Abstract
The contribution of nucleoli to the cellular stress response has been discussed for over a decade. Stress-induced inhibition of RNA polymerase I-dependent transcription is hypothesized as a possible effector program in such a response. In this study, we report a new mechanism by which ribosomal DNA transcription can be inhibited in response to cellular stress. Specifically, we demonstrate that mild hypoosmotic stress induces stabilization of R loops in ribosomal genes and thus provokes the nucleoli-specific DNA damage response, which is governed by the ATM- and Rad3-related (ATR) kinase. Activation of ATR in nucleoli strongly depends on Treacle, which is needed for efficient recruitment/retention of TopBP1 in nucleoli. Subsequent ATR-mediated activation of ATM results in repression of nucleolar transcription.
Highlights
Hypoosmotic stress induces R loop formation in nucleoli and ATR/ATM-dependent silencing of nucleolar transcription Velichko et al
Rev 5' ACAGGTCGCCAGAGGACAG 5' CTTGTTGACTATCGGTCTCGTG 5'GTCGAGGGCTGACTTTCAATAG 5’CAGTGGGGACACGGAAGG
Summary
Hypoosmotic stress induces R loop formation in nucleoli and ATR/ATM-dependent silencing of nucleolar transcription Velichko et al.
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
