facets of the PARTNERS framework. Key opportunities for growth in the partnership were found in aptness, responsiveness, negotiation, empathy and strategic support. This evaluation acted as a tool for SORALO‐CZBG leaders to talk through strengths and opportunities for growth, along with plans to address each. Practical Implication : Our findings highlight key factors that strengthen conservation partnerships and offer recommendations for conservation organizations, especially international non‐governmental organizations, to examine their partnerships and practices to enhance collaboration with community‐led conservation initiatives and their leaders.

Based on the male genitalia, five new leafhopper species of Limassolla, L. pygalis Ran & Song, sp. nov., L. maehongsonensis Ran & Song, sp. nov., L. yangi Ran & Song, sp. nov., L. lampangensis Yuan & Song, sp. nov. and L. andasibensis Yuan & Song, sp. nov., are described and illustrated. The collecting localities are as follows: L. pygalis sp. nov. from Pa Hin Ngam National Park, Dipterocarp forest, Chaiyaphum Province, Thailand; L. maehongsonensis sp. nov. from Namtok Mae Surin National Park, Haad Saen/Huai Fai Kor Reservoir, Mae Hong Son Province, Thailand; L. yangi sp. nov. from Tat Tone National Park, Dry Dipterocarp Forest, Chaiyaphum Province, Thailand; L. lampangensis sp. nov. from Chae Son National Park, Spa/roadside, Lampang Province, Thailand; and L. andasibensis sp. nov. from a botanic garden near the entrance to Andasibe National Park, Toamasina Province, Madagascar.

ABSTRACTOrchids are traded globally, where wild populations can be threatened by overharvesting, habitat loss, and climate change. Many orchid species lack ex situ protection, such as botanical gardens, making in situ genetic studies of wild populations critical to inform conservation plans. Taiwan is a center for orchid diversity and has witnessed declines in wild orchids. Holcoglossum pumilum, an island endemic epiphytic species, is popular among citizen scientists and shows potential for public engagement in biodiversity conservation. This study aims to evaluate the genetic diversity, population structure, and adaptive potential of wild Holcoglossum pumilum in Taiwan, not only to serve as an example for public outreach but also to inform conservation policy. We collected 64 plants from 18 sites across Taiwan and used ddRADseq to generate genome‐wide SNP data. We found higher genetic diversity in southern populations than in northern ones. While evidence for genetic clustering and isolation by distance was limited, we detected significant genotype–environment associations, especially with annual precipitation. Demographic reconstructions suggested a pre‐LGM expansion followed by a plateau. Contemporary Ne estimates varied by data filtering strategies but were mostly below 500. Our study demonstrates the critical role of genomic data not only in revealing the evolutionary origin of genetic diversity but also in guiding conservation plans. Specifically, we argued that the seasonal monsoon and the mountainous landscape of Taiwan may have shaped a latitudinal gradient of genetic diversity in H. pumilum. As a result, southern populations exhibit greater genetic diversity, which makes them priorities for conservation management.

The article presents important aspects of the biomorphological features and essential oil content of 2 allochthonous species of the genus Artemisia L., Asteraceae family, introduced under the pedoclimatic conditions of the Republic of Moldova: Artemisia abrotanum L. Thunb and Artemisia stelleriana Besser, which behave as herbaceous, perennial plants. The species have been investigated as high value aromatic, medicinal and ornamental plants. The biologically active substance in the plants is the essential oil, which is appreciated in phytotherapy, cosmetology and aromatherapy. The experimental results of the study demonstrate that Artemisia species, introduced into new pedoclimatic conditions, have good adaptive potential and do not demonstrate special requirements for local factors, go through the entire development cycle, thus they can be successfully recommended as promising species to increase the assortment of aromatic plants and with potential possibilities of being implemented in various branches of the national econom y.

This paper presents the results of a comparative study of seed productivity and seed quality in six accessions of daylily species introduced to the forest-steppe conditions of Western Siberia. The research was conducted at the Central Siberian Botanical Garden of the Siberian Branch of the Russian Academy of Sciences (Novosibirsk) during 2017–2019. It was established that the accessions differed significantly in their capacity for seed reproduction. Potential Seed Productivity (PSP) ranged from 27 to 51 ovules per fruit. Real Seed Productivity (RSP) per fruit varied from 12–15 seeds in H. coreana and H. esculenta to 30–35 seeds in H. minor from the Tomsk Region and Tuva, with average values of 21–23 seeds recorded for H. middendorfii and H. minor from Transbaikalia. Seed set percentage (SSP) for H. coreana and H. esculenta was below 50%, whereas for H. middendorfii and H. minor from the Tomsk Region and Tuva, it reached 80%. Average seed mass per fruit ranged from 238 to 305 mg, with the exception of H. esculenta, which exhibited values 2–3 times lower. Seed quality across different reproduction years varied significantly, as determined by laboratory germination rates and the percentage of shriveled and rotten seeds. The results demonstrate that in the arid conditions of the forest-steppe, species daylilies are capable of producing sufficient quantities of high-germination seeds, with the exception of H. esculenta. Seed reproduction potential is largely determined by species specificity; however, the high intraspecific and individual variability of these indicators suggests active adaptation of daylilies to seasonal weather fluctuations.

Settling between Donna Haraway’s proposal of “staying with the trouble” and Hélio Oiticica’s injunction to “experiment the experimental”, we present a series of strategies from which we seek to achieve intimacy with the Medellín campus of the National University of Colombia, a sort of botanical garden which appears as an affirming space for vital niches, through gestures of research-creation in multisensorial cartographic operations. As a result, the cocreation project Unwitting Foodstuffs is born, a gesture of collective more-than-human creativity that, using a video installation, speaks of a sensitive disposition towards the world in the midst of an ecology of artistic, educational and care-related practices, in which a radical ethics of multispecies cohabitation takes place. We close by insisting upon the urgency of dissolving limits between ourselves and our environment, and turning every place, in our case, our campus, into our Earth, to be and to become with it, as a form of situated and singular learning, befitting one who accepts the fact that they shall live and die on a planet in ruins.