Blast Tests Research Articles

Failure assessment of concrete shear walls under close-in blast based on viscous damage model

In this research, failure of reinforced concrete shear walls under close-in blast is evaluated based on numerical analysis. By introducing the Duvaut–Lions type damage driving stress rate, a dynamic viscous damage evolution law for concrete materials is constructed under the framework of elastoplastic damage theory. The rate effect-induced increase in concrete strength is well captured by the suggested model. For validation, the response of reinforced concrete slabs in blast tests and their mechanical behaviors after explosion were calculated, and the results are in good agreement with the experimental findings. Under blast loads at various scaled distances, the failure of a series of reinforced concrete shear walls with different axial load ratios is simulated, and the post-blast residual bearing capacity is calculated using a three-step loading analysis process. The ratio of the residual axial strength is defined to assess the performance degradation of the shear walls after blast, and the effect of different factors on the failure of structures under blast is examined.

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) primer design based on Indonesia SARS-CoV-2 RNA sequence

BackgroundThe COVID-19 pandemic has highlighted the importance of tracking cases by using various methods such as the Reverse transcription loop-mediated isothermal amplification (RT-LAMP) which is a fast, simple, inexpensive, and accurate mass tracker. However, there have been no reports about the development of RT-LAMP primer designs that use genome sequences of viruses from Indonesia. Therefore, this study aimed to design an RT-LAMP primer using SARS-CoV-2 genome sequences from Indonesia and several other countries representing five continents in the world, as well as genomes from five Variants of Concern (VOC). ResultThe results showed that the consensus sequence of 70 SARS-CoV-2 virus sequences was obtained with a length of 29,982 bases. The phylogenetic test confirmed that the consensus sequence had a close kinship with the SARS-CoV-2 Wuhan Isolate. Furthermore, the SimPlot analysis showed that there was a high genetic diversity of sequences from the Coronaviridae tribal virus at base sequences of 1,500–5,000, 6,500–7,500, and 23,300–25,500. A total of 139 sets of primers were obtained from the primer design with 4 sets namely T1_6, T1_9, T4_7, and T4_52 having the best characteristics. Based on the secondary structure analysis test on 4 sets of primers, T1_6 and T1_9 were predicted not to form secondary structures at RT-LAMP operational temperatures. The primer set T1_9 showed better specificity in BLAST NCBI and eLAMP BLAST tests. ConclusionThis study obtained a primer set of T1_9 with base sequence F3: CACTGAGACTCATTGATGCTATG, B3: CCAACCGTCTCTAAGAAACTCT, F2: GTTCACATCTGATTTGGCTACT, F1c: GAAGTCAACTGAACAACACCACCT, B2: CCTTCCTTAAACTTCTCTTCAAGC, B1c: GTGGCTAACTAACATCTTTGGCACT, LB: TGAAAACAAACCCGCCGTCCTTG, which meets the ideal parameters and has the best specificity. Therefore, it is recommended for use in further tests to recognize SARS-CoV-2 from Indonesia, other five continents, as well as five VOCs, including the new Omicron sub-variant.

Effects of delay time on crack coalescence between two boreholes

Delayed detonation widely occurs in rock blasting, which has a significant influence on the propagation and interaction of explosion-induced stress waves. This affects the rock fracture interconnection between adjacent boreholes in controlled blasting. In this study, the effects of delay time on crack coalescence between two blastholes in contour blasting are experimentally, theoretically and numerically investigated. The rock cracking in two-hole blasting on 200 × 200 × 50 mm granite plate is first experimentally examined, in which the delay time is determined by high-speed photography and the rock fracturing is identified by digital image correlation. Then, two-hole blasting with delayed initiation is analytically modelled, and the fracture propagation behaviours in blast tests are explained based on the evolution of explosion-generated stress waves and peak stress distribution between two holes. Subsequently, 3D finite element models are built in LS-DYNA to simulate the evolution of explosion-produced pressure, rock fracturing and energy dissipation in two-hole controlled blasting with delayed initiation. The results indicate that in two-hole contour blasting, the stress superposition zone, which produces local stress enhancement in the vicinity of the stress wave collision point, moves closer to the later detonated hole. The superposed stress facilitates the preferential extension of blast-created cracks along the connection line of boreholes, and the crack from the later detonated hole extends farther than that from the first detonation hole. The optimal crack coalescence in contour blasting archives when the delay time allows stress waves to approximately propagate through the hole spacing.

Rocket blast resistance of the fully demountable high performance FRC tongue and groove blocks

AbstractWithin the scope of this study, the design and testing of a fully demountable high‐performance fiber‐reinforced concrete (FRC) barriers with high resistance to sudden dynamic explosion and impact loadings is investigated. In order to solve such an engineering problem, a special FRC “tongue and groove” blocks are designed in a way that could be constructed by two persons to form barriers of various shapes and sizes by combining them easily. The structures produced with these blocks were produced using a hybrid, special FRC mixture in order to resist various bullets, rocket launchers, and explosion effects to protect the person behind them. Within the scope of this study, the resistance of five different special FRC mixtures with different properties against sudden dynamic blasting effects was determined by comparing and interpreting the acceleration‐time and strain‐time measurements taken from the wall directly. The results obtained from the dynamic blasting tests carried out in the field were compared with the results of the numerical analysis performed using the Ls‐Dyna finite element software. As a result of the study, the barrier structure produced with special FRC, in which hybrid nylon and steel fibers are used as reinforcement, exhibited the most successful results for absorbing the energy caused by the rocket blast loadings.

A methodology for predicting far-field blast loading on structures

Structural engineers are often tasked with the challenge of enhancing the resilience of buildings and structures to withstand blast loading from the detonation of energetic materials. Such loading typically occurs during terrorist attacks and from accidental explosions in nearby chemical and explosive storage facilities. However, existing methods for predicting the governing blast loading on a structure, through consideration of multiple explosion scenarios, are unsuitable for most practising structural engineers. This paper will address the need for fast-running tools for predicting blast loads on structures in the far-field by presenting the semi-empirical EMBlast method that calculates free-field and reflected pressure-time histories for both the positive and negative phase. For finite size target surfaces, this method also accounts for clearing effects, a phenomenon that results in gradually reducing the reflected pressures on the front face of a building, to the lower free-field pressures experienced by the sides and roof. To validate the predictions of the EMBlast method in the far-field, computational fluid dynamic analyses are performed over a long-range of scaled distances. Furthermore, the EMBlast predictions are also compared with the results from published blast tests, existing empirical methods and computational fluid dynamic simulations identified in the literature.

Optimized artificial neural network model for accurate prediction of compressive strength of normal and high strength concrete

This study develops and presents an Artificial Neural Network (ANN) model employing the Levenberg-Marquardt Backpropagation (LMBP) training algorithm to predict the compressive strength of both normal and high strength concrete. The model's robustness was evaluated using an extensive dataset comprising 1637 samples. Eight input variables, including the cement content, blast furnace slag, fly ash, fine aggregate, coarse aggregate, water content, superplasticizer, and testing age, were considered. The optimal number of hidden layers and neurons in the layer were identified through analysis, and the effectiveness of the model was assessed through k-fold cross-validation and statistical measures, including correlation coefficient (R), coefficient of determination (R2), Root Mean Square Error (RMSE), and Mean Absolute Error (MEA). Comparison with other models was carried out, and the perturbation/super-position method was employed for parametric studies to investigate the effect of each input variable on the output variable. The k-fold cross-validation confirmed the generalizability of the model, and statistical measures showed good results, with unit cement content and superplasticizers having the highest impact on compressive strength. The findings demonstrate that the suggested ANN model is an extremely precise, economical, and practical predictive tool for concrete compressive strength.

Strength prediction and stochastic analysis of ultra-high performance concrete columns under the explosive blast load

The performance research based on numerical and experimental studies on ultra-high performance concrete (UHPC) generally considers it as an isotropic material, which is obviously different from what it really is in practical engineering. A database of UHPC compressive strength was investigated, having the same UHPC mix proportion as the field blast experiment, to show how the strength of UHPC varies in compression. It is found that Weibull distribution is the best fit of its probability model. A combination of Monte-Carlo and Finite Element method is used, adopting the available UHPC compressive strength, to reproduce the field blast test on UHPC columns. Both the non-spatial and spatial variability of material properties of the UHPC columns are under consideration to conduct the UHPC column strength prediction under blast loads. The residual loading capacity, damage index and failure mode of UHPC columns with different sizes damaged by different explosion severities are obtained by non-spatial simulation and spatial simulation respectively. It can be concluded that compared with the non-spatial model, the numerical simulation results of the spatial model are closer to the experimental situation. Therefore, inclusion of spatial variability is recommended for reliability-based blast-resistant design for UHPC column.

Investigation of the post-blast fire performance of RC members

An explosion or blast can trigger a subsequent fire in the building structure. In the case of reinforced concrete (RC) structures, blast loading can result in relatively large residual deformations and locked-in stresses in the affected members prior to fire exposure. Such residual deformations and locked-in stresses can have a detrimental effect on the subsequent fire performance of RC members. Accordingly, this paper presents results from a numerical study investigating the post-blast fire (PBF) performance of isolated RC columns. A simplified numerical model was developed to implement the integrated environment for modeling the interaction between blast and PBF scenarios without employing complex user-defined subroutines in ABAQUS. The developed FE model was validated against the experimental blast and fire tests. The RC column was subjected to blast loads of distinct scaled distances (Z) simulating the far-field and near-field scenarios. Further, the blast-damaged columns were exposed to a standard fire and evaluated the PBF performance. Results indicated that the fire resistance period (FRP) of RC columns is significantly reduced by prior blast damage, with reductions ranging from 0.8 % to 72 % as Z decreases from 2 to 0.8 m/kg1/3. Consequently, to mitigate these detrimental blast effects and ensure adequate PBF resistance, a transverse reinforcement with a diamond configuration in the plastified region of the RC column is recommended. Furthermore, the study explores the impact of axial load levels on RC column performance under PBF scenarios. It's observed that an increase in axial load levels beyond 25 % of the critical axial load-bearing capacity results in a 100 % reduction in the post-blast FRP of the RC columns. Additionally, Pressure-Impulse (P-I) diagrams are developed examining the blast cases that yield specific post-blast FRP for the RC columns. Notably, the diamond configuration demonstrates superior blast resistance for the same post-blast FRP, as evidenced by the P-I diagrams.

Numerical modelling of rock fragmentation under high in-situ stresses and short-delay blast loading

Since the invention of electronic detonators with a delay accuracy within 1 ms, short-delay blasting technology has been used in mining and tunnelling engineering to improve rock fracturing and control blast-caused vibration. However, the fragmentation characteristics of pre-stressed rock under short-delay blast loading have not been studied in detail. In this study, the interaction between the short-delay blast loading and static in-situ stress is investigated using a FEM-based modelling method and image-processing approach. Firstly, single-hole blasting tests were conducted in an underground roadway with a burial depth of 620 m. Subsequently, a single-hole blasting model was developed in LS-DYNA and validated against one of the experimental results, a two-hole delay blasting model was established to simulate rock fracture and fragmentation under different delay times and in-situ stresses. Finally, the underlying mechanism of in-situ stress affecting the optimum delay time was theoretically analyzed and an analytical solution for optimum delay was proposed. The tested results show that under a borehole length and charge weight of 1 m and 1.5 kg, respectively, the average fragment size is approximately 10.5 cm, and the crater radius and depth are 0.67 m and 0.96 m, respectively. The numerical results indicate that both of average fragment size and fragment size distribution range significantly increase with the increase of in-situ stress, while they first decrease and then increase with the increase of short delay times. Moreover, there is a specific delay window ranging from 0.5 to 3 ms where short-delay blasting improves fragmentation performance, and the optimum delay time increases with the increase of in-situ stress. The findings of this study can aid in improving the efficiency and safety of blasting operations in deep hard rock mining.

Damage and responses of two asphalt pavement structures under blast loads: A numerical simulation

The explosion accidents are threatening the service functionality of pavement structures, which puts forward new requirements such as multi-hazard resistance and resilience. Although the widely used asphalt pavement structure is vulnerable to blast loads, its dynamic behaviors under blast loads are still unclear. This research mainly focused on the damage and responses of two asphalt pavement structures, one of which was conventional asphalt pavement, and the other was the anti-blasting asphalt pavement structure with the reinforced concrete layer. The numerical simulation method, which was validated based on a real blast test, was proposed using Abaqus code with appropriate material models and simulation procedures. The finite element models of two pavement structures were built. Under various blast loads, the damage contours and dynamic responses of different pavement structure components were investigated. It was found that the total damage areas of two asphalt pavement structures were grew by 2.26 and 3.19 times, respectively, as the blast loads increased from 100 kg TNT to 2000 kg TNT. The slope of pavement structure was extremely sensitive to the changes in blast load. The proposed anti-blasting pavement structure could reduce the damage area by up to 20 %, but it would be invalidated under particularly destructive blast loads. These findings could be helpful for the further design of an anti-blasting pavement structure.

Experiment and Numerical Study on the Dynamic Response of Foam Sandwich Panels under the Near-Field Blast Loading

Aiming at the problem that the blast load, generated by the explosion of the tandem-shaped-charge warhead, may cause damage to the warhead structure, material failure and even phase change, the material damage and structural protective capacity of the near-field blast load on the sandwich structure with foam-aluminum core were investigated by experimental test and numerical simulation. Firstly, the near-field blast test was performed to observe the deformation of sandwich structure and to collect the acceleration signals of fuze. Then, the mechanical properties of foam materials were tested, and a numerical model of blast load environment was established in the explicit dynamics software ANSYS/LS–DYNA 2020 R2. Finally, the experimental test data and simulation results were compared and analyzed. The strong agreement between the experiment and the simulation results indicates that the calculation method and simulation model are reasonable. Furthermore, the damage mode of foam-aluminum core materials with different densities and cell diameters under near-field blast load were carefully analyzed by simulation method. The simulation results show that, with the decrease of the density of foam-aluminum material and the increase of the cell chamber diameter, the deformation of the foam-aluminum panel gradually increases; the acceleration peak value of the fuze gradually decreases, and the pulse width barely changes and remains basically constant; the start and end times of the peak stress of the fuze cover gradually lag behind, and the peak stress hold-up time increases gradually; the maximum displacement deformation of the fuze cover decreases firstly and then increases. This work is expected to provide basic data and design guidelines for the graded foam sandwich panels of the blasting warhead fuze against the near-field blast load.

Investigation on overbreak and underbreak of pre-stressed tunnels under the impact of decoupled charge blasting

Decoupled charge blasting has shown its superior performance in achieving smooth tunnel profiles in underground excavation. In this study, through establishing an underground tunnel blasting similarity modeling (UTBSM) test system that incorporates a static stress loading device (SSL), a highspeed digital image correlation device (DIC) and a 3D laser scanning device (3DLS), field blast tests with concrete models involving set-aside circular and rectangular openings are first conducted to examine the influence of filling medium on the depth and area of overbreak and underbreak. Subsequently, a 3D finite element model is developed using LS-DYNA and validated against one of the test results, and the influences of decoupled coefficient, decoupled charge mode, filling medium, and in-situ stress condition are comprehensively investigated. Finally, an energy analysis encompassing internal energy and kinetic energy is performed. The experimental and numerical results show that water-decoupled blasting results in the largest overbreak and smallest underbreak due to the highest internal energy and kinetic energy, and the expanded polystyrene foam (EPS) effectively reduces the blasting energy exerted on concrete so that causes the minimum overbreak depth and volume. Both the overbreak and damage in burden decrease with increasing decoupled coefficient. Radial decoupled charge mode produces a higher energy transfer efficiency than axial charge mode, whereas eccentric charge mode outperforms in controlling overbreak and improving the excavation efficiency. Additionally, the increase of in-situ stress leads to a reduction in overbreak depth and damage volume in the burden, indicating that in-situ stress plays a favorable role in overbreak control during contour blasting. However, the restraining effect of in-situ stress on rock fracture warrants sufficient attention as it may result in blasting failure.

Predictions of lateral deflection of square concrete-filled steel tube column under explosive impulse

This study investigates lateral deflection of square concrete-filled steel tube (CFST) columns under blast loads. Impulse time histories were obtained from the blast test, and lateral deflection of square CFST without axial load was predicted by using the SDOF system based on the impulse input. Intensive numerical simulations were conducted to investigate the influences of axial compression ratio and confinement coefficient on the lateral deflection of square CFST columns subjected to blast loads. A total of 168 case scenarios were studied by using LS-DYNA. With the increasing axial compression ratio, the lateral deflection decreases gradually and then increases sharply. The lateral defection decreases remarkably with the increase of the confinement coefficient. Based on the numerical results, a formula was proposed to predict the maximum lateral deflection of the square CFST column under blast load, and the accuracy of the formula was verified by comparing it with the blast testing results.

Numerical investigation on blast-induced rock fragmentation with different stemming structures

Stemming is one of the main concerns in blast of rock engineering due to its impact on explosion energy consumption and rock excavation performance. In this study, blast-induced rock fragmentation under different stemming conditions is numerically studied using combined numerical modelling and image processing. After careful determination the parameters of constitutive material models, the developed numerical model in LS-DYNA is verified based on the blast testing results including rock fracturing and fragment size distribution (FSD). The calibrated constitutive models are then used to model the pressure variation and rock disintegration produced by blasting with different stemming structures. The size data of simulated rock fragmentation are obtained by image-processing the cut surfaces of the numerical model with the program ImageJ, and the blast-created rock FSD is characterized using a three-parameter generalized extreme value function. The effects of the combination of explosive, air/sand deck and stemming on blast-induced rock fragmentation are quantitatively analysed, considering various stemming modes, stemming lengths and air/sand deck lengths. The results show that the blast-created fragment size decreases with an increase in stemming length, a decreasing in air/sand deck length, replacement of top stemming (stemming at borehole collar with air deck) with bottom stemming (stemming directly contact explosive) and alteration of air deck to sand deck, while the FSD range exhibits the opposite tendency. Bottom stemming is recommended for practical blasting due to its efficiency in rock fragmentation and robustness with respect to stemming length.

Investigation of constitutive models of HPFRCC subjected to static and dynamic loadings

High-performance fiber-reinforced cement composite (HPFRCC), an advanced construction material, has superior material properties than normal concrete. As concrete constitutive models, such as the Karagozian & Case (K&C) and continuous surface cap (CSC) models, are utilized in various numerical analyses of HPFRCC structures under static and dynamic loadings, here, calibration methods for these two constitutive models are suggested to describe the material behaviors of HPFRCC more precisely based on uniaxial and triaxial test data. Multi-element analysis of laboratory material tests is performed on the calibrated models with four different element sizes not only to examine their reliability but also to investigate their mesh-size dependency. Moreover, the differences in the performance of these models are analyzed in terms of their theoretical background, and numerical simulations are performed on the HPFRCC structures subjected to a low-velocity impact as well as near-field blast tests. By comparing the numerical and experimental results, the CSC model is found to exhibit strength for simulating crack distribution at low strain rates, whereas the K&C model shows reasonable predictions of the failure behavior of HPFRCC structures at high strain rates.

Experimental testing of liner tray walls subjected to near field blast

AbstractExplosions produced in urban or industrial areas due to accidental or intentional detonation of high energy explosives (e.g., improvised explosive devices IED) are low‐probability but high‐impact events. If standoff distance from buildings or other constructions is small, explosions can cause structural failures and serious injuries or deaths of people. Preventing buildings from collapse is essential to minimizing casualties among occupants. However, experience has shown that even if the collapse is prevented, high number of injuries can result from fragments and flying debris generated by the non‐structural components or building envelopes. This risk could be minimized through appropriate design and selection of construction materials for most exposed elements (i.e., building envelopes). Although heavy/stiff systems were long considered appropriate to protect buildings against explosive threats, lighter and flexible systems are increasingly used for modern buildings. By allowing damage (but not fragmentation), the envelope system can provide predictable response, with minimal injuries in case of an explosion.The study presents the results of full‐scale blast tests on liner tray walls attached to a steel frame building. Walls are tested against increasing blast charges until complete failure. The ultimate strength is given by the failure of the end fasteners, after large bolt hole elongations coupled with the pull‐through of the end fasteners.

Experimental study on the influences of charging structure with various filling mediums on rock blasting performances

Decoupled charge blasting is widely used in tunnel contour excavation to mitigate overbreak/underbreak and the extent of excavation damaged zone, which plays a pivotal role in enhancing the safety and efficiency of tunnel construction. This study experimentally investigates the influences of filling medium (air, water, sand and clay) on blasting performances. Five single hole blast (SHB) tests with a blasthole length of 1.0 m and blasthole diameter of 45 mm are first conducted in an underground tunnel. The ground vibration signals are captured using three-component seismic vibrometers installed at different distances away from the blasthole. The blast-induced crater is automatically measured using a 3D laser scanner and the post-blast rock fragmentation is analyzed using the open-source program ImageJ. Subsequently, the peak pressure, particle velocity and displacement on the borehole wall with respect to various filling mediums are theoretically deduced and analyzed. The experimental results indicated that the fully coupled blasting produces the largest near-field peak particle velocity (PPV), finest rock fragmentation and largest crater, but also the highest PPV attenuation rate. Among these decoupled charge blasts, water-decoupled blasting results in the finest fragmentation and maximum crater, whereas the corresponding PPV is at a much smaller level than coupled blasting. Sand and clay-decoupled blasts yield smaller PPV and crater but coarser fragmentation than water-decoupled blasting. Air-decoupled charge structure causes the minimum PPV and crater size, as well as the coarsest fragmentation. The theoretical analysis shows that the fully coupled blasting yields the largest borehole wall pressure (BWP), particle velocity and displacement on borehole wall than those induced by decoupled blasts, as well as the maximum attenuation rate of BWP and velocity. Additionally, water-decoupled blasting exhibits higher energy transfer efficiency so that a finer rock fragmentation and a larger crater are obtained than air, clay and sand decoupled blasts, but more attention should be paid to the blast vibration.

Sensitivity Analysis of Factors Influencing Blast-like Loading on Reinforced Concrete Slabs Based on Grey Correlation Degree.

Blast simulators are capable of applying blast-like loading to components in a safe and controlled laboratory environment, overcoming the inherent shortcomings of blast testing in terms of data acquisition, test cycle time, and cost. In this paper, reasonable assumptions and refinements are made to the components and shape of the impact module, a key component of the blast simulator, to achieve diversity in simulated blast loading. By designing four rubber shapes, the importance of ellipsoid rubber as an elastic cushion for simulating blast loading was determined. In order to assess the effectiveness of this optimization, numerical calculations based on a calibrated finite element model were performed around four factors: flat rubber thickness, ellipsoid rubber thickness, impact velocity, and impact modulus mass. Additionally, a grey correlation sensitivity analysis was carried out to evaluate the effect of these factors on the impact loading on the reinforced concrete (RC) slab. The results indicate that peak pressure and impulse had opposite sensitivities to velocity and mass. Changes in ellipsoid rubber thickness had a more positive effect on the impact loading than flat rubber thickness. An in-depth study of the role of these influencing factors is important for the design and improvement of impact modules.

Full-Scale Field Tests on Concrete Slabs Subjected to Close-In Blast Loads

This research evaluates the performance of different protective solutions for reinforced concrete slabs subjected to blast loading. A series of full-scale blast tests were carried out on concrete slabs at scaled distances ranging from 0.20 to 0.83 m/kg1/3. For this purpose, 16 concrete slabs were tested; eight of them were unreinforced as ‘control specimens’, and the other eight were protected with five different protective solutions. After the tests, a damage assessment was conducted based on three different parameters. The results showed that there was no clear improvement in the concrete performance when the charge was located 0.5 m from the slab. Significant local damage that completely perforated the slab occurred. In the tests with the load placed 1 m from the slab, the reinforcements that were used significantly contributed to the retention of some fragments produced in these tests.

Blast-loading simulators: Multiscale design of graded cellular projectiles considering projectile–beam coupling effect

Graded cellular materials with a proper design may simulate blast loading and can be applied to test the anti-blast performance of protective structures. A multiscale design strategy is proposed to obtain the density distribution and mesostructure of graded cellular projectiles when taking a clamped beam as a protective structure and an exponential attenuation load as the simulation target. A projectile–target coupling model is developed for determining the projectile density distribution, and the dimensionless governing equations containing two kinds of dimensionless parameters, namely target-independent parameters and coupling parameters, are obtained. The closed-cell mesostructure of a graded cellular projectile is generated through the Voronoi technique, and the cell configuration parameters are optimized to achieve the designed density distribution while ensuring manufacturability. The graded cellular projectiles are prepared by using 3D printing technology, and their load simulation effects are verified through numerical simulations and impact tests. Case studies demonstrate the necessity of considering the projectile–target coupling effect in the density design. The applicable test condition and selection method of initial parameters of graded cellular projectiles are analyzed with dimensionless parameters. It is found that the initial momentum of the projectile mainly governs its effective simulation duration. With the increase of the initial momentum, the effective simulation duration increases, and the initial momentum should be less than the total impulse of the simulated blast load. The impact technique of well-designed graded cellular projectiles shows great potential in simulating various blast loadings and testing novel protective structures in a laboratory environment.