Β-glucuronidase Gene Research Articles

Establishment of Agrobacterium tumefaciens – mediated genetic transformation of apple pathogen Marssonina coronaria using marker genes under the control of CaMV 35S promoter

Premature leaf fall of apple caused by Marssonina coronaria is economically very important apple disease and all the commercially available apple cultivars are susceptible to this disease. The non-availability of an efficient transformation system for this fungus hinders the functional genomics research. Herein, we report for the first time, the successful Agrobacterium-mediated transformation in apple leaf blotch fungus M. coronaria by transferring T-DNA harbouring the genes for hygromycin phosphotransferase (hpt), β-glucuronidase (uidA) and green fluorescent protein (gfp) under the control of CaMV 35S promoter. The key factors that affect the transformation efficiency including type of recipient fungal material, acetosyringone concentration, the conditions for co-cultivation, Agrobacterium concentration, Agrobacterium strains and membrane types as support were investigated. The present results have recommended that 250 μM concentration of acetosyringone, 24 °C temperature and 48 h time, 0.5 OD600 of A. tumefaciens, EHA105 Agrobacterium strain and Whatman filter paper were the optimal co-cultivation conditions for the transformation of M. coronaria by using fragmented mycelia suspension and mycelial plugs. We observed that conidia were tedious to transform as compared to the fragmented mycelia and mycelial plugs of this slow growing fungus. These optimized parameters yielded 54 and 70 average transformants per 60 mycelial plugs and 104 fragmented mycelia, respectively. Fungal transformants were analysed for T-DNA integration, gus gene expression and gfp gene expression. Strong gus histochemical staining and green fluorescence expression indicated that the CaMV 35S promoter can drive gene expression in M. croronaria. Some mutants showed difference in the morphology of the colony as compared to the wild type control. This report will be very useful to inspect molecular basis of apple-M. coronaria interactions by deciphering the functional roles of various genes in this pathogenic fungus.

Agrobacterium-Mediated Transient Transformation of Marchantia Liverworts.

Agrobacterium-mediated transient gene expression is a rapid and useful approach for characterizing functions of gene products in planta. However, the practicability of the method in the model liverwort Marchantia polymorpha has not yet been thoroughly described. Here we report a simple and robust method for Agrobacterium-mediated transient transformation of Marchantia thalli and its applicability. When thalli of M. polymorpha were co-cultured with Agrobacterium tumefaciens carrying β-glucuronidase (GUS) genes, GUS staining was observed primarily in assimilatory filaments and rhizoids. GUS activity was detected 2 days after infection and saturated 3 days after infection. We were able to transiently co-express fluorescently tagged proteins with proper localizations. Furthermore, we demonstrate that our method can be used as a novel pathosystem to study liverwort-bacteria interactions. We also provide evidence that air chambers support bacterial colonization.

Agrobacterium-mediated Genetic Transformation of Rice var. BRRI Dhan 58

Agrobacterium mediated genetic transformation of BRRI Dhan 58 was conducted by using immature embryos following indirect regeneration. High percentage of callus induction at 96.5% was obtained when seeds of BRRI dhan 58 were cultured on modified MS medium supplemented with 2.5 mg/l 2, 4-D under dark condition. The maximum regeneration response was rerecorded when MS was supplemented with 3 mg/l BAP + 0.5 mg/l NAA and 1.0 mg/l Kn. Genetic transformation was performed using A. tumefaciens strain LBA4404 harboring pCAMBIA1301 plasmid carrying the marker genes for β-glucuronidase (GUS) and hygromycin resistance (hptII). Integration of the GUS gene into the genome of the rice plants was confirmed by PCR. The leaf segments of the PCR positive transformed plants showed the expression of GUS. The results of this study would be an effective tool for crop improvement and functional studies of gene on rice plant.
 Plant Tissue Cult. & Biotech. 31(1): 71-80, 2021 (June)

Tissue Culture- and Selection-Independent Agrobacterium tumefaciens-Mediated Transformation of a Recalcitrant Grain Legume, Cowpea (Vigna unguiculata L. Walp).

A simple and generally fast Agrobacterium-mediated transformation system with no tissue culture and selection steps has been developed for the first time in a recalcitrant food legume, cowpea. The approach involves wounding of 1-day-old germinated seeds with a needle or sonication either alone or in combination of vacuum infiltration with A. tumefaciens EH105 (pCAMBIA2301) carrying a β-glucuronidase (GUS) gene (uidA) and a neomycin phosphotransferase (nptII) gene for stable transformation. Sonicated and vacuum infiltrated seedlings showed the highest transient GUS activity in 90% of the explants. The sprouted co-cultured seeds directly established in soil and without selection were allowed to develop into plants which on maturity produced T0 seeds. The presence of the alien genes, nptII and uidA in T0 plants and their integration into the genome of T1 plants were confirmed by polymerase chain reaction (PCR) and Southern blot analyses, respectively. The transgenes were inherited in the subsequent T2 generation in a Mendelian fashion and their expression was confirmed by semi-quantitative PCR. The transformation frequency of 1.90% was obtained with sonication followed by vacuum infiltration with Agrobacterium. This approach provides favorable circumstances for the rapid meristem transformation and likely makes translational research ease in an important recalcitrant food legume, cowpea.

Activity and function studies of the promoter cis-acting elements of the key enzymes in saponins biosynthesis of DS from Panax notoginseng.

Panax notoginseng is a traditional Chinese medicine for the treatment of blood diseases, in which saponins were the main active components. Dammarenediol synthase (DS) is a key enzyme in the saponin synthesis pathway of P. notoginseng. The promoter is an important region to regulate gene expression, and the study of the promoter sequence provides important evidence for revealing the mechanism of gene expression regulation. However, there was still little research on the promoter function of P. notoginseng. In this study, the 1382bp promoter upstream of DS from P. notoginseng was cloned and sequenced. The promoter sequence was analyzed by online databases. The plant expression vector fused with the β-glucuronidase gene was constructed and transferred into Agrobacterium tumefaciens. Then tobacco was injected, and its response to exogenous hormones (gibberellin and abscisic acid) was studied by transient expression to verify its unique action elements. The results showed that the tobacco leaves transferred with DS promoter had significantly increased GUS protease activity after spraying GA and ABA, indicating that both DS promoter can specifically and significantly respond to exogenous GA and ABA signal. These findings will help us to better understand the regulatory mechanisms of the upstream region of the DS gene and provide a basis for future research on the interaction of cis-acting elements of promoters with related transcription factors.

Cloning and functional characterization of seed-specific LEC1A promoter from peanut (Arachis hypogaea L.).

LEAFY COTYLEDON1 (LEC1) is a HAP3 subunit of CCAAT-binding transcription factor, which controls several aspects of embryo and postembryo development, including embryo morphogenesis, storage reserve accumulation and skotomorphogenesis. Herein, using the method of chromosomal walking, a 2707bp upstream sequence from the ATG initiation codon site of AhLEC1A which is a homolog of Arabidopsis LEC1 was isolated in peanut. Its transcriptional start site confirmed by 5' RACE was located at 82 nt from 5' upstream of ATG. The bioinformatics analysis revealed that there existed many tissue-specific elements and light responsive motifs in its promoter. To identify the functional region of the AhLEC1A promoter, seven plant expression vectors expressing the GUS (β-glucuronidase) gene, driven by 5' terminal series deleted fragments of AhLEC1A promoter, were constructed and transformed into Arabidopsis. Results of GUS histochemical staining showed that the regulatory region containing 82bp of 5' UTR and 2228bp promoter could facilitate GUS to express preferentially in the embryos at different development periods of Arabidopsis. Taken together, it was inferred that the expression of AhLEC1A during seed development of peanut might be controlled positively by several seed-specific regulatory elements, as well as negatively by some other regulatory elements inhibiting its expression in other organs. Moreover, the GUS expression pattern of transgenic seedlings in darkness and in light was relevant to the light-responsive elements scattered in AhLEC1A promoter segment, implying that these light-responsive elements harbored in the AhLEC1A promoter regulate skotomorphogenesis of peanut seeds, and AhLEC1A expression was inhibited after the germinated seedlings were transferred from darkness to light.

Pollen Flow of Winter Triticale (x Triticosecale Wittmack) Investigated with Transgenic Line Expressing β-Glucuronidase Gene

A transgenic winter triticale line expressing the uidA gene, encoding β-glucuronidase, was used to assess the pollen flow in field experiments over two consecutive vegetation seasons in central Poland. The experimental design included two variants of mixed transgenic and non-transgenic lines. Pollen grains were collected using passive traps located at 0, 10, 30, 60 and 85 m from the transgenic line. GM pollen grains were detected histochemically by staining with x-Gluc. A positive effect of temperature increase, as well as the strength and direction of the wind on the number and spread of pollen grains was observed. Regardless of the experiment year and variant, only few pollen grains were observed at a distance of 85 m. In the first year of the study the amount of pollen grains at 85 m was 300-fold lower than at the source and 140-fold lower in the second year. The number of transgenic pollen grains was two times lower when the field with the transgenic triticale was surrounded by a non-transgenic line, compared to an empty field. On the basis of the obtained results, we suggest 100 m as the distance for triticale pollen migration, although longer flight incidents are possible in extreme atmospheric conditions.

WY195, a New Inducible Promoter From the Rubber Powdery Mildew Pathogen, Can Be Used as an Excellent Tool for Genetic Engineering.

Until now, there are few studies and reports on the use of endogenous promoters of obligate biotrophic fungi. The WY195 promoter in the genome of Oidium heveae, the rubber powdery mildew pathogen, was predicted using PromoterScan and its promoter function was verified by the transient expression of the β-glucuronidase (GUS) gene. WY195 drove high levels of GUS expression in dicotyledons and monocotyledons. qRT-PCR indicated that GUS expression regulated by the WY195 promoter was 17.54-fold greater than that obtained using the CaMV 35S promoter in dicotyledons (Nicotiana tabacum), and 5.09-fold greater than that obtained using the ACT1 promoter in monocotyledons (Oryza sativa). Furthermore, WY195-regulated GUS gene expression was induced under high-temperature and drought conditions. Soluble proteins extracted from WY195-hpaXm transgenic tobacco was bioactive. Defensive micro-HR induced by the transgene expression of hpaXm was observed on transgenic tobacco leaves. Disease resistance bioassays showed that WY195-hpaXm transgenic tobacco enhanced the resistance to tobacco mosaic virus (TMV). WY195 has great potential for development as a new tool for genetic engineering. Further in-depth studies will help to better understand the transcriptional regulation mechanisms and the pathogenic mechanisms of O. heveae.

Evaluation of Plant-Derived Promoters for Constitutive and Tissue-Specific Gene Expression in Potato.

Various plant-derived promoters can be used to regulate ectopic gene expression in potato. In the present study, four promoters derived from the potato genome have been characterized by the expression of identical cassettes carrying the fusion with the reporter β-glucuronidase (gusA) gene. The strengths of StUbi, StGBSS, StPat, and StLhca3 promoters were compared with the conventional constitutive CaMV 35S promoter in various organs (leaves, stems, roots, and tubers) of greenhouse-grown plants. The final amount of gene product was determined at the post-transcriptional level using histochemical analysis, fluorometric measurements, and Western blot analysis. The promoter strength comparison demonstrated that the StUbi promoter generally provided a higher level of constitutive β-glucuronidase accumulation than the viral CaMV 35S promoter. Although the StLhca3 promoter was predominantly expressed in a green tissue-specific manner (leaves and stems) while StGBSS and StPat mainly provided tuber-specific activity, a “promoter leakage” was also found. However, the degree of unspecific activity depended on the particular transgenic line and tissue. According to fluorometric data, the functional activity of promoters in leaves could be arranged as follows: StLhca3 > StUbi > CaMV 35S > StPat > StGBSS (from highest to lowest). In tubers, the higher expression was detected in transgenic plants expressing StPat-gusA fusion construct, and the strength order was as follows: StPat > StGBSS > StUbi > CaMV 35S > StLhca3. The observed differences between expression patterns are discussed considering the benefits and limitations for the usage of each promoter to regulate the expression of genes in a particular potato tissue.

Carbon Dots Enable Efficient Delivery of Functional DNA in Plants.

Genetic engineering is an important technology in plant sciences. The current delivery techniques, such as Agrobacterium-mediated gene transfer and gene gun instant gene expression system, always need a very complicated process or have host-range limitations due to the inhibition of the cell wall structure. Here, we demonstrate that a nanocomposite (CDP) prepared by combining polyethyleneimine (PEI) with carbon dot (CD) was confirmed as a good vector for gene transfection in both animal and plant cells, especially in intact plants. Efficient DNA delivery and strong gene expression without DNA integration are accomplished in rice (Oryza Sativa japonica), wheat (Triticum aestivum), and mung bean (Phaseolus radiatus) leaves and rice roots. Notably, the CDP successfully deliver the hydamycin resistance gene into the rice and induce hygromycin resistance in rice. Also, CDP can achieve the β-glucuronidase gene delivery and expression in mature rice embryo induced callus. The CDP not only facilitates plasmid transport into cells but also protects DNA from DNase degradation. Our work provides a highly efficient DNA delivery system for instant gene expression, which could be a useful and fast gene engineering tool for functional research in plant biology.

Isolation and characterization of maize ZmPP2C26 gene promoter in drought-response.

The clade A members of serine/threonine protein phosphatase 2Cs (PP2Cs) play crucial roles in plant growth, development, and stress response via theABA signaling pathway. But little is known about other PP2C clades in plants. Our previous study showed that maizethe ZmPP2C26, a clade B member of ZmPP2Cs, negatively regulated drought tolerance in transgenic Arabidopsis. However, the upstream regulatory mechanism of ZmPP2C26 remains unclear. In the present study, the expression of ZmPP2C26 gene in maize was analyzed by quantitative real time PCR (qRT-PCR). The results showed that the expression of ZmPP2C26 in shoot and root was both significantly inhibited by drought stress. Subsequently, a 2175bp promoter of ZmPP2C26 was isolated from maize genome (P 2175). To validate whether the promoter possess some key cis-element and negatively drive ZmPP2C26 expression in drought stress, three 5´-deletion fragments of 1505, 1084 and 215bp was amplified from P 2175 and were fused to β-glucuronidase (GUS) and luciferase gene (LUC) to produce promoter::GUS and promoter::LUC constructs, and transformed into tobacco, respectively. Transient expression assays indicated that all promoters could drive GUS and LUC expression. The GUS and LUC activity were both significantly inhibited by PEG-6000 treatment. Notably, the - 1084 to - 215bp promoter possess one MBS element and inhibits the expression of GUS and LUC under drought stress. Meanwhile, we found that the 215bp length is enough to drive ZmPP2C26 expression. These findings will provide insights into understanding the transcription-regulatory mechanism of ZmPP2C26 negatively regulating drought tolerance.

CLE2 regulates light-dependent carbohydrate metabolism in Arabidopsis shoots.

This study focused on the role of CLE1-CLE7 peptides as environmental mediators and indicated that root-induced CLE2 functions systemically in light-dependent carbohydrate metabolism in shoots. Plants sense environmental stimuli and convert them into cellular signals, which are transmitted to distinct cells and tissues to induce adequate responses. Plant hormones and small secretory peptides often function as environmental stress mediators. In this study, we investigated whether CLAVATA3/EMBRYO SURROUNDING REGION-RELATED proteins, CLE1-CLE7, which share closely related CLE domains, mediate environmental stimuli in Arabidopsis thaliana. Expression analysis of CLE1-CLE7 revealed that these genes respond to different environmental stimuli, such as nitrogen deprivation, nitrogen replenishment, cold, salt, dark, and sugar starvation, in a sophisticated manner. To further investigate the function of CLE2, we generated transgenic Arabidopsis lines expressing the β-glucuronidase gene under the control of the CLE2 promoter or expressing the CLE2 gene under the control of an estradiol-inducible promoter. We also generated cle2-1 and cle2-2 mutants using the CRISPR/Cas9 technology. In these transgenic lines, dark induced the expression of CLE2 in the root vasculature. Additionally, induction of CLE2 in roots induced the expression of various genes not only in roots but also in shoots, and genes related to light-dependent carbohydrate metabolism were particularly induced in shoots. In addition, cle2 mutant plants showed chlorosis when subjected to a shade treatment. These results suggest that root-induced CLE2 functions systemically in light-dependent carbohydrate metabolism in shoots.

New Structural Fragments of Molecules of Chemical Regulators of Plant Growth and Development Stimulating Rhizogenesis

Previous biotesting data on a model of rooting leaf and stem cuttings of beans proposed by the authors as a specific test for auxins allowed a conclusion that the auxin activity is inherent for benzyl alcohols, benzylamines and their quaternary ammonium derivatives. Using a quantitative molecular biotest on a model of three-day-old seedlings of the transgenic Arabidopsis thaliana L. transformed with a construct expressing the β-glucuronidase gene under the control of the auxin-sensitive DR5 semisynthetic promoter it was found that these compounds did not have the auxin activity. We showed that the biotest on the model of rooting of leaf and stem bean cuttings was nonspecific towards auxins and can detect the rhizogenic activity rather than the auxin activity of the compounds under study. Using the biotest on the rhizogenic effect of ten-day-old pea seedlings (Pisum sativum L.) of the Six-Weekly variety we demonstrated that the stress-protectors-phytoregulators under study were comparable by the rhizogenic effect with indole-3-acetic acid (IAA), a natural auxin, although they are not auxins. This is consistent with the previous data on the rhizogenic activity obtained on the models of rooting of leaf and stem cuttings of beans and germination of barley seeds. Thus, we showed that oxybenzyl OBzl and aminobenzyl NHBzl groups were new structural elements that ensured a high rhizogenic activity of the chemical regulators of plant growth.

Creation of a genetic vector carrying a synthesis bacterial protein gene CAS9 for plant genome editing

Aim. To create a genetic construct carrying the bacterial protein Cas9 gene, the reporter β-glucuronidase gus gene, as well as the marker phosphinotricin-N-acetyltransferase bar gene for plant genome editing. Methods. Molecular-biological, biotechnological, microbiological and bioinformatic methods were used in the study; Golden Gate molecular cloning method was used to create genetic constructs. Results. The genetic construct pSPE2053 which carries the Cas9 endonuclease gene, the gus and bar genes was created; the assembly correctness of all vector elements was confirmed by polymerase chain reaction; the construct was transferred to Escherichia coli and Agrobacterium tumefaciens cells; β-glucuronidase gene expression was verified by histochemical analysis after Nicotiana rustica L transient genetic transformation. Conclusions. The created genetic construct can be used to edit the plant genome for both stable and transient genetic transformation to accumulate recombinant Cas9 protein. The guide RNA sequences may be subsequently transferred into such plants using either stable or transient genetic transformation or traditional crossing methods.
 Keywords: cloning, genetic construction, gus and bar genes, Cas9 endonuclease protein, transient expression.

AtPPRT1, an E3 Ubiquitin Ligase, Enhances the Thermotolerance in Arabidopsis.

E3 ubiquitin ligase plays a vital role in the ubiquitin-mediated heat-related protein degradation pathway. Herein, we report that the expression of AtPPRT1, a C3HC4 zinc-finger ubiquitin E3 ligase gene, was induced by heat stress, and the β-glucuronidase (GUS) gene driven by the AtPPRT1 promoter has shown increased activity after basal and acquired thermotolerance. To further explore the function of AtPPRT1 in heat stress response (HSR), we used the atpprt1 mutant and AtPPRT1-overexpressing lines (OE2 and OE10) to expose in heat shock. In this study, the atpprt1 mutant had a lower germination and survival rate than those of Col-0 when suffered from the heat stress, whereas OEs enhanced basal and acquired thermotolerance in Arabidopsis seedlings. When compared to Col-0 and OEs, loss-of-function in AtPPRT1 resulted in lower chlorophyll retention and higher content of reactive oxygen species (ROS) after heat treatment. Moreover, the transcript levels of AtPPRT1 and several heat-related genes (AtZAT12, AtHSP21 and AtHSFA7a) were upregulated to greater extents in OEs and lower extents in atpprt1 compared to Col-0 after heat treated. Hence, we suggest that AtPPRT1 may act as a positive role in regulating the high temperature by mediating the degradation of unknown target proteins.

AtPPRT3, a novel E3 ubiquitin ligase, plays a positive role in ABA signaling.

The RING-type E3 ligase AtPPRT3 participates in the plant ABA responding as a positive regulator. E3 ubiquitin ligase, alike of classic plant stress resistance proteins, plays a vital role in regulating the degradation of stress-related proteins. In this study, we investigated the function of the RING-type E3 ubiquitin ligase AtPPRT3 in the ABA signaling pathway. AtPPRT3, located in the endoplasmic reticulum membrane, is involved in ABA signaling. The transcriptional expression of AtPPRT3 was induced by ABA, and the promoter region upstream of AtPPRT3 contains the ABA-responsive element (ABRE). Additionally, the β-glucuronidase (GUS) gene driven by the AtPPRT3 promoter was up-regulated in transgenic plants after ABA treated. We obtained AtPPRT3 function-deficient mutants atpprt3-1, atpprt3-2, and AtPPRT3 over-expressing lines (OE4 and OE5). In this study, atpprt3-1 and atpprt3-2 were less sensitive to exogenous ABA compared to Col-0, whereas OE4 and OE5 were more sensitive. Moreover, AtPPRT3 promotes ABA-mediated stomatal closure and inhibits water loss in Arabidopsis thaliana. After exogenous ABA treated, the transcriptional expression levels of AtDREB2A, AtKIN1, AtRD29A, AtERD10 and AtRD29B were up-regulated to greater extents in OEs and lower extents in atpprt3-1 and atpprt3-2 compared to Col-0. These results suggest that AtPPRT3 positively regulates ABA signaling in A. thaliana.

Establishment of the 'imbibed seed piercing' method for Agrobacterium-mediated transformation of jute and flax bast fibre crops via phloem-specific expression of the β-glucuronidase Gene

Jute (Corchorus capsularis) and flax (Linum usitatissimum) have been established as important sources of bast fibres (phloem fibres) worldwide. These long and lustrous natural fibres are used for various commercial and industrial purposes and hold immense future prospects. To meet the worldwide demand for bast fibres, improvement in the production and quality of jute and flax is essential. Molecular breeding is an expeditious approach for varietal improvement and requires an efficient gene transformation system. The available methods for jute and flax transformation are highly specific to species and variety, requiring a long time and rigorous preparation of media, explants, and screening procedures. In this study, we used a fast and stable method for Agrobacterium tumefaciens-mediated transformation of jute (variety JRC321) and flax (variety FT-897), known as the ‘imbibed seed piercing’ method (ISPM), where seeds were used as explants. A phloem-specific Arabidopsis sucrose-proton H+ symporter 2 (AtSUC2) promoter-driven gus gene (β-glucuronidase) was used for the assessment of genetic transformation of jute and flax plants. Transformed seedlings were selected following three consecutive selection pressure tests conducted at two-week intervals using kanamycin-supplemented culture media. Transgene integration was verified using Southern blotting and PCR-based molecular characterization of jute and flax plants. The gus gene expression levels in the transgenic jute and flax tissue samples were analysed by semi-quantitative and quantitative RT-PCR. The GUS protein expression in transgenic plant tissues was confirmed by the development of blue colour in the histochemical GUS assay. Blue colouration was observed only in phloem cells of the tested plant tissues. Transgenic progeny plants of subsequent generations followed the 3:1 transgene segregation pattern and exhibited phloem-specific GUS expression. This fast, easy, and stable ISPM could also be applied to other fibre producing industrial crops and could form a part of a modern CRISPR/Cas9-based genome editing tool by efficiently delivering CRISPR vectors in jute and flax plants.

An Efficient Agrobacterium-Mediated Genetic Transformation Using Embryonic Axis in Cotton (Gossypium hirsutum L.)

Agrobacterium-mediated genetic transformation approach allows for introducing novel genes in cotton (Gossypium hirsutum L.). Development of efficient regeneration and transformation protocol is very important for recalcitrant plants like cotton. In the present study, five-day-old germinated mature embryo parts especially embryonic axis, hypocotyl and plumule of cotton ‘Lashata’ were wounded and inoculated with A. tumefaciens strain GV2260 harbouring plasmid p35S-GUS-INT. The binary plasmid p35S-GUS-INT contains neomycin phosphotransferase II (NPTII) gene driven by nopaline synthase (NOS) promoter and β-glucuronidase (GUS) gene controlled by cauliflower mosaic virus (CaMV) 35S promoter. After inoculation, explants were co-cultivated in liquid and agar-solidified MS medium for 48 h in dark condition. Agar-solidified co-cultivation medium increased transformation frequency as compared to liquid medium. The putative primary transformants were confirmed with histochemical GUS assay, PCR and RT-PCR. However, comparing the three culture explant, the embryonic axis explants had significant difference with embryonic hypocotyl and plumule explants in terms of number and percentage (%) of GUS, PCR and RT-PCR positive plant. The total transformation efficiency was recorded as 3% with varying GUS expression levels.

Effect of virus inducible cis-element insertion on transcription properties of improved GWSF promoter in Arabidopsis thaliana

An ideal synthetic promoter can accurately regulate gene expression and the minimal cauliflower mosaic virus 35S promoter (GWSF) is an ideal synthetic pathogen-inducible promoter (SPIP) with several advantages. Three modified SPIPs, named as VGWSF, GWVSF, and GWSFV according to the arrangement of cis-elements, were optimized by inserting the dimer of a virus inducible cis-element (TTGGGAAGGAATTTCCTACT, V-box) upstream, midstream, or downstream the GWSF sequence. The three promoters were used to replace the cauliflower mosaic virus 35S promoter in the plasmid pBI121 in order to control the expression of the β-glucuronidase (gus) gene. Transformation of Arabidopsis thaliana (ecotype Col‑0) plants was performed via the Agrobacterium tumefaciens strain GV3101 by the floral dip method. The five-week-old transgenic T3 lines were histochemically stained for GUS activity to evaluate the transcriptional properties of modified SPIPs. The VGWSF and GWVSF had low basal expressions and could not be induced by low or high temperatures and a low osmotic potential but could be induced by the tobacco mosaic virus (TMV). Although GWSFV had the highest GUS activity, it showed a substantial basal expression. After being treated with TMV, abscisic acid (ABA), salicylic acid (SA), or ethylene (Eth) for12 h, the expressions of modified SPIPs were evaluated by real-time quantitative PCR. With the basal expression of GWSF as a reference, each treatment was represented as log2 (fold to the GWSF basal level). The basal expression of VGWSF and expressions induced by TMV, ABA, SA, and Eth were 1.39, 3.42, 6.01, 4.14, and 2.26, respectively, whereas the corresponding values of GWVSF were 1.16, 4.07, 3.72, 4.65, and 3.98, respectively, and the corresponding values of GWSFV were 4.43, 6.11, 4.83, 3.69, and 3.34, respectively. The results revealed that three modified SPIPs acquired virus induction activity due to the insertion of V-box. The V-box insertion position had a significant impact on transcription properties of modified SPIPs.

An efficient system for Agrobacterium-mediated transient transformation in Pinus tabuliformis

BackgroundFunctional genomic studies using genetics approaches of conifers are hampered by the complex and enormous genome, long vegetative growth period, and exertion in genetic transformation. Thus, the research carried out on gene function in Pinus tabuliformis is typically performed by heterologous expression based on the model plant Arabidopsis. However, due to the evolutionary and vast diversification from non-flowering (gymnosperms) to flowering (angiosperms) plants, several key differences may alter the underlying genetic concerns and the analysis of variants. Therefore, it is essential to develop an efficient genetic transformation and gene function identification protocol for P. tabuliformis.ResultsIn the present study we established a highly efficient transgene Agrobacterium-mediated transient expression system for P. tabuliformis. Using a β-glucuronidase gene (GUS) as a reporter gene expression, the highest transformation efficiency (70.1%) was obtained by co-cultivation with Agrobacterium strain GV3101 at an optical density at 600 nm of 0.8, with 150 μM acetosyringone for 30 min followed by 3 days in the dark at 23 ± 1 °C. This protocol would be applied to other conifers; GUS staining was observed 24 h post-infection.ConclusionsWe report a simple, fast, and resilient system for transient Agrobacterium-mediated transformation high-level expression of target genes in P. tabuliformis, which will also improve transformation efficiency in other conifer species.