The Interleukin-1β Gene Is Transcribed from a Poised Promoter Architecture in Monocytes

Michael D Liang,Yue Zhang,Daniel Mcdevit,Sylvia Marecki,Barbara S Nikolajczyk

doi:10.1074/jbc.m510700200

Michael D Liang, Yue Zhang + Show 3 more

Open Access

https://doi.org/10.1074/jbc.m510700200

Copy DOI

Abstract

Cytokine transcription is usually regulated by transcription factor binding and chromatin remodeling following an inducing signal. By contrast, these data showed the interleukin (IL)-1beta promoter assembles into a "poised" structure, as evidenced by nuclease accessibility and loss of core histones immediately surrounding the transcription start site. Strikingly, these properties do not change upon transcriptional activation by lipopolysaccharide. Furthermore, association of two key transcriptional activators, PU.1 and C/EBPbeta, is robust pre- and post-stimulation indicating the IL-1beta promoter is packaged into a nontranscribed but poised promoter architecture in cells capable of rapidly inducing IL-1beta. Monocyte stimulation causes recruitment of a third factor, IRF-4, to the IL-1beta enhancer. PU.1 phosphorylation at a CK2 kinase consensus element is required for this recruitment. We showed that CK2 phosphorylates PU.1, CK2 inhibitors abrogate IL-1beta induction, and CK2 inducibly associates with the IL-1beta enhancer. Taken together, these data indicate a novel two-step mechanism for IL-1beta transcription: 1) formation of a poised chromatin architecture, and 2) phosphorylation of an enhancer-bound factor that recruits other activators. We propose that this poised structure may generally characterize rapidly activated genes.

Highlights

Members of the interferon regulatory factor (IRF) family activate IL-1␤ transcription [8]
Because CK2 has been shown to be activated by LPS, and CK2 can target PU.1 serine 148 in cells [10], it is likely that CK2-mediated PU.1 phosphorylation leads to IL-1␤ transcription in monocyte lineage cells
We showed that less than 50% of the IL-1␤ promoters in the cellular population were packaged into an MNase-accessible structure in 293 cells, which cannot produce IL-1␤, at all positions tested (Fig. 1B, open bars)

Summary

Primer sequences

R, TGCAAAAAGCTGAGAGAGGAG to result in the robust IL-1␤ transcription characteristic of stimulated monocytes. The data demonstrate that the IL-1␤ gene is inducibly transcribed from a poised promoter architecture likely due to post-translational modification of DNA-associated protein

EXPERIMENTAL PROCEDURES

Pathway inhibited Concentration used

RESULTS

DISCUSSION