Abstract

BackgroundCell transformation by the Src tyrosine kinase is characterized by extensive changes in gene expression. In this study, we took advantage of several strains of the Rous sarcoma virus (RSV) to characterize the patterns of v-Src-dependent gene expression in two different primary cell types, namely chicken embryo fibroblasts (CEF) and chicken neuroretinal (CNR) cells. We identified a common set of v-Src regulated genes and assessed if their expression is associated with disease-free survival using several independent human tumor data sets.MethodsCEF and CNR cells were infected with transforming, non-transforming, and temperature sensitive mutants of RSV to identify the patterns of gene expression in response to v-Src-transformation. Microarray analysis was used to measure changes in gene expression and to define a common set of v-Src regulated genes (CSR genes) in CEF and CNR cells. A clustering enrichment regime using the CSR genes and two independent breast tumor data-sets was used to identify a 42-gene aggressive tumor gene signature. The aggressive gene signature was tested for its prognostic value by conducting survival analyses on six additional tumor data sets.ResultsThe analysis of CEF and CNR cells revealed that cell transformation by v-Src alters the expression of 6% of the protein coding genes of the genome. A common set of 175 v-Src regulated genes (CSR genes) was regulated in both CEF and CNR cells. Within the CSR gene set, a group of 42 v-Src inducible genes was associated with reduced disease- and metastasis-free survival in several independent patient cohorts with breast or lung cancer. Gene classes represented within this group include DNA replication, cell cycle, the DNA damage and stress responses, and blood vessel morphogenesis.ConclusionBy studying the v-Src-dependent changes in gene expression in two types of primary cells, we identified a set of 42 inducible genes associated with poor prognosis in breast and lung cancer. The identification of these genes provides a set of biomarkers of aggressive tumor behavior and a framework for the study of cancer cells characterized by elevated Src kinase activity.

Highlights

  • Cell transformation by the Src tyrosine kinase is characterized by extensive changes in gene expression

  • Populations of ts NY72-4 Rous sarcoma virus (RSV)-infected chicken neuroretinal (CNR) cells were expanded at the permissive temperature of 37.5°C while chicken embryo fibroblasts (CEF) were cultured at the non-permissive temperature of 41.5°C until transferred to the permissive temperature of 37.5°C to induce transformation

  • Identification of Transformation-Regulated genes in v-Src transformed CEF To identify genes regulated in a transformation-dependent manner, we characterized the gene expression profiles of CEF transformed by the wt RSV strain Schmidt Ruppin - group A (SR-A) or infected with the Reverse primer CGTCACATGCTCCTGTTCG CAGACTTCACACCTGCTTGG AAGCTCTGCCTTTGGCTGTA ATTTTCTTCTTCAGTGGC GAACGCTGGAAGAACC AAGAAGATTGGTGGAAGG GACATGGGATCTAATGGCTGG TTCAAGTGTATTTTATTCTCCTGCAT TAGACCTAATCGTCCACCAGC TTTCAAACGTCACAGCAAGC AGAGTTTGCTAGGTGTCCTTCAGA

Read more

Summary

Introduction

Cell transformation by the Src tyrosine kinase is characterized by extensive changes in gene expression. We took advantage of several strains of the Rous sarcoma virus (RSV) to characterize the patterns of v-Src-dependent gene expression in two different primary cell types, namely chicken embryo fibroblasts (CEF) and chicken neuroretinal (CNR) cells. The v-Src kinase, the product of the Rous sarcoma virus (RSV), has provided a paradigm for the study of signaling pathways and mechanisms of cell transformation by receptor and non-receptor type tyrosine kinases. Src family of kinases (SFK) contribute to several aspects of the activity of receptor tyrosine kinases including receptor turn-over, reorganization of the cytoskeleton and the initiation of DNA synthesis [1]. Elevated Src kinase activity has been observed in several human cancers and in particular in breast, ovary, lung, bladder, stomach and colon carcinomas [2]. The majority of breast tumors samples (>70%) show elevated Src kinase activity that reflects increased protein levels [3]

Methods
Results
Discussion
Conclusion
Full Text
Paper version not known

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call