Uric Acid Nephropathy Research Articles

Xanthine oxidase inhibitors in asymptomatic hyperuricemia

Asymptomatic hyperuricemia (AHU) is a condition, in which the serum concentration of uric acid (UA) is increased (>420 μmol/l in men or >360 μmol/l in women) and there are no signs of the formation of urate crystals. The worldwide prevalence rate of AHU has been on the increase in recent decades: it has been detected in approximately every five inhabitants of the Earth. In 10% of adults, hyperuricemia (HU) occurs at least once in a lifetime. In the process of evolution, HU has been useful; it has contributed to the intellectual development of man, owing to the activation of neurostimulating adenosine receptors, and to his survival under cold and hunger conditions. However, the negative role of UA in the genesis of different metabolic disorders, cardiovascular diseases (CVD), and kidney diseases has been discussed in recent decades. The association of elevated UA levels with almost all CVD risk factors makes it difficult to answer the question of whether UA plays a causative role in the development of heart disease, kidney disease, or carbohydrate metabolism disorders, or it is only a marker for their increased risk.Whether HU that is uncomplicated by joint damage, urolithiasis, or urate nephropathy should be treated is another question that is currently being actively discussed. Although the routine prophylactic urate-lowering therapy is not indicated in the vast majority of cases of AHU, there is growing evidence that this correction is necessary in some groups of patients. The use of xanthine oxidase (XO) inhibitors in a number of trials was accompanied by a reduction in the risk of CVD and by an improvement in renal function. Epidemiological studies have also established that there is a significant positive correlation of the serum concentration of UA with obesity, dyslipidemia, insulin resistance, and cerebrovascular and peripheral vascular diseases. Further investigations are needed to study the impact of lowering UA levels and that of therapy with XO inhibitors on the progression of different diseases.

Anti-hyperuricemic and nephroprotective effect of geniposide in chronic hyperuricemia mice

Hyperuricemia is a key risk factor for kidney disease. Geniposide possesses various pharmacological activities, however, to our knowledge, no previous work investigated the therapeutic effect of geniposide on urate nephropathy. The present study established a chronic hyperuricemia model using a combination of adenine and ethambutol administration. The potential beneficial effects and mechanisms of geniposide on hyperuricemia and nephropathy were also investigated. The results demonstrated that geniposide significantly decreased SUA levels via inhibition of the XOD activity and increasing the excretion of urinary uric acid. Geniposide also markedly improved kidney damage related to hyperuricemia. Further investigation indicated that geniposide improved the symptoms of nephropathy via decreasing the production of proinflammatory cytokines, including IL-1β, PG-E2, and TNF-α, and inhibiting the expression of TGF-β1. The molecular mechanism of action may be associated with suppression of TLR4/MyD88 signaling and NLRP3 inflammasome activation to reduce IL-1β and TNF-α production respectively in hyperuricemic mice.

“Surgical management of unusual large tophi in chronic tophaceous gout: A case report”

Gout is a disorder of purine metabolism a form of inflammatory arthritis characterized by recurrent attacks of a red, tender, hot, and swollen joint. Pain typically comes on rapidly, reaching maximal intensity in less than twelve hours. The first metatarsophalangeal joint is affected in about half of cases. It may also result in tophi, renal stones, or urate nephropathy.1 Commonly, but very large tophi are unusual in chronic gout. Here we present 52 years male patient presenting with unusually large tophi over bilateral foot, with raised serum uric acid levels. In a untreated cases of chronic gout, patients can develop severe destructive poly articular involvement and tophi. Treatment aims at control of serum uric acid levels which can cause regression of tophi. And surgical excision of very large tophi. Keywords: Gout, Arthritis, Tophi, Surgical excision.

Acute Kidney Injury - Part II: Special Situations

Acute renal failure (ARF) has been defined as a syndrome in which an abrupt decrease in renal function produces retention of nitrogenous waste products. Translating this abstract description into a clinically useful, accurate, and widely accepted definition has been challenging, in large part because of the focus on serum creatinine concentration, which is easily obtained but has the inherent limitation of poor detection of rapid or subtle, but clinically important, changes in the glomerular filtration rate (GFR). In recent years, therefore, the term acute kidney injury (AKI) has replaced ARF because AKI denotes the entire clinical spectrum from mild increases in serum creatinine to overt renal failure. AKI is defined by the Risk-Injury-Failure-Loss-ESRD (RIFLE) criteria, based on serum creatinine concentration and urine flow rate. The Acute Kidney Injury Network (AKIN) subsequently modified the definition further and divided AKI into three stages. This part of the AKI review specifically discusses special situations: rhabdomyolysis, aristolochic acid nephropathy, acute urate nephropathy, acute phosphate nephropathy, AKI in multiple myeloma, ehytlene glycol poisoning, contrast-induced nephropathy, AKI in sepsis, hepatorenal syndrome, and AKI in pregnancy. This review contains 10 tables, and 47 references. Keywords:Acute kidney injury, dialysis, contrast, rhabdomyolysis, nephropathy, urinalysis, multiple myeloma, ethylene glycol, sepsis, hepatorenal syndrome

Acute Kidney Injury - Part II: Special Situations

Acute renal failure (ARF) has been defined as a syndrome in which an abrupt decrease in renal function produces retention of nitrogenous waste products. Translating this abstract description into a clinically useful, accurate, and widely accepted definition has been challenging, in large part because of the focus on serum creatinine concentration, which is easily obtained but has the inherent limitation of poor detection of rapid or subtle, but clinically important, changes in the glomerular filtration rate (GFR). In recent years, therefore, the term acute kidney injury (AKI) has replaced ARF because AKI denotes the entire clinical spectrum from mild increases in serum creatinine to overt renal failure. AKI is defined by the Risk-Injury-Failure-Loss-ESRD (RIFLE) criteria, based on serum creatinine concentration and urine flow rate. The Acute Kidney Injury Network (AKIN) subsequently modified the definition further and divided AKI into three stages. This part of the AKI review specifically discusses special situations: rhabdomyolysis, aristolochic acid nephropathy, acute urate nephropathy, acute phosphate nephropathy, AKI in multiple myeloma, ehytlene glycol poisoning, contrast-induced nephropathy, AKI in sepsis, hepatorenal syndrome, and AKI in pregnancy. This review contains 10 tables, and 47 references. Keywords:Acute kidney injury, dialysis, contrast, rhabdomyolysis, nephropathy, urinalysis, multiple myeloma, ethylene glycol, sepsis, hepatorenal syndrome

Acute Kidney Injury - Part II: Special Situations

Acute renal failure (ARF) has been defined as a syndrome in which an abrupt decrease in renal function produces retention of nitrogenous waste products. Translating this abstract description into a clinically useful, accurate, and widely accepted definition has been challenging, in large part because of the focus on serum creatinine concentration, which is easily obtained but has the inherent limitation of poor detection of rapid or subtle, but clinically important, changes in the glomerular filtration rate (GFR). In recent years, therefore, the term acute kidney injury (AKI) has replaced ARF because AKI denotes the entire clinical spectrum from mild increases in serum creatinine to overt renal failure. AKI is defined by the Risk-Injury-Failure-Loss-ESRD (RIFLE) criteria, based on serum creatinine concentration and urine flow rate. The Acute Kidney Injury Network (AKIN) subsequently modified the definition further and divided AKI into three stages. This part of the AKI review specifically discusses special situations: rhabdomyolysis, aristolochic acid nephropathy, acute urate nephropathy, acute phosphate nephropathy, AKI in multiple myeloma, ehytlene glycol poisoning, contrast-induced nephropathy, AKI in sepsis, hepatorenal syndrome, and AKI in pregnancy. This review contains 10 tables, and 47 references. Keywords:Acute kidney injury, dialysis, contrast, rhabdomyolysis, nephropathy, urinalysis, multiple myeloma, ethylene glycol, sepsis, hepatorenal syndrome

Disposable Nonenzymatic Uric Acid and Creatinine Sensors Using μPAD Coupled with Screen-Printed Reduced Graphene Oxide-Gold Nanocomposites.

Uric acid (UA) and creatinine are the imperative biological substance for clinical monitoring and diagnosis. Measuring the ratio between uric acid and creatinine in urine helps differentiate acute uric acid nephropathy from the hyperuricemia that secondarily occurs to renal failure. In general, the ratio is greater than 0.9 in acute uric acid nephropathy and less than 0.7 in hyperuricemia. In this work, disposable nonenzymatic screen-printed reduced graphene oxide-gold nanocomposites electrodes were firstly developed for the quantitative analysis of uric acid. Our sensors were also coupled with the paper-based colorimetric sensor of the determination of creatinine. Hence, an alternative high-throughput screening test for the uric acid to creatinine ratio with high sensitivity, specificity, simplicity, and rapidity was developed. Under the optimum conditions, our disposable nonenzymatic screen-printed electrode for the determination of uric acid shows the acceptable analytical performance in a wide range of linearity (2.5-1,000 μM) with a low detection limit of 0.74 μM. Our electrodes also showed no interference from common physiologic compound in urine. The determination of creatinine has been developed using Jaffé reaction between the creatinine and picric acid in alkaline condition. The alkaline picrate color on μPAD changed from yellow to orange in the presence of creatinine and the orange intensity is directly proportional to the creatinine amount in a linearity range of 0.20-6.0 mM as a detection limit of 180 μM. Finally, our device has been utilized to determine uric acid and creatinine simultaneously in control urine samples with acceptable result.

Long non-coding RNA ANRIL-mediated inflammation response is involved in protective effect of rhein in uric acid nephropathy rats

BackgroundThe aim of this study was to investigate the role of long non-coding RNAs (LncRNAs) antisense non-coding RNA in the INK4 locus (ANRIL) in anti-inflammation of rhein in uric acid nephropathy (UAN) rats.MethodsRat models of UAN were induced by adenine and potassium oxonate. Enzyme-linked immunosorbent assay (ELISA) was performed to assess inflammation factor in serum and supernatant. ANRIL mRNA level was detected using real-time reverse transcription PCR (qRT-PCR). Immunostaining was used to observe pathological changes of renal tissues in rats.ResultsANRIL and inflammatory factor levels were highly expressed in patient with UAN. Furthermore, rhein showed an observable effect on anti-inflammatory and renal protection in UAN rats, rhein inhibited expressions of ANRIL in vivo or in vitro. Besides, ANRIL-mediated inflammatory response attenuated protective effect of rhein.ConclusionsANRIL-mediated inflammatory response attenuated the protective effect of rhein in UAN rats. This study showed an understanding of the role and mechanism of ANRIL in UAN, which provides a new target and therapy for the prevention and treatment of UAN.

The role of oxidative stress-mediated apoptosis in the pathogenesis of uric acid nephropathy

Objective: By copying the uric acid nephropathy rat model, the oxidative stress injury of mitochondria was caused in renal tubular epithelial cells and the relationship between the injury and the induction of cell apoptosis was identified.Methods: All rats were randomly divided into NC (normal control, NC) group, HUA (high uric acid, HUA) group and GSH (reductive glutathione, GSH) group. The values were quantitatively tested in the kidney tissues, including 24-h urinary protein quantity, serum creatinine, blood uric acid, the MDA (malondialdehyde, MDA) and SOD (superoxide dismutase, SOD) oxidative stress indicators. The expression of p53, Bax and caspase-9/-3 were detected by immunoblotting. TUNEL assays were used to detect the apoptosis of renal tubular epithelial cells.Result: In HUA and GSH groups, the 24-h urinary protein(24UTP), serum creatinine, and blood uric acid increased gradually with the increase of the replication cycle and the increase was significant compared to the NC group (p < .05). Compared to the NC group, MDA increased whereas SOD decreased. The expression of apoptotic proteins, such as p53, Bax, and caspase-9/-3 in the mitochondria was significantly different (p < .05). TUNEL assay revealed that the renal tubular epithelial cells in HUA group were largely apoptotic, whereas the GSH group improved significantly.Conclusion: Mitochondria incurred the substantial damage due to being in a state of oxidative stress, which was the primary cause of apoptosis in the renal tubule epithelial cells. GSH exhibited the effective resistance to the influence of oxidative stress and can restore the damage in the renal tubular epithelial cells.

Retrospective Survey of Tumor Lysis Syndrome and Acute Uric Acid Nephropathy Associated with Cancer Chemotherapy.

Retrospective Survey of Tumor Lysis Syndrome and Acute Uric Acid Nephropathy Associated with Cancer Chemotherapy.

New personalized genetic mouse model of Lesch-Nyhan syndrome for pharmacology and gene therapy

Introduction: Lesch-Nyhan syndrome is a clinical and laboratory disorder caused by X-linked disruption of the purine metabolism. The deletion in the HPRT1 gene leads to the disappearance of valine in the eighth position of the protein amino acid sequence. The disease occurs in males and is accompanied by an excess of uric acid, urate nephropathy and neurologic impairment.&#x0D; Objective of the Study: Generation of the new personalized genetic mouse model of Lesch-Nyhan syndrome for preclinical study of new approaches to the pharmacological and gene therapy&#x0D; Materials and Methods: For genomic editing, the sequence was synthesized the sequence of the matrix GACCGGTCCCGTCATGCCGACACGCAGTCCCAGCGTGGTGAGCCAAGGGGACTCCAGCAGAGCCCCACAG was synthesized. For the cultivation of viable mouse embryos after microinjection, KSOM media was used. Amplification and sequencing was performed by the standard methods.&#x0D; Results: A boy with not previously described hemizygous variant in the HPRT1 gene, was observed in our clinic. The mutation was the deletion of 8Val in the first exon of the HPRT1 gene. To introduce this mutation, we used the CRISPR-Cas9 genomic editing system. The genetic construct for microinjections included a mixture of the vector for the expression of Cas9 and sgRNA (px330), as well as the matrix for homologous recombination (ssODN), in a ratio of 1 part Cas9 to 3 parts of the ssODN matrix. Four of the 12 obtained animals were mosaic transgenes. One of 4 mice mated with a male from the hybrid strain CBA x C57BL/6, and descendants of F2 have already been received from this mating.&#x0D; Discussion: During the creation of HPRT1 genetically modified mice, we encountered certain difficulties. First, from 615 transplanted embryos, only 12 were able to complete full embryonic development. 9 recipients we observed abortions in the later stages. These data may indicate possible violations of embryonic development in animals carrying a mutant copy of the HPRT1 gene.&#x0D; Conclusion: In the current study, we present the results of the generation of a genetically modified mouse strain carrying a deletion in the HPRT1 gene. These mice can be effectively used for the preclinical testing of new drugs aimed at the treatment of Lesch-Nyhan syndrome.

The flavonoid-rich fraction from rhizomes of Smilax glabra Roxb. ameliorates renal oxidative stress and inflammation in uric acid nephropathy rats through promoting uric acid excretion

Uric acid metabolic disorder is considered to be the main pathogenesis of uric acid nephropathy (UN). Smilax glabra Roxb. is a traditional Chinese herb which has been used in the treatment of gout, but the mechanism was unclear. In this study, we investigated the protective effects of the flavonoid-rich fraction from rhizomes of Smilax glabra Roxb. (SGF) on uric acid nephropathy rats and its underlying mechanisms of promoting uric acid excretion. Sprague Dawley (SD) rats were induced by high purine diet (yeast pellets + adenine) for 5 weeks. Rats were orally treated with SGF or allopurinol daily. The biochemical parameters and enzymes in different treated rats were determined by commercial kits. Kidney pathology was visualized using optical microscopy and electron microscopy. Renal inflammatory factors were detected by ELISA. Renal fibrosis factors and uric acid transporters were analyzed by real time RT-PCR and western blot. The results showed that SGF significantly improved kidney function. Histopathologic examination revealed that urate-induced renal damage was markedly reversed by SGF. Meanwhile, SGF treatment was also found to significantly inhibit renal oxidative stress. SGF treatment obviously suppressed the inflammatory factors of interleukin-6 (IL-6), tumor necrosis factor alpha (TNF-α), interleukin-1β (IL-1β), cyclooxygenase-2 (COX-2) and the profibrotic factors of basic fibroblast growth factor (bFGF), transforming growth factor-β1 (TGF-β1) expression in UN rats. Moreover, SGF either significantly inhibited uric acid production or promoted uric acid excretion in UN rats. The mechanism of SGF promoting uric acid excretion was related to its increase of ATP-binding cassette transporter G2 (ABCG2), organic anion transporter 1 (OAT1), organic anion transporters 2 (OCT2) and organic cation/carnitine transporters 2 (OCTN2) expression. In conclusion, SGF could ameliorate renal oxidative stress and inflammation in UN rats through promoting uric acid excretion.

LncRNA ANRIL promotes NLRP3 inflammasome activation in uric acid nephropathy through miR-122-5p/BRCC3 axis

This study is designed to explore the mechanism by which long non-coding RNA (lncRNA) antisense non-coding RNA in the INK4 locus (ANRIL) plays a pathogenic role in uric acid nephropathy (UAN). The expressions of ANRIL, miR-122-5p, BRCA1-BRCA2-containing complex subunit 3 (BRCC3) and NOD-like receptor protein 3 (NLRP3) were determined in UAN patients and uric acid-treated HK-2 cells by qRT-PCR. Protein levels of BRCC3 and NLRP3 were examined by western blot. The levels of inflammatory cytokines were quantified by ELISA. CCK-8 assay was used to assess cell viability. Apoptosis was detected by Annexin V-FITC/PI double-labeled flow cytometry and TUNEL assay. The interaction between ANRIL, miR-122-5p and BRCC3 were studied using luciferase reporter assay. The role of ANRIL in renal injury was evaluated in experimental rats. ANRIL and BRCC3 were highly expressed while miR-122-5p was down-regulated in serum of UAN patients and uric acid-treated tubular epithelial cells. Luciferase reporter assay and in vitro rescue experiment confirmed that ANRIL promoted NLRP3 inflammasome activation by up-regulating BRCC3 expression via sponging miR-122-5p. Furthermore, in vivo experiment validated that knockdown of ANRIL alleviated renal injury of UAN rats. ANRIL exerted pathogenic effect in UAN to promote NLRP3 inflammasome activation via miR-122-5p/BRCC3 axis.

CXCR1/CXCR2 antagonist G31P inhibits nephritis in a mouse model of uric acid nephropathy

The prevalence of gout is relatively high worldwide, and many gout patients suffer from uric acid nephropathy (UAN) concomitantly. ELR-CXC chemokines such as CXCL8 and CXCL1 have a elevated expression in UAN. In this research, a mouse UAN model was established for a 12 week duration, and uric acid-related crystals were observed. CXCL8(3–72)K11R/G31P (G31P) is a mutant protein of CXCL8/interleukin 8 (IL-8), which has been reported to have therapeutic efficacy in both inflammatory diseases and malignancies for it acts as a selective antagonist towards CXCR1/CXCR2. In this study, G31P-treated mice showed declined production of the blood urea nitrogen (BUN) level and urine volume in UAN mice compared with G31P-untreated UAN counterparts. In addition, G31P effectively improved renal fibrosis, and reduced uric acid accumulation and leukocyte infiltration in UAN kidneys. Furthermore, the expressions of CXCL1 and CXCL2 were reduced and the activation of NOD-like receptors protein 3 (NLRP3) was inhibited by G31P treatment. This study has demonstrated that G31P attenuates inflammatory progression in chronic UAN, and plays a renoprotective function.

Mesenchymal Stem Cells Ameliorate Uric Acid Induced Nephropathy in Rats

BackgroundThe elevation of serum uric acid (UA) is positively correlated to the incidence and mortality of kidney diseases by evoked inflammation and epithelial‐mesenchymal transition (EMT) in renal tubular epithelial cells. Mesenchymal stem cells (MSCs) are able to facilitate immunomodulation and repair kidney injury in experimental models of acute or chronic kidney injury. Our study aims to investigate the effects of MSCs on kidney injury both in rats model of uric acid nephropathy and high uric acid‐treated renal tubular epithelial cells (NRK‐52E).MethodsIn vivo, rats were intragastric administrated with potassium oxonate (PO, 1500 mg/kg/day) plus adenine (Ad, 50 mg/kg/day) for 4 w to develop hyperuricemia. MSCs treatment (tail vain injection of MSCs 3×106 cells/rat) was conducted from the 2nd week for 2 times with one week interval. After 6 weeks, the kidney tissues were collected for further detections. In vitro, NRK‐52E cells were co‐cultured with or without MSCs in Transwell system. Cell cycle and apoptosis were analyzed by flow cytometry. The mRNA and protein expression of genes related to inflammation and fibrosis were detected by q‐PCR and WB.Results MSCs alleviated kidney injury in rats of uric acid nephropathy. Compared with UA group, HE and Masson staining have shown that the histological abnormalities and fibrosis were significantly ameliorated after MSCs treatment. Moreover, the mRNA of FN, TNF‐α, TGF‐β and IL‐1β showed marked decrease in UA + MSCs group in comparison to UA group. MSCs inhibited cellular damage in high uric acid‐treated NRK‐52E. Comparing with high uric acid group, MSCs co‐culture induced remarkable increase of cell proliferation index (62.61% vs. 54.55%), slight decreased of apoptosis rate (3.7% vs. 4.8%) and increased expression of anti‐apoptotic protein Bcl‐2. In respect of the expression of inflammation and fibrosis related protein, MSCs co‐culture slightly downregulated the expression of TNF‐α, α‐SMA and FN, while upregulated the expression of E‐cad, but no significant change was observed on VCAM‐1. ConclusionDuring the development of hyperuricemia, MSCs effectively ameliorated inflammatory infiltration, suppressed the fibrosis progress trigged by inflammatory factors and fibrosis factor as TGF‐β, resulting in the improvement of high uric acid induced kidney lesion. MSCs exerted the protective role through increase of cell viability and proliferation, decrease of apoptosis and the expression of inflammatory factor TNF‐α, and increase the expression of E‐cad, which contributed to the suppression of interstitial transformation of renal tubular epithelial cells.Support or Funding InformationThis study was supported by the Program of National Natural Science Foundation of China (81370824), and the National Key Clinical Project.

Higher Incidence of Renal Allograft Glomerulonephritis in Living-Related Donor Kidney Transplantation

Glomerulonephritis recurrence has emerged as one of the leading causes of allograft loss. We aimed to investigate the effect of living-related and deceased donation on the incidence of renal allograft glomerulonephritis and its effect on renal allograft survival. MethodsAdult renal allograft recipients with primary glomerulonephritis were enrolled. Transplantation date was from Feb 2004 to Dec 2015. Exclusion criteria included combined organ transplantation, structural abnormality, diabetic nephropathy, hypertension nephropathy, obstructive nephropathy, and primary uric acid nephropathy. The incidence of biopsy-proven allograft glomerulonephritis was compared between the living-related donor group and the deceased donor group. Graft survival was assessed with Kaplan-Meier method, and Cox proportional hazard model was used to evaluate the effect of posttransplant glomerulonephritis on graft outcome. ResultsThere were 525 living-related donor kidney transplant recipients (LRKTx) and 456 deceased donor kidney transplant recipients (DDKTx) enrolled. The incidence of IgA nephropathy was 8.8% in the LRKTx group and 1.3% in the DDKTx group (P < .001); the incidence of focal segmental glomerulosclerosis (FSGS) was 3.8% in the LRKTx group and 1.5% in the DDKTx group (P = .03). FSGS increased the risk of graft failure compared with non-FSGS (hazard ratio [HR], 3.703 [1.459–9.397]; P = .006). IgA nephropathy increased the risk of graft failure by over 5 times 5 years after kidney transplantation compared with non-IgA nephropathy, but it did not affect early allograft survival (HR for ≥5 years, 6.139; 95% CI, 1.766–21.345; P = .004; HR for <5 years, 0.385 [0.053–2.814]; P = .35). ConclusionsHigher incidence of IgA nephropathy and FSGS in renal allograft was observed in living-related donor kidney transplantation compared with deceased donor kidney transplantation. De novo or recurrent IgA nephropathy and FSGS impaired long-term renal allograft survival.

Medical renal diseases are frequent but often unrecognized in adult autopsies

Kidney diseases affect many hospitalized patients and contribute to morbidity and mortality. Therefore, kidney disease should be prevalent, but the frequency and spectrum of medical renal pathology in autopsy specimens has not been well documented. We sought to determine the spectrum of medical renal pathology in adult autopsy specimens and the frequency of overlooked diagnoses. We reviewed the hematoxylin- and eosin-stained kidney sections from 140 adult autopsies performed at a large teaching hospital over a 2-year period. Fifty-eight cases (41%) had findings warranting further analysis, including alterations in glomerular matrix and/or cellularity, atypical or pigmented casts, thrombi, tubulointerstitial or vascular inflammation, or deposition of amorphous material. After additional studies and clinical correlation, the pathologic changes in 43 cases (31%) were categorized as follows: diabetic nephropathy, bile cast nephropathy, thrombotic microangiopathy, infection-related glomerulonephritis, focal necrotizing/crescentic glomerulonephritis, oxalate nephropathy, light-chain cast nephropathy, amyloidosis, urate nephropathy, hemosiderosis, antineutrophil cytoplasmic antibody-associated vasculitis, polyoma virus nephropathy, atheroembolic disease, and nephrocalcinosis. These diagnoses were not reported in 26 (60%) cases during the initial autopsy evaluation. This study demonstrates that medical renal diseases are common in autopsy cases, but significant diagnoses can be easily overlooked. Autopsy kidney specimens are a rich source of renal pathology and their evaluation should be emphasized in anatomic pathology residency training. Ultimately, our understanding of how kidney disease contributes to morbidity and mortality will benefit from accurate recognition of renal pathology in autopsy specimens.

Weicao capsule ameliorates renal injury through increasing autophagy and NLRP3 degradation in UAN rats.

Uric acid nephropathy (UAN) is one of the most common metabolic diseases and leads to kidney damage. This study aimed to evaluate the effect of Weicao capsule on renal injury of UAN rats and to examine whether the mechanism was associated with induction of autophagy and degradation of nucleotide binding oligomerization domain (Nod)-like receptor (NLR) protein 3 (NLRP3) inflammasome. Sixty Sprague-Dawley rats were randomly allocated into 6 groups: Control, Model, Allopurinol, and Weicao (0.55/1.1/2.2 g/kg) group. The data showed activation of renal NLRP3 inflammasome in UAN rats, with elevation in serum levels of interleukin (IL)-1β and IL-18, and subsequent deterioration of renal injury. Fortunately, Weicao had a markedly therapeutic effect on UAN rats, including improving renal function-related indexes, ameliorating hyperuricemia-related inflammation, decreasing crystals in renal tissue and alleviating renal interstitial fibrosis. Additionally, Weicao exerted anti-proliferative and anti-apoptosis effects on rat renal tubular epithelial cell NRK-52E in macrophages from UAN rats. Our investigation into the mechanism revealed that Weicao suppressed the activated NLRP3 inflammasome. Furthermore, Weicao induced autophagy, as evidenced by a dose-dependent increase in levels of renal autophagy-related proteins in UAN rats. Moreover, autophagy inhibitor 3-MA and NLRP3 activator ATP blocked the effect of Weicao on autophagy induction and NLRP3 inflammasome degradation. In conclusion, Weicao had similar effects as allopurinol and exerted anti-inflammatory and renal-protective effect in a concentration-dependent manner in UAN rats, most likely through increasing autophagy and NLRP3 degradation. Our study provides new insight into the underlying mechanism of Weicao in the treatment of UAN.

Uric acid and contrast-induced nephropathy: an updated review and meta-regression analysis.

IntroductionPrevious studies have suggested a relationship between serum uric acid and contrast-induced nephropathy (CIN).AimWe performed an updated review and a meta-regression analysis to assess whether serum uric acid is associated with CIN or there exists any relationship between serum uric acid and other risk factors for CIN.Material and methodsWe searched PubMed, Embase and Cochrane databases and reviewed cited references up to July 31, 2018 to identify relevant studies.ResultsA total of 6,705 patients from 10 clinical studies were included. CIN occurred in 774 of the 6,705 (12%) patients. Baseline uric acid levels were significantly higher in those who developed CIN (6.51 vs. 5.67 mg/dl; 95% CI: 0.55–1.22, p = 0.00001). Comparison of clinical features showed that patients with CIN were significantly older (69 vs. 63 years; p < 0.00001) and more often had diabetes (42% vs. 32%; p = 0.002) and hypertension (67% vs. 59%; p = 0.03). Also, patients who developed CIN had lower hemoglobin (12.5 vs. 13.6 mg/dl; p < 0.00001) and higher levels of baseline creatinine (1.27 vs. 1.01 mg/dl; p < 0.0001), but had similar levels of glycemia, total cholesterol, low-density lipoprotein cholesterol, high-density lipoprotein cholesterol, and triglyceride. Also, they showed a lower ejection fraction (45% vs. 50%; p < 0.00001). Meta-regression analysis revealed that uric acid related only to age (r = 0.13, p = 0.03).ConclusionsOur investigation indicates that uric acid is significantly associated with CIN. Uric acid correlated significantly with age only, and not with other major predictors of CIN. Further studies are therefore needed to verify the potential of uric acid to improve CIN risk stratification.

Uric Acid and Diabetic Nephropathy Risk.

Diabetic nephropathy (DN) is the leading cause of end-stage renal disease (ESRD) in the western world. Current treatment methods, with better control of glycemia and blood pressure, including renin-angiotensin system blockade (RASB), appear to have slowed the DN progression rate but have not substantially decreased the annual incidence of new DN ESRD cases. Thus, new treatment targets are needed. Higher levels of serum uric acid (UA) are associated with increased risk of the clinical manifestations of DN in persons with types 1 and 2 diabetes. Also, UA is a strong predictor of DN progression. Two small, short-term, proof-of-concept clinical trials in which a minority of the patients had diabetes suggested that reduction of UA with allopurinol could decrease the rate of glomerular filtration rate (GFR) loss in persons with chronic kidney disease (CKD). However, a definitive trial to check whether UA reduction can benefit DN progression has not been conducted as yet. Preventing Early Renal Loss in Diabetes (PERL) is an ongoing trial in persons with type 1 diabetes and early to moderate GFR reduction. This 3-year randomized placebo controlled trial in 530 subjects is to check whether UA reduction with allopurinol can slow the rate of GFR decline as determined by the plasma disappearance of iohexol. Key Message: If the results of the PERL trial are positive, initiation of UA reduction treatment while GFR is relatively well preserved could delay ESRD in DN by 8-10 years, that is, considerably longer than the period that has been demonstrated for RASB. This could have important implications for the treatment of DN in particular and of CKD in general.