AG-4 Isolates Research Articles

Genetic and pathogenic characterization of Rhizoctonia solani AG-4 isolates obtained from common bean

Common bean (Phaseolus vulgaris L.) is the most important grain legume. Crop production of common bean is affected by a number of diseases, such as Rhizoctonia root rot, being detected worldwide. Herein, we aimed to genetically and pathologically characterize Rhizoctonia solani isolates obtained from different provinces in Turkey. Anastomosis groups (AG) and subgroups of isolates were identified based on the sequence analysis of the rDNA-ITS region. The most prevalent subgroup was AG-4 HGIII, according to BLAST analysis and the phylogeny of resultant sequences, followed by AG-4 HGI and AG-4 HGII, respectively. iPBS retrotransposons highly supported the phylogenetic tree and provided a high level of genetic variability among isolates to discriminate AG subgroups. The results indicated that the iPBS DNA marker system based on retrotransposons could be used to discriminate Rhizoctonia isolates relying on AG grouping. The virulence of the pathogen isolates changed from 3.67 to 5 based on the agar-plate assay on the susceptible cv. Gina. The reactions of thirty common bean cultivars were also evaluated against the most aggressive isolate in each subgroup. The reaction assay showed significant differences among both isolates and cultivars; the highest disease severity among cultivars was observed to AG-4 HGI, followed by AG-4 HGIII and AG-4 HGII, respectively. None of the cultivars showed resistance to all AG subgroups. Screening of AGs among the isolates and selecting cultivars are critical to managing Rhizoctonia disease due to the range of host suitability according to AG subgroups.

Biological Activity of Four Trichoderma Species Confers Protection against Rhizoctonia solani, the Causal Agent of Cucumber Damping-Off and Root Rot Diseases

The cucumber (Cucumis sativa L.) is often subjected to several fungal diseases. Rhizoctonia solani-induced cucumber damping-off and root rot are the most common diseases reported from the commercial greenhouses of the eastern area of Saudi Arabia. The objective of the current study is to explore the antagonistic activity of four Trichoderma species against R. solani in vitro and in vivo. Ten R. solani isolates (eight belonging to AG-4 and two belonging to AG-A and AG2-1) were studied. AG4 isolates were pathogenic to cucumber plants, while AG-A and AG2-1 isolates were non-pathogenic. Seven isolates of Trichoderma spp., named T. hamatum KSATR8, T. harzianum (KSATR9 and KSATR10), T. asperellum (KSATR11, KSATC, and KSAT1E), and T. longibrachiatum KSATS were isolated, and the identities of both R. solani and Trichoderma isolates were confirmed based on the phylogenetic analysis of the DNA sequence of the ITS region. The dual culture findings indicated that T. asperellum KSATC and KSAT1E exhibited the most significant inhibitory activities against R. solani, with values of 79.33 and 70.89%, respectively. Scanning electron microscope (SEM) images showed a considerable degradation in the cell wall and collapsing of R. solani hyphae by all Trichoderma species. Under greenhouse conditions, the application of T. asperellum KSATC and KSAT1E at concentrations of 2 × 108 conidia/mL revealed a reduction in root rot and damping-off incidence percentages with values that did not reveal a significant (p < 0.05) difference from those of Rizolex-T fungicide. Nevertheless, the efficacy of the fungicide attained 86.67%, being higher than that of T. asperellum KSATC, which reached 80%. Trichoderma asperellum KSATC and KSAT1E were the greatest in increasing peroxidase, catalase, and chitinase enzymes activities in cucumber plants. Conversely, a significant (p < 0.05) elevation in polyphenol oxidase enzyme (0.762 and 0.97 U/g FW) and total phenol content (0.55 and 0.62 mg/g FW) was recorded in cucumber plants treated with T. harzianum KSATR9 and KSATR10, respectively. The statistical analysis results displayed no considerable variations among cucumber plants regarding total chlorophyll content as a response to treatments with Trichoderma species and fungicides. Therefore, we endorse using T. asperellum KSATC and KSAT1E as an alternative to fungicides to manage root rot and damping-off in cucumbers.

Molecular Mechanisms Associated with the Resistance of Rhizoctonia solani AG-4 Isolates to the Succinate Dehydrogenase Inhibitor Thifluzamide

Thifluzamide, a succinate dehydrogenase (SDH) inhibitor, possesses high activity against Rhizoctonia. In this study, 144 Rhizoctonia solani AG-4 (4HGI, 4HGII, and 4HGIII) isolates, the predominate pathogen associated with sugar beet seedling damping-off, were demonstrated to be sensitive to thifluzamide with a calculated mean median effective concentration of 0.0682 ± 0.0025 μg/ml. Thifluzamide-resistant isolates were generated using fungicide-amended media, resulting in four AG-4HGI isolates and eight AG-4HGII isolates with stable resistance and almost no loss in fitness. Evaluation of cross-resistance of the 12 thifluzamide-resistant isolates and their corresponding parental-sensitive isolates revealed a moderately positive correlation between thifluzamide resistance and the level of resistance to eight other fungicides from three groups, the exception being fludioxonil. An active efflux of fungicide through ATP-binding cassette and major facilitator superfamily transporters was found to be correlated to the resistance of R. solani AG-4HGII isolates to thifluzamide based on RNA-sequencing and quantitative reverse transcription-PCR analyses. Sequence analysis of sdhA, sdhB, sdhC, and sdhD revealed replacement of isoleucine by phenylalanine at position 61 in SDHC in 9 of the 12 generated thifluzamide-resistant isolates. No other mutations were found in any of the other genes. Collectively, the data indicate that the active efflux of fungicide and a point mutation in sdhC may contribute to the resistance of R. solani AG-4HGI and AG-4HGII isolates to thifluzamide invitro. This is the first characterization of the potential molecular mechanism associated with the resistance of R. solani AG-4 isolates to thifluzamide and provides practical guidance for the use of this fungicide.

First report of Black Scurf caused by Rhizoctonia solani AG-3 on potato tubers in Mauritius.

Potato (Solanum tuberosum L.) is considered as one of the most economically important non-sugar food crops in Mauritius, with annual production of over 14,000 tonnes (Statistics Mauritius 2018). In September 2019, in a seed potato field located in St Pierre, approximately 10% of tubers showed the presence of numerous irregular-shaped black scurf lesions on the surface. After surface sterilization of tubers with 70% alcohol, the presumed sclerotia were directly transferred to chloramphenicol amended Potato Dextrose Agar (PDA) and incubated for 5 days at 25oC in the dark. From all sampled tubers, only fast-growing, pale brown Rhizoctonia - like colonies grew, from which hyphal-tip isolates with uniform morphology were obtained. Following staining with aniline blue using the clean slide technique, cells of the isolate were observed to be multinucleate, with typical characteristics of Rhizoctonia solani AG-3 including hyphal branching at right angles, slight constriction and septum near the branch base, presence of typical monilioid cells and formation of light-brown irregular-shaped sclerotia of average size 2 mm (Tsror 2010). Identification was further conducted by sequencing of ITS rDNA region. Total DNA was extracted directly from mycelium using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. PCR amplification and sequencing were performed with primers ITS1-F (5'-CTTGGTCATTTAGAGGAAGTAA-3') (Gardes and Bruns 1993) and ITS-4 (5'-TCCTCCGCTTATTGATATGC-3') (White et al. 1990). The nucleotide sequence of the representative isolate 448G-19/M (Accession No. MT523021) was compared with those available in GenBank and shared 99-100% identity with over 20 R. solani AG-3 isolates (100% with isolate 16-107, Salamone and Okubara 2020). Therefore, based on the morphological characteristics and sequence homology, the isolate was identified as R. solani AG-3. Koch's postulates were confirmed for the isolate by carrying out the pathogenicity tests. Twenty healthy, unwounded tubers were disinfected for 1 min with 50% commercial bleach (2% NaOCl) and individually placed in pots (20 cm ø) containing sterile substrate. Ten tubers were inoculated by placing colony fragments of 7 day-old cultures of isolate 448G-19/M near each tuber during planting. Similarly, 10 tubers inoculated with sterile PDA served as negative control. Plants were maintained in a greenhouse, watered daily and assessed for the presence of symptoms 60 days post emergence. All inoculated plants exhibited partial root necrosis while progeny tubers showed black scurf due to presence of sclerotia. Control plants remained symptomless. From all symptomatic tubers, the original isolate was successfully recovered and identified by the morphological and molecular characteristics mentioned above, thus fulfilling Koch's postulates. Although occurrence of potato black scurf had previously been observed in Mauritius (Anonymous 1927), to the best of our knowledge, this the first report confirming R. solani AG-3 as causal agent of black scurf on seed tubers in Mauritius. Early detection of R. solani AG-3 during potato seed production is necessary to prevent its dispersal via infected tubers to other fields around the island. This research is significant as it will contribute to the body of knowledge on potato pathology in Mauritius and at the same time assist in reducing losses associated with this important crop.

Characterization of a new subgroup of Rhizoctonia solani anastomosis group 3 (AG-3 TM) associated with tomato leaf blight

Ten Rhizoctonia solani AG-3 isolates obtained from blighted tomato leaves [nine isolates, collected from three regions of Japan (Akita, Okayama, and Fukushima) and the United States] and from soil (one isolate, collected from Australia) were examined for sequence variations in the rDNA-ITS, rDNA-IGS1 regions, and tef-1α gene. Three loci of 16 AG-3 PT (potato type) and eight AG-3 TB (tobacco type) isolates were also sequenced to evaluate genetic relationships with these 10 isolates. In the sequence comparisons of these loci, all 10 AG-3 isolates shared high sequence similarity (99.4–100% for rDNA-ITS, 99.1–100% for rDNA-IGS1, and 98.2–100% for tef-1α) to each other, but a comparatively low similarity (95.4–98.8% for rDNA-ITS, 94.7–98.3% for rDNA-IGS1, and 93.5–97.2% for tef-1α) to AG-3 PT and AG-3 TB isolates. The 10 AG-3 isolates were genetically closer to AG-3 PT than to AG-3 TB on the basis of rDNA-ITS and tef-1α. A phylogenetic tree based on these three loci indicated that the 10 isolates form a new clade separated from AG-3 PT and TB populations. These results indicate that the 10 isolates from tomato and soil represent a new subgroup distinct from AG-3 PT and TB. New subgroup AG-3 TM (tomato type) is proposed. This study is the first report on the phylogenetic analysis of R. solani isolates based on the combined data from the rDNA-ITS, rDNA-IGS1 regions, and tef-1α gene.

Identification and pathogenicity of Rhizoctonia solani AG-4 causing root rot on chickpea in Turkey

In the 2016-17 growing seasons, surveys were conducted in the Isparta, Uşak, Kütahya and Denizli provinces of Turkey to identify the Rhizoctonia solani AG-4 associated with root and crown rot of chickpea. A total of 75 isolates of Rhizoctonia were obtained from surveyed areas. Visual diagnostic, isolation and microscopic observation identified the causal organism as R. solani. Sequence data of the ITS rDNA region confirmed the species identity and revealed that the anastomosis group of the 23 isolates were AG-4 HGII. The isolates were variable in their morphological characters. The sequences generated during this study were clustered in the same branch with the reference isolates of R. solani AG-4 HGII based on their ITS sequencing on chickpea and the isolate grouping was not related to their geographic origins or virulence pattern. Pathogenicity tests revealed that all AG-4 isolates were pathogenic on chickpea and the disease severity values of 23 isolates varied between 42.8% and 100%. Based on the virulence, the isolates were grouped into two categories: 5 of them exhibited moderately virulence and 18 of them exhibited highly virulence reaction on chickpea. The high virulent isolate level (>50% disease severity) was determined as 78.2% of all 23 isolates. This is the first report of R. solani AG-4 as a pathogen of chickpea in Turkey.

Use of antigenic composition to differentiate among Rhizoctonia solani isolates from flax

Rhizoctonia solani is an plant pathogenic fungus with a wide host range and worldwide distribution. Double diffusion technique was used to differentiate among Rhizoctonia solani isolates from flax. In this technique, antisera of isolate 23 (AG-2) and isolate 24 (AG-4) reacted against antigens of 24 isolates belonging to AG-2 and Ag-4. The antiserum of isolate 23 (AG-2) was insensitive to differentiate among the isolates of AG-2, while it was highly sensitive to differentiate among some isolates of AG-4. The antiserum of isolate 24 (AG-4) was highly sensitive as a serotaxonomic tool to differentiate among AG-2 and AG-4, while it was of limited value in differentiating among isolates of within each AG.

Anastomosis group and pathogenicity of Rhizoctonia spp. associated with seedling damping-off of sugar beet in China

Between 2010 and 2015, 204 Rhizoctonia isolates were obtained from diseased sugar beet seedlings which collected from the sugar beet growing regions of China. On the basis of the morphological characteristics and sequence analysis of the internal transcribed spacers of the ribosomal DNA (rDNA ITS), 166 were identified as multinucleate Rhizoctonia (MNR), and 38 were binucleate Rhizoctonia (BNR), belonging to 15 species, anastomosis groups (AGs) or subgroups. The most prevalent was Rhizoctonia solani AG-4, with 49 isolates attributed to the subgroup HGIII, 47 to HGII, and 45 to HGI, followed by AG-K (31), AG-2-2IIIB (7), AG-A (6), AG-1-1C (4), AG-1-1B (3), AG-2-1 (3), AG-5 (3), AG-11 (2), AG-3 TB (1), Waitea circinata var. circinata (1), W. circinata var. zeae (1), and AG-C (1). Seventy-four representative isolates of all species, AGs or subgroups from different geographic origins were able to cause brown, dry lesions on roots of sugar beet seedlings or even seedling death with the disease incidence and the disease index ranging from 13.3 to 100% and from 1.9 to 97.1, respectively. The AG-4 isolates were the most aggressive on sugar beet seedlings. Moreover, the aggressiveness of the R. solani isolates was higher than that of the other isolates. To the best of our knowledge, this is the first detailed description of the AG composition of Rhizoctonia causing seedling damping-off on sugar beet in China.

First Report of Damping-Off on Seedlings of Coffee Caused by Rhizoctonia solani AG-4 HG I, AG-1 IB and Binucleate Rhizoctonia AG-A in China

During July 2016, damping-off of coffee (Coffea arabica L.) was observed in a coffee nursery field (∼1 ha) from Baoshan, Yunnan Province, China. More than 10% of the seedlings showed symptoms of the disease. Symptoms on newly emerged plants consisted of wilting, brown necrosis of the lower taproot, and eventual death of the seedlings. Detached infected stems of 30 coffee seedlings with damping-off were placed on water agar after surface disinfection. These stems were soaked in 75% alcohol for 1 min, then soaked in 3% sodium hypochlorite for 3 to 5 mins, and finally rinsed three times with sterile water. After culturing at 28°C for 2 days, the mycelia that had grown around the stems were transferred to potato dextrose agar (PDA) for 7 days at 28°C in the dark to obtain the isolates. Out of the 20 isolates of Rhizoctonia spp. isolated from coffee with damping-off symptoms, 16 were Rhizoctonia solani, which included 10 and six isolates that anastomosed with the tester isolates of AG-4 and AG-1, respectively. After 14 days, cultures were olive buff, producing olive-brown or white-gray sclerotia in the outer part of the disc on PDA. The other four isolates that anastomosed with the tester isolates of AG-A were binucleate Rhizoctonia spp. (BNR) isolates with white mycelia and floccose aerial hyphae on PDA. All isolates anastomosed with their corresponding tester isolates producing a C2 hyphal reaction separately (Carling 1996). The 5.8S rDNA-ITS of a single isolate from each AG of R. solani and a single isolate of BNR were sequenced. The genomic DNA of the isolates were extracted with chelex-100 method. The primers used for amplification and sequencing were ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCCGCTTATTGATATGC). The sequence of the AG-4 isolate (GenBank accession no. MF288588) exhibited 100% homology with the isolate of R. solani AG-4, subgroup HG I (AY154307). The sequence from the AG-A isolate (MF288589) showed 99% homology with BNR AG-A (AB196663 and AB196640). A BLAST search of obtained sequences (MF288587) revealed the isolates that shared the highest nucleotide sequence identity (99%) with those of other AG1-IB isolates available in GenBank. Coffee seedlings (cv. Typica) (∼10 cm high) were planted in potting soil at a density of one seedling per vinyl pot (8 cm diameter, 9 cm high). Three isolates of each AG of R. solani and BNR were used in pathogenicity test. Healthy coffee seedlings were separately inoculated at the stem base with plugs of three different isolates after they had grown for 2 days on PDA, while control plants were inoculated with plugs of sterile PDA. The inoculated plugs were covered with moist cotton batting to avoid drying out, and all plants were placed in a illuminated incubator with 100% RH at 30°C, 16 h day and ∼15°C, 8 h night. The experiments were conducted three times, each time with three replicates. At 7 days after inoculation, coffee plants showed similar symptoms to naturally infected plants while the control plants were still healthy. The most virulent strain was AG-4 HG I, causing lesions >1 cm, and the second virulent strain was AG-1IB causing lesions <1 cm, while the least pathogenic was AG-A, which caused a few brown or black speck lesions on the stem. Reisolations were carried out and confirmed the presence of R. solani or BNR AG-A from the diseased plants. AG-4 has been reported to infect coffee seedlings in Portugal (Sussel et al. 2001), while diseases of coffee caused by AG-1 IB and AG-A has not been reported. However, R. solani AG-1-ID has been reported to cause necrotic leaf spot on coffee in the Philippines (Priyatmojo et al. 2001). R. solani AG-4 HG II caused damping-off in coffee seedlings in Brazil (Kuramae et al. 2000). HG II and HG I were different subgroups of R. solani AG 4. To our knowledge, this is the first report of damping-off of coffee caused by R. solani isolates belonging to AG-4 HG I and AG-1 IB, and by BNR isolates belonging to AG-A.

Identification and Characterization of Rhizoctonia Species Associated with Soybean Seedling Disease.

In an effort to identify the Rhizoctonia spp. associated with seedling diseases of soybean, Rhizoctonia isolates were recovered from soybean seedlings with damping off and root and hypocotyl rot symptoms from Arkansas, Illinois, Kansas, Michigan, Minnesota, and the Canadian province of Ontario between 2012 and 2014. Based on cultural morphology, polymerase chain reaction restriction fragment length polymorphism, and phylogenetic analysis of the internal transcribed spacer (ITS) region of the ribosomal RNA genes, 80 isolates were confirmed to be Rhizoctonia solani, 24 were binucleate Rhizoctonia spp., and 10 were R. zeae. Of the 80 R. solani isolates, one belonged to anastomosis group (AG) 2-1, 52 belonged to AG-2-2IIIB, five belonged to AG-3 PT, three belonged to AG-4 HGI, two belonged to AG-4 HGIII, nine belonged to AG-7, and eight belonged to AG-11. Bayesian inference of phylogeny using the ITS region revealed two clades of R. solani AG-7 that possibly correspond to different AG-7 subgroups. Phylogenetic analysis also provided evidence for genetic relatedness between certain binucleate Rhizoctonia and some R. solani isolates. On 'Williams 82' soybean, isolates of AG-2-2IIIB were the most aggressive, followed by isolates of AG-7, AG-4, and AG-11. On 'Jubilee', a sweet corn cultivar, AG-2-2IIIB and AG-4 isolates caused significant stunting and root damage, whereas the damage caused by the AG-11 isolates was mostly restricted to the mesocotyl. Isolates of R. zeae and the binucleate Rhizoctonia spp. were not pathogenic on soybean or corn. Our results indicate that soybean and corn are hosts to the predominant and aggressive AG of R. solani, implying that rotation between these two crops may not be an effective management practice.

Anastomosis Group and Pathogenicity of Rhizoctonia solani Associated with Stem Canker and Black Scurf of Potato in Heilongjiang Province of China

From 2012 to 2015, a total of 226 isolates of Rhizoctonia solani were collected from the stem cankers on potato stems and sclerotia on tubers from different potato cultivation areas of Heilongjiang Province, China. These isolates were assigned to the anastomosis group (AG) by performing conventional PCR assays using previously published primers for ITS-rDNA regions, as well as by observing hyphal interactions where appropriate. Most of the isolates were assigned to AG-3PT (58.85 %), and several were assigned to AG-5 (21.68 %), AG-2-1 (7.08 %) and AG-4 (12.39 %). Pathogenicity tests showed that the AG-3 and AG-5 isolates had the highest virulence, and the disease indices were 1.96a and 2.47a for stem and 1.48a and 1.6a for root (P < 0.05) after analyzed by LSD multiple comparisons, respectively. Both two isolates consistently caused large brown lesions with sunken on the potato stems and roots in in vitro and greenhouse experiments. This is the first detailed report on the AG composition, variability and pathogenicity of R. solani isolates associated with stem cankers and black scurf found on potatoes cultivated in Heilongjiang Province.

Characterization and pathogenicity of Rhizoctonia SPP. isolated from vegetable crops grown in greenhouses in Samsun province, Turkey

A total of one hundred and five isolates of Rhizoctonia belonging to 7 anastomosis groups (AGs) were obtained from the diseased roots and rhizosphere soils of bean, cucumber, eggplant, pepper and tomato plants grown in greenhouses in Samsun province (Black Sea region, Turkey) during the period 2011–2012. The isolates of Rhizoctonia spp. were examined for their cultural characteristics, anastomosis groups and pathogenicity. Of these, 83.8% were multinucleate Rhizoctonia solani (AG-2, AG-4, AG-5 and AG-6) and 16.2% were binucleate Rhizoctonia (AG-A, AG-E and AG-F). Sixty five of the isolates belonged to AG-4 which was the most frequent group (61.9%) in all greenhouses surveyed. Numbers of the isolates belonging to AG-2 (7.6%), AG-5 (6.7%) and AG-6 (7.6%) were 8, 7 and 8, respectively. Seventeen isolates recovered from greenhouses surveyed were identified as binucleate Rhizoctonia AG-A (1.9%), AG-E (6.7%) and AG-F (7.6%). All isolates of Rhizoctonia spp. tested for growth rates grew at temperatures of 10, 15, 20, 25 and 30°C, whereas they were completely inhibited at 5°C. The results of pathogenicity tests showed that the differences in virulence among isolates of Rhizoctonia spp. were statistically significant ( P < 0.001). The tests on bean seedlings showed that the highest disease severity was caused by AG-4 isolates. The disease severity index (DSI) of the R. solani AG-4 isolates ranged from 3.2 to 3.8. In addition, the isolates of three AGs belonging to binucleate Rhizoctonia spp. were generally found to be moderately virulent (DSI 2.0–2.4).

Characterization of Rhizoctonia solani Associated with Black Scurf in Cyprus.

During 2011, 96 sclerotial isolates of Rhizoctonia solani were collected from potato tubers from all main potato-cultivating regions of Cyprus. All isolates were found to be multinucleate. Characterization of anastomosis groups (AG) based on hyphal anastomosis reactions showed that 91 isolates belonged to AG3 and 5 to AG4. Sequence analysis of the internal transcribed spacer (ITS) regions (ITS1 and ITS2) of ribosomal DNA (rDNA) of 68 isolates confirmed the prevalence of AG3. In addition, phylogenetic analysis found that AG3 isolates were of the potato type, distinctly separated from the AG3 tobacco type, while AG4 isolates were separated into two different subgroups (HGI and HGII). Temperature studies showed that isolates belonging to both AG4 subgroups had significantly higher optimum growth temperatures compared with AG3. In vitro sensitivities to the fungicide pencycuron, in terms of concentrations where 50% growth inhibition was observed, ranged from 0.012 to 0.222 μg/ml. Pathogenicity and aggressiveness of the isolates was determined on 'Annabelle' potato sprouts and seedlings of a number of selected hosts, based on crop rotations followed in Cyprus. The majority of the isolates were pathogenic to potato sprouts, with disease severity (DS) values ranging from 0 to 88%. Mean DS values were statistically different among AG and subgroups, with AG4-HGI (69.25%) and AG4-HGII (3.12%) being the most and least aggressive, respectively. However, AG4-HGII isolates were the most aggressive in all rotational hosts tested, while AG3 isolates were the least aggressive. More specifically, the highest DS levels by AG4-HGI were recorded to barley, by AG4-HGII to lettuce and melon, and by AG3 isolates to vetch. This is the first comprehensive study to elucidate the AG composition, pathogenicity and other biological aspects of R. solani isolates associated with potato black scurf in Cyprus.

Some characteristic of Rhizoctonia spp. in sharp eyespot of wheat

Isolates of &lt;i&gt;Rhizttctonia&lt;/i&gt; sp. with multinucleate and binucleate cells were obtained from sharp eyespot lesions on wheat culms in Olsztyn region. (NE Poland). These isolates were compared to isolates of AG-4 and GAG-1 testers with reference to cultural morphology of colony, growth rate, hyphal anastomosis and pathogenicity to wheat seedlings. The wheat binucleate isolates were similar in morphology of colonies and anastomosed with the &lt;i&gt;Ceratubasidium&lt;/i&gt; anastomosis group GAG-1 tester isolates of &lt;i&gt;R. cerealis&lt;/i&gt;. Growth rates on PDA ranged from 9 to 11 mm/24h for wheat isolates and from l to 11 mm/24 h for tester isolates GAG-1 of &lt;i&gt;R. cerealis&lt;/i&gt;. The wheat multinucleate isolates were similar in morphology of colonies and anastomosed with &lt;i&gt;Rhizoctonia solani&lt;/i&gt; Kühn group AG-4 tester isolate. &lt;i&gt;R. solani&lt;/i&gt; AG-4 isolates were morphologically distinct from the &lt;i&gt;R. cerealis&lt;/i&gt; isolates. These isolates on PDA were dark and grow rapidly (20-30 mm diam./24 h/20°C) and significantly contrasted with slowly growing white-creamy isolates of &lt;i&gt;R. cerealis&lt;/i&gt; (GAG-1). Isolates of &lt;i&gt;R. solani&lt;/i&gt; (AG-4) and &lt;i&gt;R. cerealis&lt;/i&gt; (GAG-I) developed sharp eyespot lesions on culms and white head symptoms typical of the disease. None of the wheat isolates of &lt;i&gt;R. cerealis&lt;/i&gt; (GAG-I) caused root-rot on wheat seedlings. In the present work the classification system of vegetative groups of &lt;i&gt;Rhizoctonia&lt;/i&gt; spp. in present work is also discussed.

Rhizoctonia cerealis anastomosis group GAG-1, the common pathogen of wheat, barley and sugar beet

Isuluies of &lt;i&gt;Rhizoctonia cerealis&lt;/i&gt; anastomosis group GAG-1 were obtained from sharp eyespot lesions on wheat and on barley culms and from diseased sugar beet seedlings. Isolates of &lt;i&gt;R. cerealis&lt;/i&gt; were collected from a fields with crop rotation experiments: sugar beet-spring wheat-winter barley. In pathogenicity tests isolates of &lt;i&gt;R. cerealis&lt;/i&gt; from sugar beet seedlings and from sharp eyespot lesions on wheat and barley were pathogenic to these crops. Isolates of &lt;i&gt;R. cerealis&lt;/i&gt; from sharp eyespot lesions on wheat and barley caused severe damping-ofTof sugar beet. Isolates of &lt;i&gt;R. cerealis&lt;/i&gt; from sugar beet seedlings also caused symptoms of sharp eyespot on wheat and barley. None of the wheat and barley isolates of &lt;i&gt;R. cerealis&lt;/i&gt; tested caused root-rot on wheat or barley seedlings. Isolates of &lt;i&gt;R. cerealis&lt;/i&gt; obtained from diseased plants of wheat, barley and sugar beet were similar in morphology of cultures and anastomosed with GAG-1 tester isolate. The relatinoship between anastomosis. colony characters, growth rate, hyphal diameter and pathogenicity of AG-4. AG-2-2 and AG-5 isolates obtained together with &lt;i&gt;R. cerealis&lt;/i&gt; from diseased plants were also investigated.

English

The interaction of binucleate Rhizoctonia (BNR) anastomosis group (AG)-A isolate W7, Rhizoctonia solani AG-4 and cucumber seedlings were investigated to elucidate the mechanism of biocontrol of Rhizoctonia solani by BNR. Hypocotyls of Cucumis sativus L. cv. Jibai were inoculated with a virulent isolate of R. solani AG-4 isolate C4 and examined with light microscopy and scanning and transmission electron microscopy. The hyphae of the virulent isolate colonized the outer surface of the hypocotyl and penetrated the epidermal and cortical cells to the pith of hypocotyls. The hyphae of a non-pathogenic species of BNR isolate W7 did not penetrate the cortical cells but instead colonized the outer epidermal cells 12 h after inoculation. Accumulation of mucilage occurred on the surface after dense colonization of the hypocotyls surface by the BNR. Observation of the hypocotyls surface pre-inoculated with BNR and challenged inoculated with R. solani showed constricted and deformed hyphae of R. solani , which were prevented to penetrate the epidermal cells. Pre-inoculating of BNR isolate caused profused formation of the mucilage which lysed BNR hyphae and restricted the growth of R. solani . The mucilage was identified as pectic substances. Analysis of pectin contents from dried hypocotyls tissues showed highly methylated pectin with low uronic acid contents in the seedlings inoculated with R. solani and unprotected by BNR while BNR- treated seedlings showed less methylated pectin and high amount of uronic acid. Furthermore, the BNR-inoculated seedlings showed significant ( P = 0.05) increase in calcium, indicating high amount of wall-bound cations in cell walls. Pectic substances accumulation and increased calcium in the cucumber tissues greatly contributed in the protection of cucumber seedlings against Rhizoctonia damping off by a non-pathogenic species of Rhizoctonia. Keywords: Rhizoctonia solani , binucleate Rhizoctonia , cucumber, biological control African Journal of Biotechnology , Vol. 13(5), pp. 640-650, 29 January, 2014

Differential interaction between isolates of Rhizoctonia solani AG-3 and potato cultivars

Twenty fungal isolates of Rhizoctonia solani AG-3 sclerotia were isolated from diseased potato tuber samples that were obtained from potato-producing areas in the Lower Egyptian governorates. The pathogenicity of the 20 isolates of R. solani AG-3 was tested on nine potato cultivars under greenhouse conditions. The black scurf disease incidence (BSDI) and stem canker index (SCI) were used as the criteria to evaluate the pathogenicity. An analysis of variance (ANOVA) showed that the isolate, cultivar and interaction between isolate and cultivar were very highly significant sources of variation for all the tested parameters. The statistical significance between the isolate and cultivar suggests that a physiological specialization exists among the R. solani AG-3 isolates that cause pathogenicity in potato. Additionally, the pathogenicity of the tested isolates was found to result from a combination of virulence and aggressiveness, and the isolates significantly differ for both types of pathogenicity. Similarly, the resistance of the tested cultivars was a mixture of both vertical and horizontal resistance, and there were significant differences among the cultivars for each type of resistance. A cluster analysis (isolates) of all of the tested parameters differentiated the isolates into four groups based on their virulence patterns in the nine potato cultivars, but there was no relationship among these groups and their geographical origin. The cluster analysis for the cultivars using all of the tested parameters differentiated the three groups based on the cultivar’s reaction pattern to the twenty R. solani AG-3 isolates. Key words: Potato, cultivars, Rhizoctonia solani, pathogenicity, cluster analysis

TEMPERATURE EFFECT ON &lt;i&gt;RHIZOCTONIA SOLANI&lt;/i&gt; ANALYZED BY MICROCALORIMETRY

Temperature is one of the factors playing an important role in fungi growth and spread. The aim of this study was to determine the effect of temperature on the growth of ten Rhizoctonia solani isolates. Colony Growth Rate (GR) was measured in potato-agar-dextrose cultures and Metabolic Efficiency (ME) by isothermal microcalorimetry in R. solani isolates growing in a temperature range of 10 to 40°C at 5°C intervals. The apparent activation Energy (Ea) was determined in the range of 15 to 30°C. Different values of Ea were found for each of the strains analyzed. GR increased as temperature increased up to 30°C, showing the highest values between 25°C. ME decreased as temperature increased in nine out of ten isolates, reaching an optimum for the different isolates between 15 and 25°C. Both GR and ME analyses showed different behaviors for each isolate. R. solani AG4 isolates showed a variable response to the same temperature of exposure and it appears that microcalorimetry is more sensitive in detecting early effects of heat stress.

First Report of Potato Stem Canker Caused by Rhizoctonia solani AG-5 in China.

Potato (Solanum tuberosum L.) is grown worldwide as a major food crop. Potato stem canker is an important disease mainly caused by Rhizoctonia solani AG-3 (4). In 2011, samples of potato stem canker were collected from 26 sites in Heilongjiang Province, northeast China. Stem fragments taken from the margins of the healthy and diseased tissues were surface disinfected with 0.5% NaOCl for 2 min, rinsed with sterile water, then placed on potato dextrose agar (PDA) at 25°C in the dark. Twenty-two fungal isolates taken from single hyphal tips were identified as R. solani based on morphological traits. Colonies were light brown with abundant growth of mycelia and produced brown, irregular sclerotia after 20 days on PDA. Mycelium was branched at right angles with a septum near the branch and a slight constriction at the branch base. Hyphal cells were determined to be multinucleate (five to 13 nuclei per cell) when stained with 4'-6-diamidino-2-phenylindole (DAPI). Anastomosis groups were determined by pairing with reference strains (kindly provided by N. Kondo, Hokkaido University, Japan) (1), and six out of 22 isolates anastomosed with R. solani AG-5. The internal transcribed spacer (ITS) region of rDNA was amplified from genomic DNA of the AG-5 isolates with primers ITS1 and ITS4. The ITS sequences (GenBank Accession Nos. JQ946291 to JQ946296) were 99% identical to R. solani isolate AG-5 ND1 (GenBank Accession No. HQ629863). Therefore, based on molecular characteristics and the anastomosis assay, these six isolates were confirmed to be R. solani AG-5. To determine the pathogenicity of R. solani AG-5 isolates, potato seed tubers (cv. Favorita) with 3- to 5-mm sprouts were inoculated with wheat seeds (sterilized by autoclaving twice at 121°C for 1 h with a 24-h interval) colonized with each isolate (2). Wheat seeds were placed 10 mm above the uppermost sprout tip (one seed per sprout). Plants were incubated in glasshouse conditions maintained at 25 to 27°C. After 3 weeks, all inoculated plants showed symptoms of potato stem canker disease, whereas control plants inoculated with sterilized wheat seeds remained healthy. R. solani AG-5 was consistently reisolated from symptomatic stems, and the identity was confirmed by morphological and molecular characteristics as previously described, fulfilling Koch's postulates. Potato stem canker caused by R. solani AG-5 was previously detected in Australia, South Africa, Finland, and Japan (3). However, to our knowledge, this is the first report of R. solani AG-5 on potato in China. Besides previously reported AGs 1, 3, and 4 implicated in Rhizoctonia disease in China, AG 5 should also be taken into account when designing programs for disease management in potato.

First Report of Crown and Root Rot Caused by Rhizoctonia solani AG-4 on Banana Passionflower (Passiflora mollissima) in Italy.

The genus Passiflora (Passifloraceae family) contains more than 500 species and several hybrids. In Italy, some of these species and hybrids are grown as ornamental evergreen vines or shrubs. During August and September 2010, a crown and root rot was observed in a stock of approximately 6,000 potted 2-year-old plants of Passiflora mollissima (Kunth) Bailey, commonly known as the banana passionflower, in a nursery located in eastern Sicily (southern Italy). Disease incidence was approximately 20%. Disease symptoms consisted of water-soaked lesions at the crown and a root rot. Successively, older crown lesions turned light brown to brown and expanded to girdle the stem. As crown and root rot progressed, basal leaves turned yellow and gradually became necrotic and infected plants wilted and died. A fungus with mycelial and morphological characteristics of Rhizoctonia solani Kühn was consistently isolated from crown lesions and brown decaying roots when plated on potato dextrose agar (PDA) amended with streptomycin sulfate at 100 μg/ml. Fungal colonies were initially white, turned brown with age, and produced irregularly shaped, brown sclerotia. Mycelium was branched at right angles with a septum near the branch with a slight constriction at the branch base. Hyphal cells removed from 10 representative cultures grown at 25°C on 2% water agar were determined to be multinucleate when stained with 1% safranin O and 3% KOH solution (1) and examined at ×400. Anastomosis groups were determined by pairing isolates on 2% water agar in petri plates (4). Pairings were made with tester strains of AG-1, AG-2, AG-3, AG-4, AG-5, AG-6, and AG-11. Anastomosis was observed only with tester isolates of AG-4 (3). Pathogenicity tests were performed on container-grown, healthy, 3-month-old cuttings. Twenty plants of P. mollissima were inoculated near the base of the stem with five 1-cm2 PDA plugs from 5-day-old mycelial plugs obtained from two representative cultures. The same number of plants served as uninoculated controls. Plants were maintained at 25°C and 95% relative humidity with a 12-h fluorescent light/dark regimen. Wilt symptoms due to crown and root rot, identical to ones observed in the nursery, appeared 7 to 8 days after inoculation with either of the two isolates and all plants died within 20 days. No disease was observed on control plants. R. solani AG-4 was reisolated from symptomatic tissues and identified as previously described, confirming its pathogenicity. Damping-off or crown and root rot due to R. solani were previously detected on P. edulis in Brazil, Africa, India, Oceania, and Australia (2). To our knowledge, this is the first report of R. solani causing crown and root rot on P. mollissima.