Characterization of Lactic Acid Bacteria and Determination of Antimicrobial Activity in Dadih from Air Dingin Alahan Panjang District, Solok Regency-West Sumatera

Abstract

Traditional Indonesian fermented foods have been studied as potential probiotics, for example dadiah from West Sumatera are made by fermenting buffalo milk in bamboo tubes. But the potential of halal probiotics isolated from Air Dingin District, West Sumatra (Indonesia) has not been studied. The purpose of this study was to determine the potential of halal probiotic lactic acid bacteria (LAB) Lactobacillus plantarum strain 8m-21 isolation from dadiah in Air Dingin Alahan Panjang District, Solok Regency West Sumatera (Indonesia) against to pathogenic bacteria and antimicrobial activity. Previously lactic acid bacteria Lactobacillus plantarum had been isolationand molecular identification used I6S rRNA with Forward (27F AGAGTTTGATCCTGGCTGAG) and Reverse primer (1492R; GTTTACCTTACGACTT). In this study we analyzed the probiotics have antimicrobial activity against pathogenic bacteria Escherichia coli O157. The results showed that Lactobacillus plantarum strain 8m-21 from Air Dingin dadiah isolates have probiotic properties because they have antimicrobial properties which able to inhibit Escherichia coli, aerob (pathogenic) bacteria and have highest antimicrobial with 20.25 mm inhibition than other sintetic antibiotics.