Abstract
The amino group of adenine plays a key role in maintaining DNA triple helical structures, being the only functional group in DNA that is involved in both Watson-Crick and Hoogsteen hydrogen bonds. In the present work we have probed the internal dynamics of the adenine amino group in the intramolecular YRY triple helix formed by the 31-mer DNA oligonucleotide d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT). The DNA triple helix was specifically labeled with 15N at the amino group of the adenine in the fifth position. The rotation rate of the labeled amino group was measured as a function of temperature using 1H- 15N heteronuclear NMR spectroscopy. The results indicate that, in the DNA triple helix, the rotation of the adenine amino group is greatly slowed relative to that in a DNA double helix. The temperature dependence of the rotation rate suggests a large entropic contribution to this effect, which may originate from different hydration patterns of the adenine amino group in the two structures.
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.