Apple Chlorotic Leaf Spot Virus Isolates Research Articles

Genetic diversity and phylogenetic relationships of apple chlorotic leaf spot virus isolates from Malus, Pyrus and Prunus hosts in Latvia

AbstractThe prevalence of apple chlorotic leaf spot virus (ACLSV) in different Rosaceae species, mainly from cultivated apple (Malus domestica), pear (Pyrus communis), plum (Prunus domestica), apricot (Prunus armeniaca) and wild plants of genus Amelanchier, Cotoneaster, Crataegus, Malus, Prunus and Sorbus were studied. ACLSV was found in cultivated M. domestica, P. communis, P. domestica and wild‐growing Malus, including M. sylvestris. Thirty‐four sequences of the ACLSV coat protein gene were obtained and compared with 372 homologous sequences from GenBank to evaluate the genetic diversity of the virus in Latvia and worldwide. The sequence identities varied from 79.6% to 98.4% at the nucleotide level and 84.5% to 100% at the amino acid level. Phylogenetic analyses clustered ACLSV pome fruit isolates into three genetic types but isolates from stone fruits into four phylogenetic groups. Three genetic types of ACLSV pome and stone fruit isolates were identified in Latvia. Two of them were previously characterized as type B6 and P205. The third genetic type was newly recognized among the stone fruit isolates and distinguished from other virus isolates by amino acid substitutions in three positions, Ser14, Asn23 and Leu72. Two natural recombinants, LV27 and NZ5, were detected among ACLSV isolates from Latvia, and recombination events were identified for the first time in wild‐growing Malus, confirming that recombination is a common process in the ACLSV population.

Seed Transmission of Three Viruses in Two Pear Rootstock Species Pyrus betulifolia and P. calleryana.

Viral seed transmission causes the spread of many plant viral diseases. Pyrus betulifolia and P. calleryana are important rootstock germplasms for pear production in China. This study revealed the widespread infection of apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and apple stem pitting virus (ASPV) in maternal trees of P. betulifolia and P. calleryana by nested multiplex reverse transcription-polymerase chain reaction (nmRT-PCR) assays. Seeds from eight P. betulifolia and two P. calleryana trees had positive rates of 15.9–73.9%, 0–21.2%, and 40.4% for ASGV, ASPV, and ACLSV, respectively. At the cotyledon and 6–8 true leaf stages, seedlings grown from seeds of infected trees gave positive rates of 5.4% and 9.3% for ASGV, 6.7% and 15.6% for ACLSV, and 0% and 2.7% for ASPV, respectively. Incidence in nursery P. betulifolia seedlings of 10.1%, 5.3%, and 3.5% were determined for ASGV, ACLSV, and ASPV, respectively. The nucleotide sequences of coat protein (CP) and movement protein coding genes of both ASGV and ASPV, and CP gene of ACLSV from maternal trees, seeds, and seedlings were analyzed. Sequence identities and phylogenetic comparison with corresponding sequences from GenBank demonstrated that molecular variation occurred within ASGV, ACLSV, and ASPV isolates, with most sequences determined here had close relationships with reported isolates infecting pear or formed independent clades. This is the first report on the seed transmission and the molecular characteristics of these viruses infecting two rootstock species. These findings provided important evidence in management effort for pear viral diseases.

Determination and characterization of several virus diseases on almond trees in the Eastern Mediterranean Region

Son yıllarda Akdeniz ülkelerinde olduğu gibi ülkemizde de badem üretimi yıldan yıla artış eğilimine girmiştir. Tüm bitkilerde olduğu gibi bademlerde de virüs hastalıklarından dolayı kayıplar meydana gelmektedir. Bu çalışma ile Doğu Akdeniz Bölgesindeki badem alanlarında ekonomik olarak zarar yapan Prune dwarf virus (PDV), Prunus necrotic ringspot virus (PNRSV), Plum pox virus (PPV), Apple chlorotic leaf spot virus (ACLSV), Apple mosaic virus (ApMV) ve Cherry leaf roll virus (CLRV)’un bölgemizdeki dağılımı araştırılarak, moleküler ve biyolojik karakterizasyonu yapılmıştır. 2012-2016 yılları arasında yapılan sürvey çalışmalarında, Doğu Akdeniz Bölgesindeki 5 ilden toplam 605 adet badem örneği toplanıp DAS-ELISA testine tabi tutulmuştur. Toplanan 605 badem örneğinden 169 tanesi (% 27,93) en az bir virüsle enfekteli bulunmuştur. Bunlardan, Adana ilinde toplanan 129 badem örneğinin 26’sı (%20,16), Mersin’de 299 örneğin 90’ı (%30,10), Kahramanmaraş’ta 71 örneğin 11’i (%15,49), Hatay’da 89 örneğin 34’ü (%38,20) ve Osmaniye’de 17 örneğin 8’i (%47,06) en az bir virüs ile enfekteli bulunmuştur. Test edilen örneklerde PNRSV %64, PDV %18, ACLSV %11 ve karışık enfeksiyon %7 oranında tespit edilmiş, ApMV, PPV ve CLRV ise tespit edilememiştir. Enfekteli badem izolatlarından, kılıf protein genini içeren gen bölgesi RT-PCR ile çoğaltılarak PNRSV için 616 bp, PDV için 862 bp ve ACLSV için 358 bp’lik bantlar elde edilmiştir. Badem izolatlarının NCBI’a kayıtlı dünya PNRSV izolatları ile %97-99, PDV izolatları ile %87-96, ACLSV izolatları ile %81-96 oranında nükleotit düzeyde benzerlik gösterdiğinden bu etmenlerin bitki materyallerinin ticaretinden dolayı yayıldığı düşünülmektedir.

Complete nucleotide sequence of a new virus, peach chlorotic leaf spot virus, isolated from flat peach in China

Contigs with sequence homologies to apple chlorotic leaf spot virus (ACLSV) were identified by high-throughput sequencing analysis in three peach samples. Complete genomic sequences of RP19-1 and RP19-2 of the virus consisted of 7,466 and 7,465 nucleotides (nts), respectively, excluding the poly (A) tails. They shared the highest identity with Ta Tao 5, but lower than 70% of sequence similarity with other ACLSV isolates. Furthermore, phylogenetic analysis revealed that these two isolates clustered with Ta Tao 5, which is distinct from other ACLSV isolates. According to the criteria for species demarcation within the genus Trichovirus, these two isolates as well as Ta Tao 5 should be recognized as a new virus species, tentatively named "Peach chlorotic leaf spot virus".

Prevalence and molecular variability of Apple chlorotic leaf spot virus capsid protein genes in Lithuania

Apple chlorotic leaf spot virus (ACLSV) is a most common pathogen of apples in the world. The occurrence, genetic diversity, recombination patterns and mutation of ACLSV CP in apple trees 80–120 years old from old homesteads and abandoned orchards in Lithuania were investigated. Using RT-PCR, 73.8% of samples tested positive for ACLSV. Specific PCR products to virus CP gene were sequenced and analysed from 39 RNA samples of apple trees collected in different geographic locations. Heterogenic infection of ACLSV in the same apple tree was detected in 11 samples. Fifty Lithuanian sequences of ACLSV with diversity in CP gene were submitted in NCBI and compared to 28 analogous sequences by other authors. The identity of virus CP gene among Lithuanian isolates ranged 81.6–99.7% at the nucleic and 88.6–100% at the amino acids level. ACLSV isolates significantly distinguished into two clusters and seven subclusters on phylogenetic tree. Isolates related to P205, A4, B6 and GC10a were identified in Lithuania, and relationship with Mo-5 and RC was not found. Two recombinant Lithuanian isolates of ACLSV distinguished to separate subcluster R-LT. Lithuanian isolates were characterized by combination of amino acids in conservative sites. The unique single or multiple mutations in CP gene among Lithuanian isolates were observed, and substitution in conservative sites 59, 75 and 79 was also identified. The high prevalence and diversity of latent infection in old apple trees was frequently determined due to the genomic mutation and rarely due to the recombination.

Characterization and genetic variability of coat protein genes of Apple chlorotic leaf spot virus isolates from southern Brazil

Apple chlorotic leaf spot virus (ACLSV) infects temperate rosaceous fruit trees worldwide and causes a wide range of diseases that are economically highly damaging. This study was carried out to analyze genetic variability of regional ACLSV isolates and compare it with ACLSV isolates from other parts of the world. Nineteen amplicons of ACLSV, corresponding to the coat protein (CP) gene of isolates from apple, plum, and nectarine, from two states in southern Brazil, have been analyzed for genetic variation and compared phylogenetically among themselves and with other sequences available in GenBank. Sequences identities among complete CP genes of these isolates ranged from 87.5 to 100% and 92.2 to 100% at the nucleotide (nt) and the deduced amino acid (daa) levels, respectively. In the comparison with isolates from Asia, Europe and North America, identities were 68.4 to 100% and 72.5 to 100% at nt and daa levels, respectively. Phylogenetic trees based on nucleotide sequences showed that these isolates grouped into two clusters, cluster 1 containing apple isolates and cluster 2 comprising apple, plum and nectarine isolates. Most Brazilian isolates showed conserved signatures (Ser40, Leu59, Tyr75, Thr130 and Leu184) in their CPs, which place them with type B6 isolates. However, some Brazilian isolates were found to be variants of type B6. These analyzes indicated that Brazilian isolates had lower genetic variability compared to isolates from China, India and Japan and that the CP genes were under negative selection. The greatest diversity of nucleotides was observed in the central portion of the CP gene, represented predominantly by synonymous substitutions. One natural recombinant was detected among ACLSV isolates from Brazil.

Characterization of apple stem grooving virus and apple chlorotic leaf spot virus identified in a crab apple tree.

Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.

Genome Sequences of Three Apple chlorotic leaf spot virus Isolates from Hawthorns in China.

The genome sequences of Apple chlorotic leaf spot virus (ACLSV) isolates from three accessions of hawthorns (Crataegus pinnatifida) grown at Shenyang Agricultural University were determined using Illumina RNA-seq. To confirm the assembly data from the de novo sequencing, two ACLSV genomic sequences (SY01 and SY02) were sequenced using the Sanger method. The SY01 and SY02 sequences obtained with the Sanger method showed 99.5% and 99.7% nucleotide identity with the transcriptome data, respectively. The genome sequences of the hawthorn isolates SY01, SY02 and SY03 (GenBank accession nos. KM207212, KU870524 and KU870525, respectively) consisted of 7,543, 7,561 and 7,545 nucleotides, respectively, excluding poly-adenylated tails. Sequence analysis revealed that these hawthorn isolates shared an overall nucleotide identity of 82.8–92.1% and showed the highest identity of 90.3% for isolate YH (GenBank accession no. KC935955) from pear and the lowest identity of 67.7% for isolate TaTao5 (GenBank accession no. EU223295) from peach. Hawthorn isolate sequences were similar to those of ‘B6 type’ ACLSV. The relationship between ACLSV isolates largely depends upon the host species. This represents the first comparative study of the genome sequences of ACLSV isolates from hawthorns.

First Report of Apple chlorotic leaf spot virus in Hawthorn in China.

Apple chlorotic leaf spot virus (ACLSV) is the type species of the genus Trichovirus in the Betaflexiviridae family (1). ACLSV is distributed worldwide in most pome and stone fruit trees of the Rosaceae family, including apple, pear, peach, plum, cherry, apricot, and hawthorn (3). In 2012, a de novo assembly of the fruit transcriptome of a hawthorn (Crataegus pinnatifida) accession maintained in the National Hawthorn Germplasm Repository at Shenyang was conducted using Illumina-based RNA-seq data, and it resulted that a 7,543 nt of the genomic sequence of ACLSV was assembled. To confirm the result of Illumina RNA-Seq analysis, nine pairs of primers were designed according to the assembled sequence of ACLSV to amplify the genomic sequence of ACLSV by RT-PCR with total RNA extracted from hawthorn leaves as template (2). The full-length sequence of the isolate of ACLSV from hawthorn assembled with the sequences of the RT-PCR fragments was also 7,543 nt (GenBank Accession No. KM207212), which shows 99.5% nucleotide identity with the sequence assembled from Illumina RNA-seq data. The isolate of ACLSV from hawthorn was named SY01, which shows about 75% nucleotide identity with the sequences of ACLSV isolated from apple (GenBank Accession No. KJ522693), peach (JN634760), and plum (M58152). The nucleotide sequences of coat protein and RNA polymerase genes of SY01 are about 83 and 88% identical with those of ACLSV isolates in GenBank, respectively. A pair of primers HF/HR (ACCGGCGTCTTTTGCAAACT/TGGGTTCCAGAGTTTGAATGCA), which amplified a 210-bp fragment, was designed according to the sequence of SY01 to detect ACLSV in hawthorns. With RT-PCR, ACLSV was detected in 6 of the 30 accessions of hawthorn, and the nucleotide identity among PCR fragments was 92%. In addition, leaves from six RT-PCR positive plants reacted positively when tested by DAS-ELISA with polyclonal antisera (X-Y Biotechnology, Shanghai, China) raised against ACLSV. These findings, representing the first report of the presence of ACLSV in hawthorn in China, illustrate the need to develop virus-free trees of hawthorn for cultivation and germplasm distribution of this important Rosaceae family plant.

First Report of Apple chlorotic leaf spot virus, Cherry green ring mottle virus, and Cherry necrotic rusty mottle virus on Peach in Montenegro.

The sanitary status of peach fruit trees was assessed in central and coastal regions of Montenegro during a survey in September and October of 2011 and 2012. Leaf samples were collected from 58 (2011) and 47 (2012) trees showing chlorotic rings and spots, mosaic, necrosis, leaf distortion, and stunting. Total RNAs was extracted from each sample by RNeasy Plant Mini kit (Qiagen, Germany) and used as a template in PDO (polyvalent degenerate oligonucleotides) nested reverse transcription (RT)-PCR for the detection of fruit tree viruses belonging to the genera Trichovirus, Capillovirus, and Foveavirus (family Betaflexiviridae). PDO primer sets PDO-F1i/PDO-R3i/PDO-R4i and PDO-F2i/PDO-R1i (2) were used in the first RT-PCR and nested PCR, respectively. Total RNAs obtained from Italian Apple chlorotic leaf spot virus (ACLSV)-infected isolate and healthy peach leaves were used as positive and negative controls, respectively. A nested set of primers amplified a 362-bp product from 6 samples collected in 2011 (10.3%) and 13 samples collected in 2012 (27.7%). Sequence analysis included three isolates (367/11, 133/12, and 168/12) chosen from different peach cultivars (Ritastar, Spring Belle, and Redhaven, respectively). Amplified products of expected size of the partial RNA-dependent RNA polymerase from three positive samples were cloned into p-GEM-T Easy Vector (Promega, Madison, WI) and sequenced (MWG-Biotech AG, Germany). Sequences were deposited in GenBank under accession nos. KF534757, KF534769, and KF534766, respectively. BLAST analysis showed that the sequence of isolate 367/11 (KF534757) shared high nucleotide similarity (78.9 to 87.2%) with ACLSV isolates from GenBank, showing highest identity with isolate PBM1 (AJ243438) from Germany. Sequence analysis of isolate 133/12 (KF534769) proved that it is 90.5 to 93.3% identical to Cherry green ring mottle virus (CGRMV) isolates reported from other parts of the world. In particular, the highest nucleotide similarity was showed with isolate P1C124 (AJ291761) from France. Finally, analysis of sequence from the isolate 168/12 (KF534766) revealed high degree of identity (86.1 to 96.1%) with the corresponding nucleotide sequences of the Cherry necrotic rusty mottle virus (CNRMV) isolates, showing highest similarity with isolate 120/86 (AF237816) from Switzerland. To confirm virus infectivity, according to the FAO/IPGRI Technical Guidelines (1), budwood from 367/11, 133/12, and 168/12 samples were grafted into seedlings of peach (GF305), Prunus serrulata (cv. Shirofugen) and P. avium (cv. Sam) then maintained in a greenhouse with controlled conditions. Six months post inoculation, GF305 indexed with 367/11 sample reacts with a green depressed mottle on leaves typical of ACLSV infection. Cherry tree of cv. Shirofugen indexed with sample 133/12 showed symptoms attributable to CGRMV such as epinasty, twisting and curling of leaves while a tree of cv. Sam indexed with 168/12 sample exhibited classical necrotic shot holes in leaves induced by CNRMV infection (1). Sequence analysis of PCR products obtained from indicator plants by RT-PCR as described above showed full nucleotide identity with KF534757, KF534769, and KF534766 sequences and confirmed the presence of previous described viral agents. To our knowledge, this is the first report of ACLSV, CGRMV, and CNRMV occurrence on peach in Montenegro. Due to the economic importance of this crop, sanitation measures should be adopted to improve the control of imported plants and the use of virus-tested propagation material in order to prevent spreading of these viruses.

The genome sequences of three isolates of Apple chlorotic leaf spot virus from pear (Pyrus sp.) in China

Isolates of Apple chlorotic leaf spot virus (ACLSV) were collected from three species of pear (genus Pyrus) growing in Shandong and Hubei Provinces, China. The complete genome of one isolate (JB) and near-full-length genomes (30 nucleotides at 5′ end excluded) of two isolates (KMS and YH) were determined. These three isolates showed an overall nucleotide identity of 87.3–100%, and had the highest identity of 83.0% to an isolate MO-5 infecting apple in Japan and 74.9–75.8% identity to two recently reported ACLSV isolates from peach plants grown in China. The three ACLSV isolates from pear were mostly similar to ‘B6 type’ by having signature sites (S40-V59 or M59-Y75-T130-L184) in their coat protein. This is the first comparative study on the complete genomic sequences of ACLSV isolates infecting pear.

First Report of Apple Top Working Disease Caused by Viruses (Apple stem grooving virus, Apple chlorotic leaf spot virus, and Apple stem pitting virus) in Apple in India.

Top working of apple (Malus domestica Borkh.) trees of old, unproductive, and less preferred cultivars with the newly introduced spur type commercial cultivars has become a common practice with many growers in the northwestern Himalayan region of India. Typical viral symptoms of curling, puckering, and necrosis on leaves were observed with an incidence of 80% on Red Chief, Super Chief, Scarlet Spur, Schillet Spur, Washington Red Delicious, and many other newly introduced cultivars during surveys conducted in May and June 2009. Leaf samples from top worked trees were tested for the presence of Apple stem grooving virus (ASGV), Apple chlorotic leaf spot virus (ACLSV), and Apple stem pitting virus (ASPV) by employing biological detection (herbaceous and woody indicators), double antibody sandwich (DAS)-ELISA), and reverse transcriptase (RT)-PCR based detection. Mechanical transmission to herbaceous indicators produced chlorotic lesions on Chenopodium quinoa and C. amaranticolor, whereas marginal necrosis was induced on Phaseolous vulgaris within 9 to 21 days after sap inoculations. All three viruses, i.e., ASGV, ASPV, and ACLSV, were detected from these herbaceous indicators in DAS-ELISA (BIOREBA AG, Switzerland). Furthermore, symptoms similar to those observed in orchards were produced when the test budwood was inoculated onto the woody indicator (M. pumila 'Spy 227') plant by double grafting, grafting cum budding, and double budding methods within time periods ranging from 4 months in double grafting, 5 months in double budding, to 1 year 4 months in the grafting cum budding method. The presence of all three viruses was confirmed by DAS-ELISA again in Spy 227 woody indicator. PCR detection was carried out by using the coat protein gene specific primers (ASGV5641 [forward], ASGV6396 [reverse]; ACLSV6784 [forward], ACLSV7365 [reverse] [2]; ASP-C [sense], ASP-A [anti-sense] [1]) of all the viruses detected through ELISA. The amplified products were cloned, sequenced, and deposited in NCBI (GenBank Accessions KC110892 for ASGV, KC154859 for ASPV, and KC154862 for ACLSV). BLASTn analysis showed the ASGV isolate had 97 to 98% sequence identity with Indian (FM204881) and Brazilian (AF438409) ASGV isolates. The ASPV and ACLSV isolates had 98% and 99% sequence identity with Chinese (JF895517) and Japanese (AB326230) isolates, respectively. To the best of our knowledge, this is the first report of apple top working disease associated with ASGV, ASPV, and ACLSV infection in commercial cultivars of apple from India and seems to be a serious threat for growing virus-free healthy stocks in orchards. Top working disease in apple associated with ASGV, ASPV, and ACLSV viruses has been reported from Japan (3,4).

Molecular Characterization and Recombination Analysis of the Complete Genome of Apple Chlorotic Leaf Spot Virus

The complete nucleotide sequence of an Indian isolate of Apple chlorotic leaf spot virus (ACLSV) was determined and found to be 7,525 nt in length. The genome organization was similar to known isolates of ACLSV, encoding three ORFs. Comparisons indicated high sequence variability among known isolates with overall nucleotide sequence identities of 80 to 84%. A striking variable region was identified among the replicase protein upstream of the RNA-dependent RNA polymerase (aa 1510–1590), which showed a 41–43% match with the corresponding region in other isolates. Phylogenetic analysis at the nucleotide level clustered the isolates into three groups, without any relation to geographical origin. Recombination analysis showed that the isolate is a recombinant with recombination sites spread throughout the genome, especially in the polymerase gene region (nt 4700–5400). Most recombination sites were bordered by an upstream region (5′) of GC-rich and downstream region (3′) of AU-rich sequences of similar length. Correlation of recombination site with host type is discussed, and it was found that there were more interlineage recombinations in the apple host compared with intralineage recombinations.

Host‐range studies, genetic diversity and evolutionary relationships of ACLSV isolates from ornamental, wild and cultivated Rosaceous species

A large‐scale survey was carried out to study the host range and genetic diversity of Apple chlorotic leaf spot virus (ACLSV) in various Rosaceae species, with a special emphasis on ornamentals and wild shrubs. Samples were tested by DAS‐ELISA using two different antisera, and RT‐PCR amplification of part of the CP gene. There was generally a poor correlation between the results obtained with the two sets of serological reagents and between serological and molecular detection assays. Using a nested RT‐PCR assay developed here, ACLSV was found to be widespread among cultivated, ornamental and wild species of the Rosaceae. The virus was detected for the first time in plum, wild cherry, Crataegus monogyna, Prunus spinosa and Prunus cerasifera in Greece. Sequences of a part of the CP encoding gene and the 3′ untranslated region from ACLSV isolates originating from various wild species and ornamentals were compared to those of isolates from cultivated hosts, showing similar divergence levels. Further phylogenetic analysis using the sequenced region indicated that the isolates from wild or ornamental hosts were not more closely related to each other than to isolates from cultivated hosts. The possible role of different factors in the spread of ACLSV on cultivated, ornamental and wild species is discussed.

국내에서 발생하는 복숭아 바이러스병

국내에서 재배되는 복숭아에 발생하는 바이러스병을 조사하기 위하여 경북 영천 등 복숭아 주산단지 6개 지역에서 전체 시료 515점을 채집하여 5종(ACLSV, ApMV, PDV, PNRSV, PPV) 바이러스의 감염여부를 RT-PCR 방법을 이용하여 바이러스 검정을 실시하였다. RT-PCR 검정 결과 전체 시료 515점 중 335점의 시료에서 ACLSV와 PNRSV가 검출되어 검정한 시료의 65.0%가 바이러스에 감염된 것을 확인하였다. ACLSV가 검출된 복숭아나무는 잎에 모자이크 증상이 관찰되었으며 PNRSV가 검출된 복숭아나무는 별다른 이상증상이 관찰되지 않았다. 검출된 바이러스의 유전자 염기서열 분석으로 ACLSV 4개와 PNRSV 3개의 분리주들을 확인하였으며 ACLSV 분리주들 간에는 95% 이상, PNRSV는 88% 이상의 아미노산 서열 상동성을 나타냈다. 기존에 보고된 ACLSV 및 PNRSV 분리주들과의 아미노산 서열 비교에서는 ACLSV 분리주들의 경우 70-99%, PNRSV 분리주들의 경우 88-99%의 상동성을 보였다. 이들 바이러스 분리주들의 계통학적 분석에서 ACLSV 분리주들은 A, B 그룹 중 A그룹에, PNRSV 분리주들은 I (PV32), II (PV96), III (PE5) 그룹에 각각 하나씩 속하는 것으로 나타났다. To investigate the occurrence of viruses in peach, leaf samples were collected from peach trees in commercial orchard of six areas in Korea. Reverse transcription polymerase chain reaction (RT-PCR) was used to identify the presence of the following stone fruit viruses: Apple chlorotic leaf spot virus (ACLSV), Apple mosaic virus (ApMV), Prune dwarf virus (PDV), Prunus necrotic ringspot virus (PNRSV) and Plum pox virus (PPV). About 65.0% of the 515 samples were infected with ACLSV and PNRSV. Virus-like symptoms showing mosaic on leaves was observed in ACLSV infected peach trees. However, PNRSV infected peach trees showed no symptoms. These viral DNAs by sequence analysis were confirmed 4 ACLSV isolates and 3 PNRSV isolates. The Korean peach isolates of ACLSV and PNRSV showed 70-99% and 88-99% amino acid sequence identities, respectively, with those reported previously and their amino acid sequence identities with each other were approximately 95% and 88%, respectively. Phylogenetic analysis indicated that the Korean ACLSV isolates belong to the A group of ACLSV. The Korean PNRSV isolates reported in this study were grouped into I (PV32), II (PV96) and III (PE5) groups.

Studies on genome structure and function of fruit tree viruses

In this study, we investigated the complete nucleotide sequence and genome organization of Apple stem grooving virus (ASGV), Apple chlorotic leaf spot virus (ACLSV), Apple stem pitting virus (ASPV), which causes apple topworking disease in Japan, citrus tatter leaf virus, which causes citrus bud-union disorder, Grapevine berry inner necrosis virus (GINV) and Apple latent spherical virus (ALSV) to clarify their taxonomic positions. Sequence analysis of virus isolates also showed that ASGV, ASPV, and ACLSV isolates from fruit trees comprise at least two to four ‘‘sequence variants’’ that differ considerably from each other in nucleotide sequence. We also showed that P50 encoded by the ORF2 of ACLSV genome has multifunctional roles, i.e., it functions as a virus movement protein (MP), it acts as a suppressor of systemic silencing, and it interferes specifically with the functions of the MP encoded by GINV. We constructed infectious cDNA clones of ALSV-RNAs, which were modified into viral vectors for the expression of foreign genes in plants. ALSV vectors effectively induce reliable VIGS of endogenous genes among a broad range of plants including Rosaceae fruit trees. Using the ALSV vector expressing Flowering locus T (AtFT) gene from Arabidopsis thaliana (AtFTALSV), we established a system that promoted flowering time of apple seedlings within 2 months after germination and shortened the generation time from seed germination to next-generation seed maturation to within 7 months when pollen from precocious flowers was used for pollination.

落葉果樹ウイルスのゲノム構造と機能に関する研究

In this study, we investigated the complete nucleotide sequence and genome organization of Apple stem grooving virus (ASGV), Apple chlorotic leaf spot virus (ACLSV), Apple stem pitting virus (ASPV), which causes apple topworking disease in Japan, citrus tatter leaf virus, which causes citrus bud-union disorder, Grapevine berry inner necrosis virus (GINV) and Apple latent spherical virus (ALSV) to clarify their taxonomic positions. Sequence analysis of virus isolates also showed that ASGV, ASPV, and ACLSV isolates from fruit trees comprise at least two to four ‘‘sequence variants’’ that differ considerably from each other in nucleotide sequence. We also showed that P50 encoded by the ORF2 of ACLSV genome has multifunctional roles, i.e., it functions as a virus movement protein (MP), it acts as a suppressor of systemic silencing, and it interferes specifically with the functions of the MP encoded by GINV. We constructed infectious cDNA clones of ALSV-RNAs, which were modified into viral vectors for the expression of foreign genes in plants. ALSV vectors effectively induce reliable VIGS of endogenous genes among a broad range of plants including Rosaceae fruit trees. Using the ALSV vector expressing Flowering locus T (AtFT) gene from Arabidopsis thaliana (AtFTALSV), we established a system that promoted flowering time of apple seedlings within 2 months after germination and shortened the generation time from seed germination to next-generation seed maturation to within 7 months when pollen from precocious flowers was used for pollination.

Pome fruit viruses at the Canadian Clonal Genebank and molecular characterization of Apple chlorotic leaf spot virus isolates

A survey for apple and pear viruses was carried out at the Canadian Clonal Genebank (CCG), Harrow, Ontario, Canada, during the fall/winter of 2007 and spring of 2008. Leaves and/or dormant cuttings were randomly collected from 438 to 122 accessions of apple and pear, respectively. Samples were tested by Double Antibody Sandwich-Enzyme Linked Immunosorbent Assay (DAS-ELISA) for the presence of Apple chlorotic leaf spot virus (ACLSV), Apple stem pitting virus (ASPV), Apple stem grooving virus (ASGV) and Apple mosaic virus (ApMV). Infection rates for apples were ACLSV (48.1%), ASGV (10%), ASPV (6.6%) and ApMV (7.1%), and for pears ACLSV (42.6%). ACLSV was detected and characterization by multiplex RT-PCR with primers targeting a fragment of 677 bp corresponding to the partial coat protein (CP), movement protein (MP) and untranslated (3′UTR) region in 22 accessions of apple and pear. Multiplex RT-PCR showed a higher sensitivity over the ELISA test. The nucleotide and amino acid deduced partial CP identities ranged from 82.6–100% to 91–100%, respectively, while partial MP identities was 62.5–100% at aa level based on the amplified fragment appropriate for partial MP using a frame shift, among 22 ACLSV isolates. Phylogenetic analyses based on the partial CP region clustered CCG ACLSV isolates in two different groups, while those based on the partial MP region embraced CCG ACLSV isolates in two sub-clusters within the same group. This is the first report on the detection of ACLSV, ASPV, ASGV and ApMV at CCG, and the molecular characterization of ACLSV isolates in apple and pear plants from worldwide countries to deduce possible heterogeneity and evolution.

Sensitive PCR-based Detection of Apple Chlorotic Leaf Spot Virus Heterogeneous in Apple Trees

This paper presents a useful process for the detection of Apple chlorotic leaf spot virus (ACLSV) in apple trees. The 3'-terminal 1.8-kb genomic cDNAs of 15 ACLSV isolates, of which 11 induce a decline (of varying severity) in the condition of inoculated Malus prunifolia var. ringo rootstock and four do not, were amplified by reverse transcription (RT) coupled with polymerase chain reaction (PCR). Single-strand conformation polymorphism analysis of the cDNAs revealed that most of the isolates inducing the decline were composed of at least two to four sequence variants per apple tree, whereas isolates inducing no decline were occupied with a major type sequence. Direct sequencing of the cDNAs showed heterogeneity in the nucleotide sequence of the analyzed region; most of the variation in these positions appeared to specify the same amino acids upon translation of the 50K protein and capsid protein (CP). To detect all isolates, degenerate primers were designed with consideration of the sequence varieties of the viral genomes. RT-nested PCR and its improved methods have a 10 4 -fold higher sensitivity than conventional RT-PCR, and consistently amplify ACLSV genomic cDNA in RNA extracts from apple leaf and bark during growing and dormant seasons, respectively.

국내에서 발생하는 배나무 바이러스병

Three pome fruit viruses, Apple chlorotic leaf spot virus (ACLSV), Apple stem grooving virus (ASPV) and Apple stem pitting virus (ASGV) were detected in pear trees (Pyrus pyrifolia) using double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) in Ansung, Naju and Ulsan provinces of Korea. Infection rate of three viruses was 35.2% from 452 leaf samples of the three cultivars of pear trees. Also, each of three viruses was detected by reverse transcription polymerase chain reaction (RT-PCR) for a limited number of samples. Infection rate of three viruses was 86.3% from 233 leaf samples of the three pear cultivars. The virus infection rates by RT-PCR were much higher than ELISA. ASGV was prevailing on pear with 74.2%, whereas ASPV and ACLSV were found in 34.8% and 0.4% of tested samples, respectively. Symptoms caused by ASGV showed black spots of infected Niitaka cultivar leaves. The ACLSV, ASPV and ASGV isolates showed 83~94% sequence identity at a nucleotide level to other pome fruit virus isolates when analyzed by NCBI BLAST. Pome fruit viruses occurring in pear were ACLSV, ASPV and ASGV. This is the first report of pear trees infected ASPV in Korea.