RPA2 Is a Direct Downstream Target for ATR to Regulate the S-phase Checkpoint

Christian J. Nievera,Xiaohua Wu,Vitaly Klimovich,Ellen Fanning,Erin Olson

doi:10.1074/jbc.m605121200

Abstract

Upon DNA damage, replication is inhibited by the S-phase checkpoint. ATR (ataxia telangiectasia mutated- and Rad3-related) is specifically involved in the inhibition of replicon initiation when cells are treated with DNA damage-inducing agents that stall replication forks, but the mechanism by which it acts to prevent replication is not yet fully understood. We observed that RPA2 is phosphorylated on chromatin in an ATR-dependent manner when replication forks are stalled. Mutation of the ATR-dependent phosphorylation sites in RPA2 leads to a defect in the down-regulation of DNA synthesis following treatment with UV radiation, although ATR activation is not affected. Threonine 21 and serine 33, two residues among several phosphorylation sites in the amino terminus of RPA2, are specifically required for the UV-induced, ATR-mediated inhibition of DNA replication. RPA2 mutant alleles containing phospho-mimetic mutations at ATR-dependent phosphorylation sites have an impaired ability to associate with replication centers, indicating that ATR phosphorylation of RPA2 directly affects the replication function of RPA. Our studies suggest that in response to UV-induced DNA damage, ATR rapidly phosphorylates RPA2, disrupting its association with replication centers in the S-phase and contributing to the inhibition of DNA replication.

Highlights

The S-phase checkpoint inhibits ongoing DNA replication as soon as DNA lesions are detected, allowing time for DNA repair to take place before replication continues [4, 5]
To demonstrate conclusively that the slower migrating bands of RPA2 detectable after DNA damage were a result of hyperphosphorylation of the protein, chromatin isolated from U2OS cells exposed to UV light or HU was treated with ␭ phosphatase
RPA2 phosphorylation can be induced with an extremely high dose of ionizing radiation (IR) (100 Gy [27, 32]), this result suggested that RPA2 hyperphosphorylation on chromatin is more prevalent when replication forks are stalled than when DNA double strand breaks are introduced

Summary

EXPERIMENTAL PROCEDURES

Silencing of endogenous RPA2 in these cells was accomplished by two rounds of retroviral infection using pMKO vector [39] expressing the RPA2 shRNA target sequence, CCUAGUUUCACAAUCUGUUGU, located in the 3Ј-UTR of the mRNA [40] followed by selection of G418- and hygromycin-resistant cells. Endogenous ATR, ATM, Chk, and DNA-PK were silenced in U2OS cells by two rounds of retroviral infection using pMKO vector that expressed two different shRNA target sequences. Immunoprecipitates were extensively washed (three times in NETN and two times in kinase buffer) and incubated with the glutathione-eluted GST fusion proteins in the presence of [␥-32P]ATP in either ATR kinase buffer (25 mM HEPES (pH 7.4), 50 mM NaCl, 10 mM MnCl2, 10 mM MgCl2, 1 mM DTT) or Chk kinase buffer (25 mM HEPES (pH 7.4), 50 mM NaCl, 10 mM MgCl2B, 1 mM DTT) at 30 °C for 30 min. The experiment was repeated three times, and the average number of surviving cells from each cell line was normalized to the average number of viable, uninfected U2OS cells that were plated as a control for each experiment

RESULTS

RPA recruitment to the chromatin

DISCUSSION