Bacterium Ralstonia Solanacearum Research Articles

The Genes Associated with Jasmonic Acid and Salicylic Acid Are Induced in Tropical Chili Pepper against Ralstonia solanacearum by Applying Arbuscular Mycorrhizal Fungi

Controlling soil-borne pathogens is a significant problem in agriculture. Arbuscular mycorrhizae have a potential role in controlling soil-borne pathogens by increasing plant phytohormone contents. However, the mechanism of resistance by mycorrhizae has not been fully elucidated, particularly against bacterial wilt disease in Solanaceae. This study examined the role of mycorrhizae in expressing genes involved in the signaling pathways mediated by jasmonic acid (JA) and salicylic acid (SA) in tropical chili pepper against the bacterium Ralstonia solanacearum. Seedlings from ten genotypes of chili pepper were inoculated with a consortium of five mycorrhizal species and/or inoculated with a mixture of nine isolates of R. solanacearum. The leaves of 10-week-old plants after the treatment were sampled for real-time polymerase chain reaction analysis. The results showed that the mycorrhizae strengthened the immune system of tropical chili pepper by increasing the relative gene expression levels of JA and SA in genotypes with high and low responsiveness to the mycorrhizae. The relative gene expression level of JA was related to the percentage colonization of mycorrhizae and the resistance of the tropical chili pepper genotypes to R. solanacearum. The relative gene expression level of SA was associated with the resistance of tropical chili pepper to R. solanacearum.

Bisprenyl naphthoquinone and chlorinated calcimycin congener bearing thiazole ring from an actinomycete of the genus Phytohabitans.

A bisprenyl naphthoquinone, phytohabinone (1), and a calcimycin congener with unusual modifications, phytohabimicin (2), were isolated from the culture extract of Phytohabitans sp. RD003013. The structures of 1 and 2 were determined by NMR and MS analyses, and the absolute configuration of 2 was established by using electronic circular dichroism (ECD) calculation. The prenylation pattern of 1 was unprecedented among the known prenylated naphthoquinones. Compound 2 represents a spiroacetal core of polyketide origin substituted with a thiazole carboxylic acid and a dichrolopyrrole moiety, which is an unprecedented modification pattern in the known calcimycin family natural products. Remarkably, 2 showed moderate antimicrobial activity against a Gram-negative bacterium Ralstonia solanacearum while calcimycin was inactive. Additionally, 2 inhibits the migration of EC17 cancer cells at noncytotoxic concentrations.

Maintenance of tRNA and elongation factors supports T3SS proteins translational elongations in pathogenic bacteria during nutrient starvation

BackgroundSufficient nutrition contributes to rapid translational elongation and protein synthesis in eukaryotic cells and prokaryotic bacteria. Fast synthesis and accumulation of type III secretion system (T3SS) proteins conduce to the invasion of pathogenic bacteria into the host cells. However, the translational elongation patterns of T3SS proteins in pathogenic bacteria under T3SS-inducing conditions remain unclear. Here, we report a mechanism of translational elongation of T3SS regulators, effectors and structural protein in four model pathogenic bacteria (Pseudomonas syringae, Pseudomonas aeruginosa, Xanthomonas oryzae and Ralstonia solanacearum) and a clinical isolate (Pseudomonas aeruginosa UCBPP-PA14) under nutrient-limiting conditions. We proposed a luminescence reporter system to quantitatively determine the translational elongation rates (ERs) of T3SS regulators, effectors and structural protein under different nutrient-limiting conditions and culture durations.ResultsThe translational ERs of T3SS regulators, effectors and structural protein in these pathogenic bacteria were negatively regulated by the nutrient concentration and culture duration. The translational ERs in 0.5× T3SS-inducing medium were the highest of all tested media. In 1× T3SS-inducing medium, the translational ERs were highest at 0 min and then rapidly decreased. The translational ERs of T3SS regulators, effectors and structural protein were inhibited by tRNA degradation and by reduced levels of elongation factors (EFs).ConclusionsRapid translational ER and synthesis of T3SS protein need adequate tRNAs and EFs in nutrient-limiting conditions. Numeric presentation of T3SS translation visually indicates the invasion of bacteria and provides new insights into T3SS expression that can be applied to other pathogenic bacteria.

Microbial Profiling of Potato-Associated Rhizosphere Bacteria under Bacteriophage Therapy.

Potato soft rot and wilt are economically problematic diseases due to the lack of effective bactericides. Bacteriophages have been studied as a novel and environment-friendly alternative to control plant diseases. However, few experiments have been conducted to study the changes in plants and soil microbiomes after bacteriophage therapy. In this study, rhizosphere microbiomes were examined after potatoes were separately infected with three bacteria (Ralstonia solanacearum, Pectobacterium carotovorum, Pectobacterium atrosepticum) and subsequently treated with a single phage or a phage cocktail consisting of three phages each. Results showed that using the phage cocktails had better efficacy in reducing the disease incidence and disease symptoms’ levels when compared to the application of a single phage under greenhouse conditions. At the same time, the rhizosphere microbiota in the soil was affected by the changes in micro-organisms’ richness and counts. In conclusion, the explicit phage mixers have the potential to control plant pathogenic bacteria and cause changes in the rhizosphere bacteria, but not affect the beneficial rhizosphere microbes.

Characterization of Ralstonia solanacearum Using Fourier Transform Infrared (FTIR) Spectroscopy

Ralstonia solanacearum, the causal agent of bacterial wilt disease is worldwide in distribution, and results in serious economic losses, particularly in the tropics. Detection and characterization of microorganisms by Fourier transform infrared spectroscopy (FTIR) technique promises to be of great value because of the method’s inherent sensitivity, small sample size, rapidity, and simplicity. In this study, we used FTIR spectroscopy for the characterization of Ralstonia solanacearum. The bacteria were grown on Nutrient Agar (NA) at 28°C for 48 hours. The colonies of Ralstonia solanacearum on nutrient agar medium were smooth circular, raised, and dirty white. Cultures of bacteria were identified by molecular methods using PCR techniques. The DNA was amplified using a specific primer pair, 759f/760r (forward primer: 5'- GTCGCCGTCAACTCACTTTCC 3’, reverse primer: 5'-GTCGCCGTAGCAATGCGGAATCG-3’). The PCR produced a single band of 280 bp from the isolated DNA of cultured bacteria. Bacterial spectra were obtained in the wavenumber range of 4000–400 cm-1 using FTIR spectroscopy. The identification of cell wall constituents in region 3000–2800 cm-1, the proteinaceous structure of bacteria in region 1665–1200 cm-1, and the fingerprint of bacteria in region 1200-800 cm-1 are all part of the spectra analysis in this study. Absorption bands obtained from bacteria Ralstonia solanacearum samples associated with protein, phospholipids, nucleic acids, and carbohydrates appear in the bacterial IR absorption spectra.

Structural Elucidation and Engineering of a Bacterial Carbohydrate Oxidase.

Flavin-dependent carbohydrate oxidases are valuable tools in biotechnological applications due to their high selectivity in the oxidation of carbohydrates. In this study, we report the biochemical and structural characterization of a recently discovered carbohydrate oxidase from the bacterium Ralstonia solanacearum, which is a member of the vanillyl alcohol oxidase flavoprotein family. Due to its exceptionally high activity toward N-acetyl-d-galactosamine and N-acetyl-d-glucosamine, the enzyme was named N-acetyl-glucosamine oxidase (NagOx). In contrast to most known (fungal) carbohydrate oxidases, NagOx could be overexpressed in a bacterial host, which facilitated detailed biochemical and enzyme engineering studies. Steady state kinetic analyses revealed that non-acetylated hexoses were also accepted as substrates albeit with lower efficiency. Upon determination of the crystal structure, structural insights into NagOx were obtained. A large cavity containing a bicovalently bound FAD, tethered via histidyl and cysteinyl linkages, was observed. Substrate docking highlighted how a single residue (Leu251) plays a key role in the accommodation of N-acetylated sugars in the active site. Upon replacement of Leu251 (L251R mutant), an enzyme variant was generated with a drastically modified substrate acceptance profile, tuned toward non-N-acetylated monosaccharides and disaccharides. Furthermore, the activity toward bulkier substrates such as the trisaccharide maltotriose was introduced by this mutation. Due to its advantage of being overexpressed in a bacterial host, NagOx can be considered a promising alternative engineerable biocatalyst for selective oxidation of monosaccharides and oligosaccharides.

Inactivation of plant pathogenic bacterium Ralstonia solanacearum in drainage solution from hydroponic system by a rotating advanced oxidation contactor equipped with TiO2/zeolite composite sheets

A rotating advanced oxidation contactor (RAOC) equipped with TiO2/zeolite composite sheets was developed to inactivate the plant pathogenic bacterium Ralstonia solanacearum in drainage solution (DS) from a hydroponic system. The inactivation efficiency of R. solanacearum in DS and pure culture solution (PS) by the RAOC was compared with that achieved by a submerged composite sheet photocatalysis reactor (SSPR). The initial number of living bacteria (N0) was adjusted to around 106–107 CFU mL−1. The inactivation efficiency of R. solanacearum by the SSPR at 4.0 × 107 CFU mL−1 of N0 significantly decreased compared with that at 1.8 × 106 CFU mL−1 of N0 owing to the attenuation of UV intensity by light absorption and scattering by solids derived from R. solanacearum, while the RAOC achieved >2-log inactivation during 24 h of treatment regardless of N0. The inactivation of R. solanacearum by the RAOC decelerated after 6 h, possibly because of competition for reactive oxygen species between R. solanacearum and products accumulated by inactivation of R. solanacearum. The ratio of rate constants for inactivation of R. solanacearum in DS to that in PS by the RAOC was 8 times that for the SSPR. This shows that the RAOC greatly mitigates the light attenuation and inhibitory effects of coexisting substances on inactivation of R. solanacearum in the DS. The RAOC is therefore a promising and upscalable photocatalytic reactor for efficient inactivation of R. solanacearum in DS.

Analysis of the replanting of banana hills with infection by the bacterium Ralstonia solanacearum philotype II race 2 and economic losses

Background: Moko is a disease caused by the bacterium Ralstonia solanacearum philotype II race 2, which has caused great economic losses and continues without proper management. So far there is no treatment to control the disease and the best solution is to avoid the arrival of the bacteria. This is done through strategies for managing the cultivation and eradication of infected plants, since the bacteria have the ability to spread through water, wind, and animals, among others. However, the main form of dispersal is infected planting material (hills). Methods: For this reason, to investigate the dynamics of Moko disease in plantain, a population simulation model with nonlinear ordinary differential equations was presented, with disease prevention and population of susceptible and infected plants and associated economic losses over time. Results: We found that replanting infected hills has a large effect on increasing the incidence of the disease and on production costs, in addition to generating greater economic losses. Both prevention strategies should be implemented in a medium proportion ( f=60% ; g=70%), in order to sustain a reasonable amount of susceptible plants over time. With this, the infected plants tend to be controlled, as well as leading to lower economic losses in general. Conclusion: cultural control strategies in banana Moko disease, such as disinfestation of tools, footwear, weed pruning, among others, are important agronomic practices for disease control, however the identification of infected hills plays an essential role in preventing the spread of the disease.

Elucidating the role of silicon dioxide and titanium dioxide nanoparticles in mitigating the disease of the eggplant caused by Phomopsis vexans, Ralstonia solanacearum, and root-knot nematode Meloidogyne incognita

Abstract Nanoparticles (NPs) have a critical function in mitigating the disease of fruits and vegetables. In the present investigation, the effects of three levels of concentrations (0.05, 0.10, and 0.20 mg/mL) of titanium dioxide NPs (TiO2-NPs) and silicon dioxide NPs (SiO2-NPs) were investigated against fungus Phomopsis vexans, bacterium Ralstonia solanacearum, and Meloidogyne incognita (root-knot nematode). The present investigation’s findings found that the application of SiO2-NPs was more efficient against test pathogens in comparison to TiO2-NPs. The best result produced by SiO2-NPs against pathogenic strain was used in the molecular docking investigation with the protein of R. solanacearum to better understand the interaction of active amino acids with SiO2-NPs. The obtained results revealed that the administration of 0.20 mg/mL foliar spray of SiO2-NPs in plants with M. incognita improves up to 37.92% of shoot dry weight and increases 70.42% of chlorophyll content. P. vexans growth was suppressed by 41.2% with 0.62 mm of inhibition zone when SiO2-NPs were given at a dosage of 0.20 mg/mL. The reductions in egg hatching and M. incognita (J2) mortality were greater in SiO2-NPs than in TiO2-NPs. The results of scanning electron microscopy confirmed that the application of both NPs harmed test pathogens. The confocal study also showed the penetration of NPs among test pathogens.

Bacillus amyloliquefaciens WS-10 as a potential plant growth-promoter and biocontrol agent for bacterial wilt disease of flue-cured tobacco

BackgroundBacterial wilt disease caused by the soilborne bacterium Ralstonia solanacearum is a serious threat to flue-cured tobacco production. In this study, an indigenous disease suppressive Bacillus strain was isolated from the rhizosphere soil of healthy tobacco plants, and its biocontrol and plant growth promoting (PGP) potential were evaluated in in-vivo and in-vitro assays.ResultsThrough isolation and screening of 250 isolates, WS-10 was found to be the best candidate antagonistic strain against R. solanacearum (WS-001). In-vitro assays revealed that the isolated strain WS-10 (Bacillus amyloliquefaciens) showed an effective antagonistic activity against R. solanacearum WS-001 and several plant-pathogenic fungi. As promising PGP rhizobacteria, WS-10 had the ability of nitrogen fixation, solubilization of inorganic potassium and phosphate, and biosynthesis of indole-3-acetic. In a co-culture assay, it significantly inhibits the growth of WS-001. Our greenhouse experiments showed that the soil physicochemical properties and accumulation of dry matter contents in different plant parts (roots, stems, and leaves) were significantly increased in the presence of B. amyloliquefaciens WS-10. The soil treated with B. amyloliquefaciens WS-10 displayed significantly higher values of the average well color development index, the utilization ability of 6 types of carbon sources by rhizosphere microorganisms, and the diversity indices of the rhizosphere microbial communities. In planta assay, B. amyloliquefaciens WS-10 significantly reduced tobacco bacterial wilt disease incidence by up to 73.36, 43.82, and 86.82% under three different treatments by improving the functional diversity and biological activity of the soil microbial community.ConclusionsObtained findings suggested that B. amyloliquefaciens WS-10 had an excellent potential as a growth-promoting and biocontrol agent of tobacco bacterial wilt disease due to its multiple beneficial traits of nutrient solubilization and disease suppression. Thus, we conclude that B. amyloliquefaciens WS-10 was a high potential PGP and biocontrol strain for healthy production of tobacco crop.

Myxococcus xanthus R31 Suppresses Tomato Bacterial Wilt by Inhibiting the Pathogen Ralstonia solanacearum With Secreted Proteins.

The pathogenic bacterium Ralstonia solanacearum caused tomato bacterial wilt (TBW), a destructive soil-borne disease worldwide. There is an urgent need to develop effective control methods. Myxobacteria are microbial predators and are widely distributed in the soil. Compared with other biocontrol bacteria that produce antibacterial substances, the myxobacteria have great potential for biocontrol. This study reports a strain of Myxococcus xanthus R31 that exhibits high antagonistic activity to R. solanacearum. Plate test indicated that the strain R31 efficiently predated R. solanacearum. Pot experiments showed that the biocontrol efficacy of strain R31 against TBW was 81.9%. Further study found that the secreted protein precipitated by ammonium sulfate had significant lytic activity against R. solanacearum cells, whereas the ethyl acetate extract of strain R31 had no inhibitory activity against R. solanacearum. Substrate spectroscopy assay and liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis of secreted proteins showed that some peptidases, lipases, and glycoside hydrolases might play important roles and could be potential biocontrol factors involved in predation. The present study reveals for the first time that the use of strain M. xanthus R31 as a potential biocontrol agent could efficiently control TBW by predation and secreting extracellular lyase proteins.

Effect of Phyto‐Assisted Synthesis of Magnesium Oxide Nanoparticles (MgO‐NPs) on Bacteria and the Root‐Knot Nematode

The root-knot nematode was examined using magnesium oxide nanoparticles (MgO-NPs) made from strawberries. The biologically synthesized MgO-NPs were characterized by UV, SEM, FTIR, EDS, TEM, and dynamic light scattering (DLS). Nanoparticles (NPs) were examined using scanning electron microscopy (SEM) and transmission electron microscopy (TEM) and shown to be spherical to hexagonal nanoparticles with an average size of 100 nm. MgO-NPs were tested on the root-knot nematode M. incognita (Meloidogynidae) and the plant pathogenic bacteria Ralstonia solanacearum. The synthesized MgO-NPs showed a significant inhibition of R. solanacearum and the root-knot nematode. MgO-NPs cause mortality and inhibit egg hatching of second-stage juveniles (J2) of M. incognita under the in vitro assay. This study aims to examine the biological activity of biogenic MgO-NPs. The findings marked that MgO-NPs may be utilized to manage R. solanacearum and M. incognita and develop effective nematicides. In addition, the antioxidant capacity of MgO-NPs was determined by using 2, 2-diphenyl-1-picryl-hydrazyl-hydrate (DPPH).

English

Bacterial wilt is a serious disease of potato (Solanum tuberosum L.) caused by the soil-borne pathogenic bacterium Ralstonia solanacearum. Detecting changes in protein abundance in potato plants in response to R. solanacearum is a pivotal step in uncovering the molecular interactions of plant pathogens. In this study, using the disease-resistant cultivar ‘Zhongshu 3’, we analyzed protein expression in potato seedlings inoculated with R. solanacearum every 12 h for a total of 72 h using isobaric tags for relative and absolute quantitation-based proteomics. Our results indicate that pathogenesis-related proteins, stressrelated proteins, non-specific lipid transfer proteins, small heat shock proteins, and osmotin-like proteins were up-regulated in response to pathogen infection at different time points. The accumulation of these proteins in response to biotic stress suggests that these proteins play an important role in pathogen resistance. Our findings will provide an important basis for characterizing the role of these proteins in increasing plant resistance to pathogens and in breeding bacterial wilt-resistant plants.

Inactivation of Plant Pathogenic Bacterium Ralstonia Solanacearum in Drainage Solution from Hydroponic System by a Rotating Advanced Oxidation Contactor Equipped with Tio2/Zeolite Composite Sheets

Inactivation of Plant Pathogenic Bacterium Ralstonia Solanacearum in Drainage Solution from Hydroponic System by a Rotating Advanced Oxidation Contactor Equipped with Tio2/Zeolite Composite Sheets

Biosynthesis of Silver Chloride Nanoparticles by Rhizospheric Bacteria and Their Antibacterial Activity against Phytopathogenic Bacterium Ralstonia solanacearum.

Ralstonia solanacearum is the most destructive pathogen, causing bacterial wilt disease of eggplant. The present study aimed to develop green synthesis and characterization of silver chloride nanoparticles (AgCl-NPs) by using a native bacterial strain and subsequent evaluation of their antibacterial activity against R. solanacearum. Here, a total of 10 bacterial strains were selected for the biosynthesis of AgCl-NPs. Among them, the highest yield occurred in the synthesis of AgCl-NPs using a cell-free aqueous filtrate of strain IMA13. Ultrastructural observation revealed that the AgCl-NPs were spherical and oval with smooth surfaces and 5–35 nm sizes. XRD analysis studies revealed that these particles contained face-centered cubic crystallites of metallic Ag and AgCl. Moreover, FTIR analysis showed the presence of capping proteins, carbohydrates, lipids, and lipopeptide compounds and crystalline structure of AgCl-NPs. On the basis of phylogenetic analysis using a combination of six gene sequences (16S, gyrA, rpoB, purH, polC, and groEL), we identified strain IMA13 as Bacillus mojavensis. Three kinds of lipopeptide compounds, namely, bacillomycin D, iturin, and fengycin, forming cell-free supernatant produced by strain IAM13, were identified by MALDI-TOF mass spectrometry. Biogenic AgCl-NPs showed substantial antibacterial activity against R. solanacearum at a concentration of 20 µg/mL−1. Motility assays showed that the AgCl-NPs significantly inhibited the swarming and swimming motility (61.4 and 55.8%) against R. solanacearum. Moreover, SEM and TEM analysis showed that direct interaction of AgCl-NPs with bacterial cells caused rupture of cell wall and cytoplasmic membranes, as well as leakage of nucleic acid materials, which ultimately resulted in the death of R. solanacearum. Overall, these findings will help in developing a promising nanopesticide against phytopathogen plant disease management.

Ralstonia solanacearum Effectors Localize to Diverse Organelles inSolanum Hosts.

Phytopathogenic bacteria secrete type III effector (T3E) proteins directly into host plant cells. T3Es can interact with plant proteins and frequently manipulate plant host physiological or developmental processes. The proper subcellular localization of T3Es is critical for their ability to interact with plant targets, and knowledge of T3E localization can be informative for studies of effector function. Here we investigated the subcellular localization of 19 T3Es from the phytopathogenic bacteria Ralstonia pseudosolanacearum and Ralstonia solanacearum. Approximately 45% of effectors in our library localize to both the plant cell periphery and the nucleus, 15% exclusively to the cell periphery, 15% exclusively to the nucleus, and 25% to other organelles, including tonoplasts and peroxisomes. Using tomato hairy roots, we show that T3E localization is similar in both leaves and roots and is not impacted by Solanum species. We find that in silico prediction programs are frequently inaccurate, highlighting the value of in planta localization experiments. Our data suggest that Ralstonia targets a wide diversity of cellular organelles and provides a foundation for developing testable hypotheses about Ralstonia effector function.

Performance of Solanum phureja-derived bacterial-wilt resistant potato clones in a field naturally infested with Ralstonia solanacearum in Central Brazil

ABSTRACT Bacterial wilt (BW), or brown rot, caused by the soil and seed borne bacterium Ralstonia solanacearum, is one of the most devastating diseases of potatoes cultivated in warmer regions of the world. There are no potato cultivars with a desirable level of BW resistance, although it has been recognized that resistance can be an outstanding component for disease management. However, the sources of resistance available lack agronomic traits required by potato growers, therefore being of little interest to breeders. The objective of this work was to evaluate the performance of 11 clones selected for BW resistance and improved for tuber traits upon selection in the last two decades. The clones under test were compared with susceptible and resistant clones and cultivars, in a completely randomized blocks design with three replications of single lines of 10 plants, in a field naturally infested with race 1, biovar 1, phylotype II of R. solanacearum. BW incidence was assessed 60-70 days after planting and total tuber yield in each plot was recorded 110 days after planting. All the evaluated clones presented higher levels of resistance to BW compared with the commercial varieties, not differing from the resistant, not commercial, controls. In a next step, these clones will be characterized for other desirable traits and those which combine high level of resistance and commercial characteristics will be recommended for breeders for enriching the genotypic background in the search for commercial varieties. We also confirmed that the cultivar BRSIPR Bel displays an intermediate level of resistance, what makes it an interesting genitor for its good agronomic characteristics. The findings of this work demonstrate that the improved potato clones selected under tropical conditions in the Embrapa’s pre-breeding project possess high and stable levels of resistance to bacterial wilt, being a valuable resource for breeders.

Antimicrobial and Antioxidant properties of medicinal mushroom Ganoderma P. Karst

Ganoderma species have been known all over the world as highly medicinal mushrooms. Antimicrobial activity of it is an attractive approach which raises the global interests from the scientific community. In this study, the antimicrobial assay of ethanol and methanol extracts of Ganoderma were prepared by using the dried mycelial powder obtained from five different liquid media; was performed against seven plant pathogenic fungi viz., Alternaria macrospora, Aspergilus niger, A. flavus, Colletotrichum falcatum, Fusarium oxysporum, Pestalotiopsis mangiferae and Penicillium sp. and two plant pathogenic bacteria Xanthomonas oryzae and Ralstonia solanacearum. The extracts of mycelia obtained from Yeast Wine Media exhibited the highest inhibition percentage as compared to rest. At concentration 1000ppm, there was complete inhibition of mycelial growth for Alternaria macrospora, Aspergilus niger and A. flavus while for Fusarium oxysporum and Penicillum sp. complete inhibition was observed at 500ppm but for Colletotrichum falcatum and Pestalotiopsis mangiferae, more than 80% mycelial inhibition at concentration 1000ppm in both ethanol and methanol extracts. In the case of Xanthomonas oryzae and Ralstonia solanacearum, at concentration 1000ppm, methanol extract showed the highest inhibition zone (3.50mm, 3.75mm). Ganoderma exhibited antagonistic effect against plant pathogenic fungi could add to the interest of developing Ganoderma as a successful bioagent in the near future. Antioxidant activities were evaluated by using DPPH radical scavenging assay and Metal chelating activity on ferrous ions. The DPPH radical scavenging effect was detected in methanol extract (Inhibition% = 27.312%) was higher than that of the ethanol extract (Inhibition% = 24.79%) and also Ferrous ion chelating ability of methanol extract (Inhibition% =22.27%) was higher than the ethanol extract (Inhibition% =12.55%). It is clearly indicated that both methanol and ethanol extract of the Ganoderma show antioxidant properties and Ganoderma extracts act as an effective antioxidant agents.

Management of Ralstonia solanacearum in Tomato Using ZnO Nanoparticles Synthesized Through Matricaria chamomilla.

Matricaria chamomilla flower extract was used as a biocompatible material for synthesis of zinc oxide nanoparticles (ZnONPs). The synthesized NPs were evaluated for their antibacterial potential invitro and invivo against the Gram-negative bacterium Ralstonia solanacearum, which causes devastating bacterial wilt disease in tomato and other crops. Synthesized ZnONPs were further analyzed by UV-visible spectroscopy, Fourier transform infrared spectroscopy, x-ray diffraction, transmission electron microscopy, and scanning electron microscopy with energy-dispersive spectroscopy. The synthesized polydisperse ZnONPs were found to be in the size range of 8.9 to 32.6 nm, and at 18.0 µg ml-1 exhibited maximum invitro growth inhibition of the pathogen R. solanacearum. Scanning electron microscopy analysis of affected bacterial cells showed morphological deformation such as disruption of the cell membrane and wall, and the leakage of cell contents. Results of invivo studies also showed that application of ZnONPs to the artificially inoculated tomato plants with the pathogen R. solanacearum significantly enhanced the plant growth by reducing bacterial soil population and disease severity as compared with the untreated control. Biosynthesized ZnONPs could be an effective approach to control the bacterium R. solanacearum.

Green synthesis of multifunctional carbon coated copper oxide nanosheets and their photocatalytic and antibacterial activities

The studies of metal oxides in environmental remediation of chemical and biological pollutants are gaining colossal importance. Herein, we report the facile synthesis of multifunctional copper oxide nanosheets (CuO NS) using an aqueous extract of Rhazya stricta. The phytochemical investigation of R. stricta indicated the presence of saponins, tannins, and reducing sugars, responsible for the reduction and stabilization of CuO NS. A UV–Visible spectrophotometer initially confirmed the fabrication of CuO NS with specific Surface Plasmon Resonance at 294 nm. Field Emission Scanning Electron Microscopy (FE-SEM), Fourier-transform infrared spectroscopy FTIR, and XRD were further used to characterize the CuO NS. The obtained CuO NS were poly-dispersed with an average size of 20 nm. Interestingly these particles were aligned together in 3D cubical sheets layered above each other via self-assembly. The as-synthesized CuO NS showed enhanced antibacterial potential (17.63 mm, overall mean inhibition zone) in comparison to the known antibiotics (11.51 mm, overall mean inhibition zone) against both Solanaceous crop's wilt-causing bacteria (Ralstonia solanacearum and Clavibacter michiganensis). Furthermore, the appreciable photocatalytic potential of CuO NS has also been observed, causing 83% degradation of methylene blue (MB) upon solar irradiation. The synthesis methodology is devoid of any toxic waste or by-products. It could be used to produce eco-friendly CuO nanomaterial for industrial uses.