Base Pair Opening Research Articles

Importance of base-pair opening for mismatch recognition.

Mismatch repair is a highly conserved cellular pathway responsible for repairing mismatched dsDNA. Errors are detected by the MutS enzyme, which most likely senses altered mechanical property of damaged dsDNA rather than a specific molecular pattern. While the curved shape of dsDNA in crystallographic MutS/DNA structures suggests the role of DNA bending, the theoretical support is not fully convincing. Here, we present a computational study focused on a base-pair opening into the minor groove, a specific base-pair motion observed upon interaction with MutS. Propensities for the opening were evaluated in terms of two base-pair parameters: Opening and Shear. We tested all possible base pairs in anti/anti, anti/syn and syn/anti orientations and found clear discrimination between mismatches and canonical base-pairs only for the opening into the minor groove. Besides, the discrimination gap was also confirmed in hotspot and coldspot sequences, indicating that the opening could play a more significant role in the mismatch recognition than previously recognized. Our findings can be helpful for a better understanding of sequence-dependent mutability. Further, detailed structural characterization of mismatches can serve for designing anti-cancer drugs targeting mismatched base pairs.

Reduction in Dynamics of Base pair Opening upon Ligand Binding by the Cocaine-Binding Aptamer

We have used magnetization transfer NMR experiments to measure the exchange rate constant (kex) of the imino protons in the unbound, cocaine-bound, and quinine-bound forms of the cocaine-binding DNA aptamer. Both long-stem 1 (MN4) and short-stem 1 (MN19) variants were analyzed, corresponding to structures with a prefolded secondary structure and ligand-induced-folding versions of this aptamer, respectively. The kex values were measured as a function of temperature from 5 to 45°C to determine the thermodynamics of the base pair opening for MN4. We find that the base pairs close to the ligand-binding site become stronger upon ligand binding, whereas those located away from the binding site do not strengthen. With the buffer conditions used in this study, we observe imino 1H signals in MN19 not previously seen, which leads us to conclude that in the free form, both stem 2 and parts of stem 3 are formed and that the base pairs in stem 1 become structured or more rigid upon binding. This is consistent with the kex values for MN19 decreasing in both stem 1 and at the ligand-binding site. Based on the temperature dependence of the kex values, we find that MN19 is more dynamic than MN4 in the free and both ligand-bound forms. For MN4, ligand-binding results in the reduction of dynamics that are localized to the binding site. These results demonstrate that an aptamer in which the base pairs are preformed also experiences a reduction in dynamics with ligand binding.

Transcription, torsional stress and the bending dynamics of DNA

In this research, we found that the local opening of base pairs induces the formation of kinks which facilitates the bending of double helix. The conformational properties of DNA can be mapped onto the Heisenberg spin system and denaturation occurs through quantum phase transition (QPT) induced by a quench when the temperature effect is incorporated through the quench time. The nonequilibrium effect in QPT introduced through the quench generate defects like kinks end antikinks, the density of which depends on the quench time and hence on temperature. It is here argued that when we transcribe this result in the rod –like-chain (RLC) model of DNA, these defects correspond to bends. The dynamical formation of these bends during local denaturation associated with transcription hinders free rotation of the transcribed DNA and helps the torsional stress to propagate down the DNA. This explains the observed large torsional stress near the point of transcription. We have estimated the bend length which is found to be in good agreement with experiments.

Salt effect on thermodynamics and kinetics of a single RNA base pair.

Due to the polyanionic nature of RNAs, the structural folding of RNAs are sensitive to solution salt conditions, while there is still lack of a deep understanding of the salt effect on the thermodynamics and kinetics of RNAs at a single base-pair level. In this work, the thermodynamic and the kinetic parameters for the base-pair AU closing/opening at different salt concentrations were calculated by 3-µsec all-atom molecular dynamics (MD) simulations at different temperatures. It was found that for the base-pair formation, the enthalpy change is nearly independent of salt concentration, while the entropy change exhibits a linear dependence on the logarithm of salt concentration, verifying the empirical assumption based on thermodynamic experiments. Our analyses revealed that such salt concentration dependence of the entropy change mainly results from the dependence of ion translational entropy change for the base pair closing/opening on salt concentration. Furthermore, the closing rate increases with the increasing of salt concentration, while the opening rate is nearly independent of salt concentration. Additionally, our analyses revealed that the free energy surface for describing the base-pair opening and closing dynamics becomes more rugged with the decrease of salt concentration.

Mathematical Modeling of Open States in Double Stranded DNA Molecule Depending on 2H/1H Ratio

The evaluation results of the possible deuterium atoms effect on the DNA base pair opening are presented in the article. The cause of these processes is the replacement of protium with deuterium atom due to the increase of energy required to break the hydrogen bond. These processes can be studied by method of mathematical modeling, with account of open states between base pairs being the key condition of the adequacy of the mathematical model of the DNA. The experiment data show that the presence of deuterium in a chain of nucleotides can cause - depending on the value of hydrogen bond disruption energy - both increase and decrease in probability of open states occurrence. For example: hydrogen bond disruption energy of 0.358·10-22n·m, non-zero probability of open states occurrence is observed in case of the absence of deuterium in the molecule, and with hydrogen bond disruption energy of 0.359·10-22n·m or more such probability equals zero. Also, when one deuterium atom is present in a molecule, non-zero probability is observed even with hydrogen bond disruption energy equal to 0.368·10-22n·m (i.e. more than 0.358·10-22n·m). Thus participation of deuterium atoms in the formation of hydrogen bonds of double helixes of a DNA molecule can cause the changes in the time required for transfer of genetic information, which can explain the effect of even minor deviations in deuterium concentration in a medium on metabolic processes in a living system.

Asymmetric base-pair opening drives helicase unwinding dynamics

The opening of a Watson-Crick double helix is required for crucial cellular processes, including replication, repair, and transcription. It has long been assumed that RNA or DNA base pairs are broken by the concerted symmetric movement of complementary nucleobases. By analyzing thousands of base-pair opening and closing events from molecular simulations, here, we uncover a systematic stepwise process driven by the asymmetric flipping-out probability of paired nucleobases. We demonstrate experimentally that such asymmetry strongly biases the unwinding efficiency of DNA helicases toward substrates that bear highly dynamic nucleobases, such as pyrimidines, on the displaced strand. Duplex substrates with identical thermodynamic stability are thus shown to be more easily unwound from one side than the other, in a quantifiable and predictable manner. Our results indicate a possible layer of gene regulation coded in the direction-dependent unwindability of the double helix.

Base pairs opening and bubble transport in damped DNA dynamics with transport memory effects

Transport memory effects on nonlinear wave propagation are addressed in a damped Peyrard-Bishop-Dauxois model of DNA dynamics. Under the continuum and overdamped limits, the multiple-scale expansion method is employed to show that an open-state configuration of the DNA molecule is described by a complex nonlinear Schrödinger equation. For the latter, solutions are proposed as bright solitons, which suitably represent the open-state configuration that takes place along the DNA molecule in the form of bubbles. A good agreement between numerical experiments and analytical predictions on the impact of memory effects on the angular frequency, velocity, width, and amplitude of the moving bubble is obtained. It also appears that memory effects can modify qualitatively and quantitatively the nonlinear dynamics of DNA, including the energy brought by enzymes for the initiation of the processes of replication and transcription.

The Possibility of Blocking the Process of DNA Base Pairs Opening by Hydrogen Peroxide

One of the most progressive methods of cancer treatment is the ion beam therapy. Simulations of the water radiolysis show that the most long-living species in the cell medium are hydrogen peroxide (H2O2) molecules. But up to the present time, the role of H2O2 molecules in the deactivation of cancer cells has not been determined yet. To understand the possible role of H2O2 in the ion beam therapy, the competitive interaction of H2O and H2O2 molecules with nucleic bases in a pair on the different stages of genetic information transfer is studied in the present work. The method of atom-atomic potential functions is used in the calculations. It is shown that some configurations of A·T, and G·C complementary pairs are stabilized muchbetter by an H2O2 molecule as compared to a water molecule. The formation of such interaction complexes can terminate the processes of DNA unzipping by enzymes and consequently block the genetic information transfer processes in cancer cells during the ion beam treatment. An experimental method of verification of the interaction of hydrogen peroxide with nucleic base pairs is proposed.

Riemann metric approach to optimal sampling of multidimensional free-energy landscapes.

Exploring the free-energy landscape along reaction coordinates or system parameters λ is central to many studies of high-dimensional model systems in physics, e.g., large molecules or spin glasses. In simulations this usually requires sampling conformational transitions or phase transitions, but efficient sampling is often difficult to attain due to the roughness of the energy landscape. For Boltzmann distributions, crossing rates decrease exponentially with free-energy barrier heights. Thus, exponential acceleration can be achieved in simulations by applying an artificial bias along λ tuned such that a flat target distribution is obtained. A flat distribution is, however, an ambiguous concept unless a proper metric is used and is generally suboptimal. Here we propose a multidimensional Riemann metric, which takes the local diffusion into account, and redefine uniform sampling such that it is invariant under nonlinear coordinate transformations. We use the metric in combination with the accelerated weight histogram method, a free-energy calculation and sampling method, to adaptively optimize sampling toward the target distribution prescribed by the metric. We demonstrate that for complex problems, such as molecular dynamics simulations of DNA base-pair opening, sampling uniformly according to the metric, which can be calculated without significant computational overhead, improves sampling efficiency by 50%-70%.

Coupled Sine-Gordon Systems in DNA Dynamics

We consider a model called the coupled sine-Gordon equation for DNA dynamics by introducing two double helix structures. The second double helix structure is unilaterally influenced by the first one. The completely integrable coupled sine-Gordon equation admits kink-antikink solitons with increased width representing a wide base pair opening configuration in DNA. Also we propose another coupled sine-Gordon model with variable coefficients for DNA dynamics under an inhomogeneous background. We find that the inhomogeneous DNA model has many interesting localized nonrational rogue wave solutions. We can find that the appearance of the rogue waves (possibly means the genetic mutation) in the nonlinear DNA model is highly related to the inhomogeneity.

Melting of polymeric DNA double helix at elevated temperature: a molecular dynamics approach.

Genomic DNA of higher organisms exists as extremely long polymers, while in bacteria and other lower organisms it is circular with no terminal base pairs. Temperature-induced melting of the DNA double helix by localized strand separation has been unattainable by molecular dynamic simulations due to more rapid fraying of the terminal base pairs in oligomeric DNA. However, local-sequence-dependent unfolding of the DNA double helix is extremely important for understanding various biochemical phenomena, and can be addressed by simulating a model polymeric DNA duplex. Here, we present simulations of polymeric B-DNA of sequence d(CGCGCGCGAATTCGCGCGCG)2 at elevated temperatures, along with its equivalent oligomeric constructs for comparison. Initiation of temperature-induced DNA melting was observed with higher fluctuations of the central d(AATT) region only in the model polymer. The polymeric construct shows a definite melting start site at the weaker A/T stretch, which propagates slowly through the CG rich regions. The melting is reflected in the hydrogen bond breaking, i.e. basepair opening, and by disruption of stacking interaction between successive basepairs. Melting at higher temperature of the oligomer, however, was only through terminal fraying, as also reported earlier.

Predicting conformational ensembles and genome-wide transcription factor binding sites from DNA sequences

DNA shape is emerging as an important determinant of transcription factor binding beyond just the DNA sequence. The only tool for large scale DNA shape estimates, DNAshape was derived from Monte-Carlo simulations and predicts four broad and static DNA shape features, Propeller twist, Helical twist, Minor groove width and Roll. The contributions of other shape features e.g. Shift, Slide and Opening cannot be evaluated using DNAshape. Here, we report a novel method DynaSeq, which predicts molecular dynamics-derived ensembles of a more exhaustive set of DNA shape features. We compared the DNAshape and DynaSeq predictions for the common features and applied both to predict the genome-wide binding sites of 1312 TFs available from protein interaction quantification (PIQ) data. The results indicate a good agreement between the two methods for the common shape features and point to advantages in using DynaSeq. Predictive models employing ensembles from individual conformational parameters revealed that base-pair opening - known to be important in strand separation - was the best predictor of transcription factor-binding sites (TFBS) followed by features employed by DNAshape. Of note, TFBS could be predicted not only from the features at the target motif sites, but also from those as far as 200 nucleotides away from the motif.

Sequence dependency of canonical base pair opening in the DNA double helix.

The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair.

Base-pair opening dynamics of the microRNA precursor pri-miR156a affect temperature-responsive flowering in Arabidopsis

Internal and environmental cues, including ambient temperature changes, regulate the timing of flowering in plants. Arabidopsis miR156 represses flowering and plays an important role in the regulation of temperature-responsive flowering. However, the molecular basis of miR156 processing at lower temperatures remains largely unknown. Here, we performed nuclear magnetic resonance studies to investigate the base-pair opening dynamics of model RNAs at 16 °C and investigated the in vivo effects of the mutant RNAs on temperature-responsive flowering. The A9C and A10CG mutations in the B5 bulge of the lower stem of pri-miR156a stabilized the C15∙G98 and U16∙A97 base-pairs at the cleavage site of pri-miR156a at 16 °C. Consistent with this, production of mature miR156 was severely affected in plants overexpressing the A9C and A10CG constructs and these plants exhibited almost no delay in flowering at 16 °C. The A10G and A9AC mutations did not strongly affect C15∙G98 and U16∙A97 base-pairs at 16 °C, and plants overexpressing A10G and A9AC mutants of miR156 produced more mature miR156 than plants overexpressing the A9C and A10CG mutants and showed a strong delay in flowering at 16 °C. Interestingly, the A9AC mutation had distinct effects on the opening dynamics of the C15∙G98 and U16∙A97 base-pairs between 16 °C and 23 °C, and plants expressing the A9AC mutant miR156 showed only a moderate delay in flowering at 16 °C. Based on these results, we propose that fine-tuning of the base-pair stability at the cleavage site is essential for efficient processing of pri-miR156a at a low temperature and for reduced flowering sensitivity to ambient temperature changes.

Sequence-Dependent T:G Base Pair Opening in DNA Double Helix Bound by Cren7, a Chromatin Protein Conserved among Crenarchaea

T:G base pair arising from spontaneous deamination of 5mC or polymerase errors is a great challenge for DNA repair of hyperthermophilic archaea, especially Crenarchaea. Most strains in this phylum lack the protein homologues responsible for the recognition of the mismatch in the DNA repair pathways. To investigate whether Cren7, a highly conserved chromatin protein in Crenarchaea, serves a role in the repair of T:G mispairs, the crystal structures of Cren7-GTAATTGC and Cren7-GTGATCGC complexes were solved at 2.0 Å and 2.1 Å. In our structures, binding of Cren7 to the AT-rich DNA duplex (GTAATTGC) induces opening of T2:G15 but not T10:G7 base pair. By contrast, both T:G mispairs in the GC-rich DNA duplex (GTGATCGC) retain the classic wobble type. Structural analysis also showed DNA helical changes of GTAATTGC, especially in the steps around the open T:G base pair, as compared to GTGATCGC or the matched DNAs. Surface plasmon resonance assays revealed a 4-fold lower binding affinity of Cren7 for GTAATTGC than that for GTGATCGC, which was dominantly contributed by the decrease of association rate. These results suggested that binding of Cren7 to DNA leads to T:G mispair opening in a sequence dependent manner, and therefore propose the potential roles of Cren7 in DNA repair.

Base-pair opening dynamics of primary miR156a using NMR elucidates structural determinants important for its processing level and leaf number phenotype in Arabidopsis.

MicroRNAs originate from primary transcripts containing hairpin structures. The levels of mature miR156 influence the leaf number prior to flowering in the life cycle of plants. To understand the molecular mechanism of biogenesis of primary miR156a (pri-miR156a) to mature miR156, a base-pair opening dynamics study was performed using model RNAs mimicking the cleavage site of wild type and B5 bulge-stabilizing mutant pri-miR156a constructs. We also determined the mature miR156 levels and measured leaf numbers at flowering of plants overexpressing the wild type and mutant constructs. Our results suggest that the stabilities and/or opening dynamics of the C15·G98 and U16·A97 base-pairs at the cleavage site are essential for formation of the active conformation and for efficient processing of pri-miR156a, and that mutations of the B5 bulge can modulate mature miR156 levels as well as miR156-driven leaf number phenotypes via changes in the base-pair stability of the cleavage site.

Structural Insights into Conformation Differences between DNA/TNA and RNA/TNA Chimeric Duplexes.

Threose nucleic acid (TNA) is an artificial genetic polymer capable of heredity and evolution, and is studied in the context of RNA chemical etiology. It has a four-carbon threose backbone in place of the five-carbon ribose of natural nucleic acids, yet forms stable antiparallel complementary Watson-Crick homoduplexes and heteroduplexes with DNA and RNA. TNA base-pairs more favorably with RNA than with DNA but the reason is unknown. Here, we employed NMR, ITC, UV, and CD to probe the structural and dynamic properties of heteroduplexes of RNA/TNA and DNA/TNA. The results indicate that TNA templates the structure of heteroduplexes, thereby forcing an A-like helical geometry. NMR measurement of kinetic and thermodynamic parameters for individual base pair opening events reveal unexpected asymmetric "breathing" fluctuations of the DNA/TNA helix. The results suggest that DNA is unable to fully adapt to the conformational constraints of the rigid TNA backbone and that nucleic acid breathing dynamics are determined from both backbone and base contributions.

Assessing the Current State of Amber Force Field Modifications for DNA

The utility of molecular dynamics (MD) simulations to model biomolecular structure, dynamics, and interactions has witnessed enormous advances in recent years due to the availability of optimized MD software and access to significant computational power, including GPU multicore computing engines and other specialized hardware. This has led researchers to routinely extend conformational sampling times to the microsecond level and beyond. The extended sampling time has allowed the community not only to converge conformational ensembles through complete sampling but also to discover deficiencies and overcome problems with the force fields. Accuracy of the force fields is a key component, along with sampling, toward being able to generate accurate and stable structures of biopolymers. The Amber force field for nucleic acids has been used extensively since the 1990s, and multiple artifacts have been discovered, corrected, and reassessed by different research groups. We present a direct comparison of two of the most recent and state-of-the-art Amber force field modifications, bsc1 and OL15, that focus on accurate modeling of double-stranded DNA. After extensive MD simulations with five test cases and two different water models, we conclude that both modifications are a remarkable improvement over the previous bsc0 force field. Both force field modifications show better agreement when compared to experimental structures. To ensure convergence, the Drew–Dickerson dodecamer (DDD) system was simulated using 100 independent MD simulations, each extended to at least 10 μs, and the independent MD simulations were concatenated into a single 1 ms long trajectory for each combination of force field and water model. This is significantly beyond the time scale needed to converge the conformational ensemble of the internal portions of a DNA helix absent internal base pair opening. Considering all of the simulations discussed in the current work, the MD simulations performed to assess and validate the current force fields and water models aggregate over 14 ms of simulation time. The results suggest that both the bsc1 and OL15 force fields render average structures that deviate significantly less than 1 Å from the average experimental structures. This can be compared to similar but less exhaustive simulations with the CHARMM 36 force field that aggregate to the ∼90 μs time scale and also perform well but do not produce structures as close to the DDD NMR average structures (with root-mean-square deviations of 1.3 Å) as the newer Amber force fields. On the basis of these analyses, any future research involving double-stranded DNA simulations using the Amber force fields should employ the bsc1 or OL15 modification.

Two conformational states in D-shaped DNA: Effects of local denaturation.

The bending of double-stranded(ds) DNA on the nano-meter scale plays a key role in many cellular processes such as nucleosome packing, transcription-control, and viral-genome packing. In our recent study, a nanometer-sized dsDNA bent into a D shape was formed by hybridizing a circular single-stranded(ss) DNA and a complementary linear ssDNA. Our fluorescence resonance energy transfer (FRET) measurement of D-DNA revealed two types of conformational states: a less-bent state and a kinked state, which can transform into each other. To understand the origin of the two deformed states of D-DNA, here we study the presence of open base-pairs in the ds portion by using the breathing-DNA model to simulate the system. We provide strong evidence that the two states are due to the emergence of local denaturation, i.e., a bubble in the middle and two forks at ends of the dsDNA portion. We also study the system analytically and find that the free-energy landscape is bistable with two minima representative of the two states. The kink and fork sizes estimated by the analytical calculation are also in excellent agreement with the results of the simulation. Thus, this combined experimental-simulation-analytical study corroborates that highly bent D-DNA reduces bending stress via local denaturation.

Current-induced enhancement of DNA bubble creation

Current-induced heating of short double-stranded DNA chains is studied within a two-probe transport setup by using the Langevin approach. The electrons are modeled by a tight-binding Hamiltonian. The DNA atomic motion is described by the Peyrard–Bishop–Dauxois atomic potential, coupled with electrons through the Holstein interaction. The solvent environment is accounted for as a classical heat bath. Voltage biases of can effectively break the base pairs and lead to the melting transition, which can be detected from the resulting significant reduction of the conductance. When the bias increases, the opening of base pairs near the leads with higher chemical potential is suppressed and bubble (localized separation of the double strand) formation becomes asymmetric. Our results suggest that the voltage bias can excite the base pairs, hence increases the chemical activity of DNA.