BASFI Index Research Articles

Disease activity indices used in axial spondyloarthritis perform similarly in real-life clinical settings

ObjectiveMonitoring of axial spondyloarthritis (axSpA) activity using validated indices (BASDAI/ASDAS) is widely recommended but rarely followed in practice. The reasons, although varied, may be found in the scarcity of studies comparing the performance of these indices in daily practice. Here we compare the performance of activity indices in clinical practice.MethodsObservational cross-sectional study involving 330 patients. The BASDAI, ASDAS, BASFI and ASAS HI indices were included. Their correlations, degree of concordance, and discriminating capacity for different levels of activity and impact were compared using the appropriate statistics.ResultsA total of 127 (38.5%) women and 203 (61.5%) men were included, mean age 47.6 (SD 12.9) years, median disease duration 8 [IQR 4-16] years. At inclusion, 209 (63.3%) patients were receiving biological therapies, mostly anti-TNF. All measurement indices were highly correlated (Pearson's r ≥ 0.73). Concordance between instruments was substantial both with regard to the different activity thresholds and the different disease impact categories (k ≥ 0.61). BASDAI cutoffs of 3.95 (AUC 0.90) and 5.85 (AUC 0.90) accurately identified the ASDAS high and very high activity categories, respectively. An ASDAS ≥ 2.1 (AUC 0.87) and a BASDAI ≥ 3 (AUC 0.92) accurately discriminated the ASAS-HI high impact category. Regardless of systemic therapy use, there was substantial agreement between BASDAI remission (≤2) and ASDAS inactive disease (<1.3).ConclusionThe metrological performance of standard activity indices in axSpA was similar. The BASDAI values that identify the ASDAS categories are novel. We suggest using these indices interchangeably in clinical routine.

Efficacy and safety of the biosimilar etanercept in the treatment of patients with rheumatoid arthritis and spondyloarthritis

Objective: to evaluate the efficacy and safety of the biosimilar etanercept (ETC, Altebrel) in patients with rheumatoid arthritis (RA) and spondyloarthritis (SpA) in clinical practice.Material and methods. The study included 20 patients with a confirmed diagnosis of RA and 8 with SpA: 5 with axial SpA with radiological signs of sacroiliitis (r-axSpA), 3 with peripheral psoriatic arthritis (PsA). The mean age of the patients with RA was 47.7±12.3 years, and the mean age of SpA patients was 40.4±15.9 years. Patients with RA had moderate or high disease activity: mean DAS28-ESR index 5.2±1.0, median CDAI – 22.5 [15.5; 35.0], SDAI – 31.9 [24.4; 38.6], CRP level – 11 [0.9; 32.5] mg/L. Patients with r-axSpA had high activity and functional impairment, the median BASDAI was 5.5 [3.5; 8.0], BASFI – 6 [4; 6], CRP level – 17.5 [12.5; 27] mg/L. In PsA, the average DAS28 was 6.25±0.71. All patients were prescribed Altebrel at a dose of 50 mg subcutaneously weekly against a background of disease-modifying antirheumatic drugs. Patients were examined at baseline and then after 3 and 6 months of treatment.Results and discussion. During treatment with the biosimilar ETC, all patients with RA showed a decrease in inflammatory activity markers: after 3 and 6 months of therapy, the mean DAS28-ESR value decreased to 3.5±1.2 and 2.3±0.7 (p <0.001) the median SDAI value to 19.6 [6.9; 32.5] and 8.4 [4.7; 15.6] (p<0.001), CDAI value to 9.5 [4; 13.0] and 4.5 [3.0; 7.5] (p <0.001), the CRP level – to 5.0 [0.7; 21.9] and 5.0 [2.0; 10.9] mg/L (p<0.001), respectively. Patients with SpA showed a decrease in disease activity and an improvement in functional status: the median BASDAI decreased to 1.0 [0; 2.5] and 0 [0; 1.5], BASFI to 0 [0; 1] and 0 [0; 0], CRP level to 4.5 [2.5; 6.5] and 2.0 [2.0; 2.5] mg/L, respectively. In patients with PsA, DAS28 decreased on average to 2.92±0.12 after 3 months, and after 6 months the values were 1.74 and 2.29 in 2 patients.All patients completed the study and no adverse events were observed during treatment. According to EULAR criteria, a good response was achieved in 40% of patients with RA after 3 months, and in 80% after 6 months, and a satisfactory response in 20%. Patients with r-axSpA showed statistically significant positive dynamics of BASDAI and BASFI indices as well as normalization of laboratory activity parameters.Conclusion. The results of the study demonstrate the high efficacy of Altebrel in rheumatic diseases, including RA and SpA.

Comparative analysis of the efficacy of seniprutug (BCD-180) and adalimumab in the treatment of active radiographic axial spondyloarthritis: results of a systematic review and matching-adjusted indirect comparison

Objective: to compare the clinical efficacy of seniprutug (BCD-180) and adalimumab (ADA) in the treatment of adults with active radiographic axial spondyloarthritis (r-axSpA).Materials and methods. Based on the results of a previously conducted systematic review, an unanchored matching-adjusted indirect comparison (MAIC) was performed, adjusting for confounding factors. The analysis was based on the results of randomized placebo-controlled clinical trials of seniprutug (BCD-180-2/ELEFTA, NCT05445076) and ADA (ATLAS, NCT00085644) that met the selection criteria. We chose ASAS40 and ASAS20 measurements at week 24 as efficacy outcomes. Initial BASDAI and BASFI indices, proportion of women in the study population, time from disease onset, and baseline C-reactive protein (CRP) levels were considered as confounders.Results and discussion. The MAIC showed a statistically significant advantage in the clinical efficacy of seniprutug (BCD-180) over ADA. When adjusted, the odds ratios (OR) with 95% confidence intervals (CI) for seniprutug (BCD-180)/ADA were 1.86 (1.15; 3.02) and 2.21 (1.34; 3.72) for ASAS40 and ASAS20, respectively, at week 24.Conclusion. The MAIC demonstrated statistically significant superiority of seniprutug (BCD-180) over ADA on the key efficacy endpoints ASAS40 and ASAS20 at week 24 in adults with active r-axSpA. The inclusion of the innovative domestic drug seniprutug into treatment paradigm of active r-axSpA will potentially reduce the socio-economic burden of this disease by providing an affordable, effective and safe therapy while optimizing healthcare costs

Association of rs7574865 polymorphism of the <i>STAT4</i> gene with spinal syndesmophytes in patients with ankylosing spondylitis

Objective. The aim of the investigation was to study the possible association of the rs7574865 polymorphism of the STAT4 gene with syndesmophytes (SMP) of the spine in patients with ankylosing spondylitis (AS).Subjects and methods. The study included a cohort of 100 patients, 79 men and 21 women with a diagnosis of AS.All patients were positive for the HLA-B27 antigen, had a mean age of 39.6±10.9 years and a mean disease duration of 60,4±28,4 months. The association of the rs7574865 polymorphism of the STAT4 gene with the SMP of the cervical, thoracic and lumbar spine was studied. For genotyping of the rs7574865 polymorphism, the method of allele-specific polymerase chain reaction in real time (RT-PCR) was used.Results. Spearman’s correlation analysis showed a statistically significant positive relationship between SMP in the thoracic spine and rs7574865 polymorphism of the STAT4 gene (r=0.23; p=0.022). The frequency of GT genotype carriers in the group of patients with thoracic spine trSMP(+) was statistically significantly lower than in the alternative group trSMP(–) (28.2% and 50.8%, respectively; p=0.025). Carriage of the GT genotype in patients with AS reduced the risk of trSMP(+) formation in the thoracic spine (OR=0.31) and this genotype was protective. No reliably significant association of the studied polymorphism with SMP of the cervical and lumbar spine was found. Patients with trSMP(+) were statistically significantly older in age, had a longer duration of the disease and a higher functional BASFI index compared with patients without trSMP(–).Conclusion. Genetic testing of the rs7574865 G/T polymorphism of the STAT4 gene in patients with AS opens up the possibility of using this polymorphism as a genetic marker-predictor – X-ray progression of structural changes in the thoracic spine.

Disease activity, health status and quality of life in patients with ankylosing spondylitis associated with fibromyalgia

Annotation. Ankylosing spondylitis (AS) and fibromyalgia (FM) are often comorbid pathological conditions, and the presence of FM, which characterized by the complexity of diagnosis and treatment, may be one of the factors delaying the diagnosis of AS. FM can also complicate the interpretation of disease activity, assessment of pain and the choice of adequate anti-inflammatory therapy, which makes it essential to study the impact of this comorbidity on the clinical course of AS. The study aimed to evaluate the indicators of disease activity, health, and quality of life of patients with AS associated with FM. One hundred forty-three patients with AS (81.8% of men) aged 42.1±11.3 years (M ± σ) were examined. The diagnosis of AS was established according to modified New York criteria (1984), and the diagnosis of FM – by the criteria of mACR2010. FM detected in 49 (34.3%) individuals. Indicators of disease activity (ASDAS-ESR, BASDAI), functional status (BASMI, BASFI), quality of life and health (ASQoL, ASAS HI/EF, HAQ), fatigue, sleep disorders, depressive and cognitive disorders (MAF, PSQI, HAM-D, MMSE) was determined. The study was conducted in compliance with bioethical standards. Statistical processing of the results was performed using IBM Statistics SPSS 22. Patients with concomitant FM showed higher rates of disease activity by BASDAI and poorer functional ability by BASFI and BASMI (by 30.2%; 53.2% and 33.2%, p<0.01), by ASDAS-ESR (by 11,5%, p<0.05). Among patients with FM, individuals with very high disease activity (BASDAI≥6.0), significant functional disorders (BASFI≥4.0 and BASMI≥4.0) were more likely than among patients without FM (1.97; 1,69 and 1.73 times, p <0.001, respectively). Patients with AS with FM showed worse health and quality of life indicators for ASQoL, HAQ and ASAS HI (65.2%; 34.7% and 26.4%, p<0.001). Moderate and severe fatigue (MAF ≥ 20), sleep disorders (PSQI ≥ 5) and depressive disorders (HAM-D ≥ 8) were in 75.5%; 68.1% and 60.6% of patients without FM and in 98%; 100% and 98% (p<0.001) of patients with FM. There are direct correlations between the severity of polysymptomatic distress and the BASDAI, BASFI and ASAS HI indices (r = 0.52; 0.57 and 0.42, p<0.001). So, patients with AS with FM characterized by higher disease activity, more insufficient functional ability and lower quality of life.

АССОЦИАЦИЯ ПОЛИМОРФИЗМА rs2569190 ГЕНА CD14 С АНКИЛОЗИРУЮЩИМ СПОНДИЛИТОМ

Ankylosing spondylitis is a chronic rheumatological disease of unknown etiology. The search for new genetic associations will improve understanding of pathogenesis. Objective: to study the association of the rs2569190 polymorphism of the CD14 gene with ankylosing spondylitis in the European population of the Krasnoyarsk region. The study recruited 3 groups of patients: the first - with ankylosing spondylitis (AS) (n = 150), the second group - patients with the rest of seronegative spondyloarthritis (SPA) (n = 66), the third group included conditionally healthy patients (control group) (n = 226). The clinical assessment of patients with SPA was based on Russian federal clinical guidelines, including the calculation of the BASDAI, BASFI and HAQ indices. DNA isolation was performed using the standard phenol-chloroform method. Genotyping for the CD14 gene was performed by PCR (polymerase chain reaction) – RFLP (restriction fragment length polymorphism) analysis. PCR was performed with a set of primers (forward GCTGAGGTTCGGAGAAGTTGC; reverse GGTGCCAACAGATGAGGTTCAC) followed by restriction with Bme18I. PCR products were analyzed by electrophoresis in 4% polyacrylamide gel followed by staining with ethidium bromide. Comparative analysis of the group of patients with AS and the control group revealed a statistically significant prevalence of the TT genotype rs2569190 in the main group (34.7% versus 23.9%) (p = 0.0236; OR 1.6901; 95% CI OR 1.0728-2.6625). Patients with seronegative SPA did not demonstrate the significant disparities in rs2569190. In Krasnoyarsk region europids, the TT genotype of the rs2569190 polymorphism was associated with ankylosing spondylitis but not with seronegative SPA. The identification of a new association confirms the influence of other genetic factors on the predisposition to AS. It is likely that some of the genetic factors play a role in the pathogenesis under the influence of the external environment. Identification of these associations will make it possible to adjust the lifestyle of patients and their relatives to reduce the risk of exacerbation or development of AS.

Efficacy and safety of biologics for the treatment of ankylosing spondylitis: systematic literature review and network meta-analysis of treatments registered in the Russian Federation

The aim of the study was to evaluate the comparative efficacy and safety of biologics registered and reimbursed in the Russian healthcare system for the treatment of adult patients with active ankylosing spondylitis. Material and methods . We performed a systematic literature review of randomized controlled trials in PubMed, Embase, and eLIBRARY.RU databases. 17 articles reporting results from 16 trials were selected for qualitative and quantitative analysis. The main efficacy criteria were ASAS 20/40 over 12-16 weeks of therapy, additional criteria were BASDAI 50, changes from baseline in BASDAI and BASFI indexes. Safety criteria were determined based on the incidence of adverse events; we also analysed the proportion of patients suffering from at least one serious adverse event. Biologics were ranked based on the SUCRA values. Results. Subgroup analysis showed no statistically significant differences between IL-17 and TNF-a inhibitors, but the IL-17 inhibitor class had a higher SUCRA values. For the combination of all analyzed efficacy outcomes, netakimab, infliximab, and ixekizumab hold the first three ranks. The safety profiles of biologics included in the review were comparable with each other. Conclusion . The results of this review are intended to help healthcare professionals make decisions about optimal therapy for adult patients with active ankylosing spondylitis.

DISORDERS OF STRUCTURAL AND FUNCTIONAL STATE OF BONE TISSUE IN MEN WITH ANKYLOSING SPONDYLITIS, THEIR RELATION TO DISEASE COURSE

The aim: To study the structural and functional state of bone tissue in men with ankylosing spondylitis and to asses its relationship with the course of the disease. Materials and methods: the study was conducted involving 105 men, aged 40.74 ± 0.87 years and 25 generally healthy individuals of the certain age and sex, who formed the control group. The functional ability was assessed by the BASFI index and the disease activity was calculated by ASDAS-CRP and BASDAI. Laboratory criteria for the activity of the inflammatory process were considered erythrocyte sedimentation rate and C-reactive protein. Bone mineral density of the lumbar spine and femoral neck was determined by dual energy X-ray absorptiometry. Results: osteoporosis and osteopenic syndrome were identified in men with ankylosing spondylitis in 27,7% and 29,5% consequently. Disorder of the structural and functional state of bone tissue was closely related to the total indicators of inflammatory activity in ASDAS-CRP (r = –0,36), BASDAI (r = –0,51), the functional index BASFI (r = –0,30), C-reactive protein (r = –0,30) and the cumulative dose of glucocorticoids (r = –0.32). The comparative analysis of densitometric parameters in groups of patients depending on the form of the disease has not shown statistically significant differences. Conclusions: The decrease in bone mineral density in patients with ankylosing spondylitis does not depend on age and duration of the disease, but is associated with the cumulative dose of glucocorticoids and high activity of the inflammatory process.

Эффективность применения голимумаба в лечении анкилозирующего спондилоартрита и ревматоидного артрита (собственный опыт)

Genetic engineering drugs are used to treat rheumatic diseases. Based on the results of multicenter studies, the effectiveness and safety of golimumab, a representative of the group of tumor necrosis factor inhibitors in various categories of patients, was proved.. Purpose of research.To evaluate the effectiveness of golimumab in the treatment of ankylosing spondylitis and rheumatoid arthritis. Material and methods. The efficacy of golimumab was analyzed based on clinical and laboratory data in 7 patients with ankylosing spondylitis and 6 patients with rheumatoid arthritis. These studies are described against the background of a one-year follow-up of patients. Results and discussion. The observation group consisted of 7 patients with ankylosing spondylarthritis (as) and 6 patients with a diagnosis of rheumatoid arthritis. In all patients with (as) at the beginning of the study, the BASDAI index >6 points, and in 5 patients, the ASDASRB index was 3.5±0.45. In 4 patients with the diagnosis (as), the BASFI index was 7±0.67, and in three patients-5±0.3. the BASMI Index in all studied patients revealed pronounced disorders and was 7.5±0.85. Positive dynamics was observed during golimumab therapy. A patient with a high degree of BASDAI activity >6 showed improvement on the 4th injection of golimumab, the Average score of BASDAI and BASFI indices on golimumab was lower by the 20th week, compared with the start of therapy. By the 24th week of therapy, the BASDAI index was down 31%. The follow-up group with the diagnosis of rheumatoid arthritis consisted of 6 patients, including 1 male and 5 female, with an average age of 38±0.5 years. In a male patient, the DAS-28 index was 5.2±0.06, the SDAI index was 27±0.05, and the CDAI index was 23±0.03. In women, the DAS-28 index was 3.8±0.03, and the SDAI index was 19±0.3 in 5 patients, and the CDAI index was 20±0.3. after adding golimumab, the General condition of all patients improved clinically after the second injection, and all indicators of inflammatory activity decreased. Golimumab is a human monoclonal antibody to tumor necrosis factor (TNF)α. The effect of golimumab is due to the binding and neutralization of soluble and membrane-bound forms of TNF)α. TNF)α. it is a cytokine detected in patients with rheumatoid arthritis, ankylosing spondylarthritis. Conclusion. Against the background of the use of golimumab, the clinical effect was noted in the form of complete relief of joint pain and positive dynamics according to the studied laboratory parameters. Keywords: rheumatoid arthritis, ankylosing spondylitis, golimumab, efficacy.

Impact of traditional and ankylosing spondylitisassociated risk factors on the formation of atherosclerotic lesions in the brachiocephalic arteries

Introduction. Ankylosing spondylitis (AS) is associated with an increased risk of cardiovascular diseases (CVD). Well-known cardiovascular risk scales underestimate the possibility of the onset of cardiovascular complications and do not take into account the peculiarities of inflammatory rheumatic diseases. To improve risk stratification and timely prevention, it is necessary to study the risk factors associated with damage to the cardiovascular system in AS. Objective. To study the risk factors associated with carotid atherosclerotic lesions in ankylosing spondylitis. Material and Methods. The study included 32 male patients with AS who underwent a general clinical examination. In these patients, traditional factors of cardiovascular risk were identified; the activity and functional status of the disease were determined. To identify atherosclerotic lesions of the carotid arteries, Doppler ultrasound was used to measure carotid intima-media thickness and to identify atherosclerotic plaques. Results. The carotid intima-media thickness (CIMT) in the group was 0.9 mm [0.7; 1.2]; the median age was 38.2 years [32.0; 43.5]. With the application of age and sex norms, an increase in CIMT was observed in 80.6% of patients. The correlation analysis of the structure of traditional risk factors demonstrated the significant associations of CIMT with age ( r = 0.609, р < 0.0001), body mass index ( r = 0.439, p = 0.013), glucose level ( r = 0.528, p = 0.002), triglycerides ( r = 0.458, p = 0.010), and total cholesterol ( r = 0.398, p = 0.027). High rates of smoking (6 out of 16 against 14 out of 16, χ 2 = 7.888, p = 0.009) and arterial hypertension (4 out of 16 against 10 out of 16, χ 2 = 7.630, p = 0.009) were found mostly in the group with increased CIMT. No significant differences and relationships of CIMT with disease activity indicators and antirheumatic therapy were revealed. Significant relationships were found between the atherosclerotic lesions of the carotid arteries in patients with AS with the duration of the disease ( r = 0.370, p = 0.041) and functional status assessed using the BASFI index ( r = 0.507, p = 0.004). Conclusions . The study revealed a high prevalence of traditional cardiovascular risk factors among patients with AS, as well as the significant associations of the duration of the disease and the degree of functional impairment with the formation of carotid atherosclerotic lesions. The results of the study suggest that a more thorough assessment of CVD risk, as well as the use of additional objective criteria, are necessary for patients with AS.

СОВРЕМЕННЫЙ ВЗГЛЯД НА ПРОБЛЕМУ ОСТЕОПОРОЗА ПРИ АНКИЛОЗИРУЮЩЕМ СПОНДИЛИТЕ

The study included 72 men with a reliable diagnosis of AS, mean age – 43,2±9,1 years. X-ray examination of the axial skeleton and peripheral joints was carried out, HLA-B27 was determined. Disease activity was assessed using the index ВАSDАI, functional disorders with the help of the BASFI index. BMD was determined by two-energy x-ray absorptiometry. The control group consisted of 74 healthy men, mean age – 46,7±0,9 years. Given the chronic nature and asymptomatic course of osteoporosis, the task of doctors working with this group of patients is an active search for osteoporosis using all available diagnostic techniques for the early detection of this condition and subsequent correction of the drug treatment.

Effects of etanercept and infliximab on bone metabolism indexes in patients with ankylosing spondylitis.

Effect of etanercept and infliximab on bone metabolism indexes in patients with ankylosing spondylitis (AS) were evaluated. The clinical data of 80 patients with ankylosing spondylitis admitted to Affiliated Hospital of Hebei University of Engineering from June 2015 to March 2016 were selected. There were 39 patients treated with Enbrel as Enbrel group and 41 patients treated with Infliximab as Infliximab group. The general data of the two groups of patients were collected and various indexes before and 12 and 24 weeks after treatment were recorded. Adverse reactions of the two groups of patients after treatment were recorded and the clinical efficacy of the drugs was evaluated. C-reactive protein (CRP) and erythrocyte sedimentation rate (ESR) levels in both groups decreased significantly before and 12 and 24 weeks after treatment (P<0.05), and 24 weeks after treatment showed a downward trend compared with 12 weeks (P<0.05). The β-collagen special sequence (β-CTX) level in the two groups was significantly lower after treatment than before (P<0.0001). The adverse reaction rate of Infliximab group (21.95%) was higher than that of Enbrel group (5.13%) (P>0.05). The morning stiffness time, BASDAI and BASFI indexes of the two groups of patients after treatment were significantly lower than those before treatment (P<0.0001). Schober test was significantly higher than that before treatment (P<0.0001); BASDAI in Infliximab group was lower than that in etanercept group (P<0.05). Both etanercept and infliximab have good therapeutic effects on AS, which can reduce the bone metabolism level of β-CTX in AS patients and effectively improve the symptoms of affected medullary joints. The short-term efficacy of the two groups of patients is similar, but the incidence of adverse reactions of etanercept is slightly lower than that of infliximab.

Evaluation of efficacy and safety of long-term use of amtolmetin guacil in rheumatic diseases: results of a 9-month observational AURORA study (Amtolmetin guacil: allRussian Register for Osteoarthritis, Rheumatoid arthritis and Ankylosing spondylitis)

Non-steroidal anti-inflammatory drugs (NSAIDs) are widely used for the treatment of rheumatic diseases (RD). In some cases, their long-term use is advisable: NSAIDs slow the progression of spondylarthritis, are an important element in the control of chronic pain in osteoarthritis (OA) and rheumatoid arthritis (RA). However, the risk of serious adverse events (AE) should be considered. A good choice for long-term therapy may be amtolmetin guacil (AMG), which rarely induce gastrointestinal AE.The aimof the study was to assess the effect and safety of long-term use of AMG in RD.Material and methods.An open observational study was conducted in which AMG (Nayzilat) was assigned to 442 patients with OA (mean age 60.6±10.2 years, women 88.7%), 126 patients with RA (55.0±14.0 years, women 84.2%) and 73 with ankylosing spondylitis (AS, 47.0±12.0 years, women 30.0%). The dose of AMG depended on the clinical situation and was determined by the attending physician: from 1800 to 600 mg/day. The main criterion of the effect was the changes of pain by numeric rating scale (NRS), additional measures of efficacy were pain on the WOMAC and HAQ for OA, DAS28 for RA, BASDAI, BASFI and ASDAS-CRP for AS. The result of treatment was evaluated during three consecutive visits every 3 months (9 months of follow-up).Results and discussion.At the end of follow-up 65.2% of patients with OA, 75.3% of patients with RA and 82.2% of patients with AS continued treatment with AMG. The reasons for discontinuation of treatment were significant reduction or absence of pain (70.3%), the patient's decision (26.6%) or AE (3.1%). At the end of follow-up, there was a significant decrease in pain intensity compared to the baseline: in OA, the median pain decreased from 5.6 [4.1; 6.9] to 3.4 [1.7; 5.1], in RA from 5.8 [4.0; 7.5] to 3.4 [2.0; 4.8], in AS from 5.8 [4.2; 7.5] to 3.1 [1.5; 5.0] according to NRS, the difference was significant in all groups (p&lt;0.001). In OA, the median WOMAC pain decreased from 127 [24; 159] to 13.7 [14; 40] (p&lt;0.001), the average HAQ value – from 0.54±0.44 to 0.34±0.26 (p&lt;0.001). In RA, the average value of DAS28 decreased from 4.81±1.18 to 4.30±1.24 (p&lt;0.05). The number of painful and swollen joints, ESR and C-reactive protein also significantly decreased. In AS, the median BASDAI index decreased from 4.5 [1.0; 8.0] to 3.0 [0; 8.0] (p&lt;0.001). The number of patients with high activity according to ASDAS-CRP (&gt;3.5) decreased from 76.9 to 25.8% (p&lt;0.001). The BASFI index did not changed. 77.9% of patients with OA, 77.0% with RA and 74.5% with AS were satisfied with the results of AMG treatment. AMG tolerance was good. Mild dyspepsia was observed in 15–25% of patients. AE, which caused the discontinuation of therapy, were observed only in 6 (0.93%) patients. There was no development or deterioration of hypertension, as well as other cardiovascular complications.Conclusion.AMG is an effective NSAID with good tolerability, which is advisable to use for long-term treatment of RD. Limitations are the open nature of the study and the absence of a control group.

Predictors of response and drug survival in ankylosing spondylitis patients treated with infliximab.

BackgroundThe advent of anti-tumor necrosis factor-α (TNFα) drugs has changed the course of ankylosing spondylitis (AS). While data are available concerning the long term effectiveness of single anti-TNF agents, little has been published about predictors of treatment response in AS. The aim of this retrospective study was to evaluate the survival, effectiveness, and safety of infliximab over a 5-year period and to identify predictors of disease outcome.MethodsSeventy AS patients attending the Rheumatology Clinic of the University of Padua who were treated with intravenous infliximab at 0, 2, 4 weeks and then every 6, 8, or up to 16 weeks were studied retrospectively. Demographic information, laboratory inflammatory and disease indices (BASDAI, BASFI, BASMI) were collected (at baseline, 3, 6, 12 months and once a year thereafter). Clinical improvement, drug tolerability, adverse events/side effects and causes leading to discontinuation were recorded.ResultsInfliximab caused a rapid, persistent improvement at all the assessment times in the BASDAI 50 (71.4 %) and ASDAS scores (97.1 % in ASAS20, 80 % in ASAS40, 80 % in ASAS5/6), and already within 6 months of beginning treatment in 50 % percent of the patients. The other 50 % withdrew because of: adverse events (12 = 34.3 %), side effects (5 = 14.3 %), drug inefficacy (12 = 34.3 %), spontaneously (4 = 11.4 %). Those who did not respond were prevalently females (34.3 % vs 17.1 %).ConclusionFactors such as female sex, use of steroids, persistently high inflammatory levels, BASFI and BASDAI indices were found to be negative predictors of treatment response. Infliximab was found to be safe, effective and well-tolerated; it elicited satisfactory long term response and drug survival rates.

Muscular disorders associated with ankylosing spondylitis and their correction with the help of whole body cryotherapy

The objective of the present study was to evaluate the possibilities for the correction of muscular disorders associated with ankylosing spondylitis and their correction with the help of whole body cryotherapy. The study included 55 patients randomly allocated to two groups. Group 1 was comprised of the patients treated with the use of the common mineral baths, physiotherapy, therapeutic physical exercises, spinal massage, and whole body air-cryotherapy. Group 2 contained the patients who were treated in a similar way with the exception of whole body cryotherapy; they served as controls. Muscular disorders were diagnosed by means of functional muscular testing. The study has demonstrated the high prevalence of muscular disorders in the patients suffering from ankylosing spondylitis. Moreover, it revealed the profile of such disorders associated with ankylosing spondylitis and showed significant correlation between the results of functional muscular testing, BASMI and BASFI indices as well as characteristics of chest excursions (p<0.01). The analysis of the results of the treatment gave evidence of the higher effectiveness of the combined treatment including whole body cryotherapy in comparison with the alternative therapeutic modalities employed in the present study. This therapeutic modality ensured the statistically more pronounced improvement of functional muscular testing parameters (p<0.05), muscle strength and extensibility, as well as certain other clinical and functional characteristics. The groups of muscles most susceptible to cryogenic therapy have been identified. The data obtained in the present study shed light on some specific features of the action of whole body cryotherapy accounting for its corrective influence on the muscular disorders in the patients presenting with ankylosing spondylitis. It is concluded that the proposed approach can be recommended for the introduction in the combined therapeutic and rehabilitative treatment of muscular disorders associated with ankylosing spondylitis.

CORRELATION BETWEEN CLINICAL CHARACTERISTICS OF ANKYLOSING SPONDYLITIS AND WORK CAPACITY AND PRODUCTIVITY

Система комплексной поддержки и сопровождения научного журнала Elpub позволяет запустить двуязычный сайт журнала со встроенной системой электронной редакции в соответствии с лучшими издательскими практиками, а так же предусматривает техническую и методическую поддержку со стороны специалистов НЭИКОН.

PARE0017 Fit for Work Italy: Program First Ongoing Evidences

BackgroundAccording to Fit for Work program, 3 technical tables -leaded by G. Minisola (clinic), F.S. Mennini (economic), G.Voltan (socio–political)- have been appointed in 2012 to promote musculoskeletal deseases as an...

AB0725 Ankylosing Spondylitis in Women, Clinical Features

ObjectivesTo evaluate the clinical features and course of ankylosing spondylitis (AS) in women according to the City rheumatological center in Kazan.MethodsThe study involved two groups of patients with AS: 23...

OP0287 The Effectiveness of Educational Programs for Patients with Ankylosing Spondylitis in Clinical Practice

BackgroundAn effective and long-term treatment of ankylosing spondylitis (AS) is not possible without active participation of the patient in the process, which requires educational programs.ObjectivesTo assess the effectiveness of educational...

AB0701 Difference in musculoskeletal clinical expression among spanish and mexican patients with juvenile spondyloarthritis: data from the mexespa project

BackgroundUp to 50% of cases of juvenile spondyloarthritis (JSpA) begin in childhood, with clinical features that distinguish them from their adult counterparts, such as more frequent peripheral involvement, and more...