Abstract
In this communication we report protium-deuterium fractionation factors for the intramolecular triple helix formed by the DNA oligonucleotide 5'-d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT)-3'. The fractionation factors of individual Watson-Crick and Hoogsteen hydrogen bonds in the structure are measured by NMR spectroscopy. The results show that, in contrast to proteins, the fractionation factors are all equal or lower than unity. On the average, the values of the fractionation factors are centered between 0.6 and 0.8, and no significant differences are observed between Hoogsteen and Watson-Crick hydrogen bonds. Deviations from the average are observed for the 5'-end region of the molecule where a base triad is absent and the structure is strained by the intramolecular folding of the DNA strand.
Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
