Abstract
Bacterial blight of rice is an important disease in Asia and Africa. The pathogen, Xanthomonas oryzae pv. oryzae (Xoo), secretes one or more of six known transcription-activator-like effectors (TALes) that bind specific promoter sequences and induce, at minimum, one of the three host sucrose transporter genes SWEET11, SWEET13 and SWEET14, the expression of which is required for disease susceptibility. We used CRISPR–Cas9-mediated genome editing to introduce mutations in all three SWEET gene promoters. Editing was further informed by sequence analyses of TALe genes in 63 Xoo strains, which revealed multiple TALe variants for SWEET13 alleles. Mutations were also created in SWEET14, which is also targeted by two TALes from an African Xoo lineage. A total of five promoter mutations were simultaneously introduced into the rice line Kitaake and the elite mega varieties IR64 and Ciherang-Sub1. Paddy trials showed that genome-edited SWEET promoters endow rice lines with robust, broad-spectrum resistance.
Highlights
Xanthomonas oryzae pv. oryzae (Xoo) is the etiological agent of bacterial blight disease in rice
transcription-activator-like effectors (TALes) from Xoo are injected by a type III secretion system into plant cells and recognize effector-binding elements (EBEs) in cognate SWEET host gene promoters, which results in induction of SWEET genes and production of sugars that enable disease susceptibility in rice[2,3]
Eighty-seven strains (18 + 69) were not virulent on line 52-1, which harbors mutant alleles of both SWEET11 and SWEET14, while the remaining eight strains (95 – 87) were virulent on line 52-1 (Fig. 2 and Supplementary Table 2). These findings indicate that 87 strains from the screen rely on major TALes that target known EBEs of SWEET11 and SWEET14, whereas eight ‘deviant’ strains have different virulence abilities and, presumably, different TALes
Summary
Xanthomonas oryzae pv. oryzae (Xoo) is the etiological agent of bacterial blight disease in rice. TALes from Xoo are injected by a type III secretion system into plant cells and recognize effector-binding elements (EBEs) in cognate SWEET host gene promoters, which results in induction of SWEET genes and production of sugars that enable disease susceptibility in rice[2,3]. EBE sequence GCATCTCCCCCTACTGTACACCAC ATAAAAGCACCACAACTCCCTT ATATAAGCACCACAACTCCCTT ATAAAGCACCACAACTCCCTTC ATAAAGCACCACAACTCCCTTC CATGCATGTCAGCAGCTGGTCAT ATATAAACCCCCTCCAACCAGGTGCTAAG ATAAACCCCCTCCAACCAGGTGCTAA AAGCTCATCAAGCCTTCA same time, relatively few strains have been assessed for TALe gene content, and optimized genome editing requires knowledge of the TALe variants present in bacterial populations. Targeting both prevalent and rare TALes should increase the durability of resistance. The development of better tools for TALe characterization, which is a challenging and laborious procedure owing to their repetitive DNA sequences and presence of multiple copies per genome, would facilitate identification of novel TALes and determination of gene-editing strategies[21,22,23]
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
