Abstract

Curcumin has been shown to have anticancer effects in a variety of tumors. However, there are fewer studies on the role of curcumin in endometrial carcinoma (EC). The purpose of this experiment was to examine the inhibitory effect of curcumin on endometrial carcinoma cells and ERK/c-Jun signaling pathway. We first predicted the mechanism of action of curcumin on endometrial carcinoma by network pharmacology. Then, we found that curcumin can decrease the cell viability of Ishikawa cells, inhibit the migration of cancer cells, induce apoptosis, and cause cell cycle arrest in the S phase. For molecular mechanism, curcumin reduced the mRNA expression levels of ERK2 and JUN genes and inhibited the phosphorylation of ERK and c-Jun. This suggests that curcumin inhibits the proliferation of endometrial carcinoma cells by downregulating ERK/c-Jun signaling pathway activity.

Highlights

  • Endometrial carcinoma is a type of uterine cancer

  • It belongs to epithelial malignant tumors that occur in the endometrium. e most common uterine cancer is adenocarcinoma derived from the endometrial glands, accounting for 75%–80% [1]

  • Target prediction in network pharmacology can accelerate the progress of drug design and BioMed Research International development and address limitations [26]. erefore, we used this approach to predict the targets of curcumin against endometrial carcinoma, in order to elucidate the possible mechanism of drug action comprehensively

Read more

Summary

Introduction

Endometrial carcinoma is a type of uterine cancer. It belongs to epithelial malignant tumors that occur in the endometrium. e most common uterine cancer is adenocarcinoma derived from the endometrial glands, accounting for 75%–80% [1]. E most common uterine cancer is adenocarcinoma derived from the endometrial glands, accounting for 75%–80% [1] It is one of the three major malignant tumors of the female reproductive tract, accounting for 7% of female systemic malignancies and 20%–30% of female reproductive tract malignancies. Several studies have reported the antitumor activity of curcumin on breast cancer, lung cancer, head and neck squamous cell carcinoma, prostate cancer, and brain tumors [18]. Erefore, we used this approach to predict the targets of curcumin against endometrial carcinoma, in order to elucidate the possible mechanism of drug action comprehensively. Curcumin has been confirmed to suppress the expression of matrix metalloproteinase to inhibit migration [32] and downregulate apoptosis-related proteins, Wnt pathway, and ROS production to induce apoptosis in endometrial carcinoma. We manage to explore the mechanism of curcumin on ERK/c-Jun pathway in EC

Materials and Methods
F: TGGACTTCGAGCAAGAGATG R
Results
Background number
Conclusions
Full Text
Paper version not known

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call