Zucchini Lethal Chlorosis Virus Research Articles

First report of Moroccan watermelon mosaic virus in pumpkin plants in Brazil.

Cucurbita moschata is widely cultivated in Brazil, and zucchini lethal chlorosis virus, squash mosaic virus, papaya ringspot virus, watermelon mosaic virus have been reported as viral pathogens in this crop in Brazil. The leaf samples of C. moschata showing mosaic, blistering, and yellowing symptoms were collected from a commercial field in Petrolina, Pernambuco state and a commercial field in Juazeiro, Bahia state, in February 2023. To identify viruses that infect cucurbit plants in Brazil, three pooled samples showing virus-like symptoms (plants from the Cucurbita genus, the Cucumis genus, and other cucurbit plans including watermelon and chayote) were analyzed by high-throughput sequencing (HTS). The total RNA was extracted from the semi-purified virus using the protocol described by Blawid et al. 2017. The cDNA library was constructed from one RNA sample, which was composed of three pooled RNA samples (Cucurbita genus, the Cucumis genus, and other cucurbit plans), using TruSeq Stranded Total RNA with Ribo-Zero Plant kit (Illumina, San Diego, CA, US) and sequenced by HTS using Novaseq 10G scale (150 bp paired-ends). De novo assembly of total reads was performed using Megahit (Li et al. 2015), and the resulting contigs were analyzed using Blastx with RefSeq viral proteins 2023 (NCBI) in Geneious Prime (Biomatters, Auckland, New Zealand). Total of 88,028,898 reads were obtained and 407,500 contigs (mean length 514 nt) were assembled. Two contigs showed higher amino acid sequence identities (95.4% of 3124 aa in polyprotein and 87.2% of 203 aa in P1 protein) with Moroccan watermelon mosaic virus (MWMV) in the genus Potyvirus of the family Potyviridae (McKern et al. 1993), a virus that had not been previously reported in Brazil. The complete genome was assembled by the read mapping to the contigs as references. The assembled complete genome of MWMV (LC775353) was 9,713 nt, not counting the poly(A) tail, and 217,278 reads were aligned to the genome with a mean coverage of 3369.6 and a pairwise identity of 99.0%. The assembled genome encoded a polyprotein with a higher amino acid sequence identity of 97.82% with the Moroccan isolate (OQ847413). To confirm the presence of this virus in individual samples, RT-PCR was performed with specific primers (MWMV-F: ATTGTCTGATGAAAGAGCACA and MWMV-R: CAGCTTCAGTCGCAACAAG), targeting the cylindrical inclusion gene (the expected size of 598 bp). Eleven field samples of pumpkin plants (six from a field in Juazeiro region and five from Petrolina region) were analyzed using RT-PCR, and one sample from Juazeiro and five samples from Petrolina were positive for MWMV. One replicon of each region was sequenced (Juazeiro, OR338305; Petrolina, OR338306) and showed higher nucleotide identities of 97.0% with each other, and 96.4% and of 97.7%, respectively, with the isolate from Morocco (OQ847413). Samples positive for MWMV were tested for the presence of other viruses previously reported in Brazil. All five samples from Petrolina were positive by RT-PCR as a mixed infection with zucchini yellow mosaic virus (ZYMV) and cucurbit whitefly-borne yellows virus, also, four out of five samples were positive for papaya ringspot virus (PRSV). On the other hand, in one sample positive for MWMV from Bahia state, no mixed infection with ZYMV and PRSV was observed. This is the first report of the occurrence of MWMV in Brazil and South America, associated with mosaic, blistering and yellowing disease symptoms in pumpkin plants.

First Report of Zucchini lethal chlorosis virus in Argentina Infecting Squash Crops

Virus species of the genus Orthotospovirus are among the most economically important plant pathogens in the world because they cause severe crop losses, mainly in ornamental and horticultural crops (Pappu et al. 2009). They are exclusively transmitted by thrips. Several species of Orthotospovirus have been reported infecting cucurbits: watermelon silver mottle virus, zucchini lethal chlorosis virus (ZLCV), watermelon bud necrosis virus, melon yellow spot virus, melon severe mosaic virus, and groundnut ringspot virus (Ciuffo et al. 2017; Spadotti et al. 2014). The symptoms caused by ZLCV infection can include chlorosis and systemic necrosis on leaves, apical upward leaf curl, reduction of leaf blade, and fruit malformation (Giampan et al. 2007). The collection of 90 symptomatic leaves of squash from Salta and Jujuy provinces was carried out during early 2016. For an initial assessment of the presence of ZLCV, a plate trapped antibody enzyme-linked immunosorbent assay (Lommel et al. 1982) with antiserum against ZLCV, kindly provided by Jorge A. M. Rezende from the Universidade de Sao Paulo, Brazil, was performed. Fifty-four of the 90 samples reacted positively to ZLCV-specific antiserum: 18 and 11 positive plants of Cucurbita maxima var. zapallito redondo del tronco and var. zapallo plomo, respectively, 11 positive plants of C. pepo, 11 positive plants of C. ficifolia var. “cayote”, and three positive plants of C. moschata. Ultrathin sections of leaf samples of naturally infected plants were examined by transmission electron microscopy, and presumable orthotospovirus particles were observed. To confirm the identity of the virus, a one-step reverse transcription polymerase chain reaction (RT-PCR) assay was carried out on the RNA extracts from squash plants, using ZLCV-specific primers designed to direct amplification of nucleotides (ZLCV-F, ATCATGCTGTCCAGTCTCCT; and ZLCV-R, CCCACATTTTGCACTTGCGA) of the nucleocapsid gene region. The RT-PCR reaction for ZLCV detection consisted of reverse transcription at 46°C for 30 min, followed by denaturation at 94°C for 3 min, and 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 45 s. Amplicons of the two ZLCV isolates (MK680830 and MK680831) were Sanger sequenced. The consensus sequences were aligned using clustalW and compared with other ZLCV sequences in the public domain using Mega 7 (Kumar et al. 2016). Alignments of the N gene sequences of these ZLCV isolates displayed nucleotide sequence identity above 94% with other ZLCV isolates available at the GenBank database. In addition, the amino acid sequence demonstrated above 97% identity with equivalent regions of S segment of Brazilian ZLCV isolate from Cucumis sativus and squash. The phylogenetic analysis of the identified sequence of ZLCV and other related sequences from GenBank showed a cluster of Argentine isolates close to ZLCV-DF isolate obtained from C. sativus (KU681011). This is the first report of ZLCV outside of Brazil. Although we have not observed the presence of Frankliniella zucchini in the field, which was identified and described as the vector of ZLCV (Riley et al. 2011), as well as virus distribution being limited to Brazil (Nakahara and Monteiro 1999), it would be important to consider the presumable entry of F. zucchini into Argentina.

English

Watermelon plants can be naturally infected by several viruses in single or mixed infections, of which the diagnosis is difficult and require specific techniques. This study aims to detect and to verify the presence of Cucumber mosaic virus (CMV), Papaya ringspot virus type W (PRSV-W), Watermelon mosaic virus (WMV), Zucchini lethal chlorosis virus (ZLCV), Zucchini yellow mosaic virus (ZYMV), and the main cucurbit viruses in Brazil using multiplex reverse transcriptase polymerase chain reaction (RT-PCR) assay. Oligonucleotides were designed towards the conserved regions of the virus genomes. In the duplex-PCR, it was possible to detect all the virus combinations, except ZLCV with ZYMV. The amplified product sizes were 644 bp (CMV), 535 bp (WMV-2), 398 bp (PRSV-W), 244 bp (ZLCV), and 214 bp (ZYMV). To test the efficacy of the methodology, we analyzed plants with virus symptoms from four municipalities in the state of Tocantins, located at Brazilian Cerrado. Mixed infections were detected in 80% of samples in all the municipalities. The multiplex RT-PCR assay can be used to detect and differentiate watermelon viruses that affect crops in the state of Tocantins.   Key words: Cucumovirus, multiplex RT-PCR, Orthotospovirus, potyvirus, watermelon.

Resistance of Cucurbita maxima ‘Exposição’ to zucchini lethal chlorosis virus is likely associated with restriction to the systemic movement of the virus

Zucchini lethal chlorosis virus (ZLCV), genus Orthotospovirus, so far was only reported in Brasil. The main natural hosts of ZLCV are in the cucurbit family. Pumpkin (Cucurbita maxima) cultivar Exposicao was previously reported as highly resistant to ZLCV infection. The objectives of this work were to better characterize the resistance of the Exposicao cultivar to ZLCV and to evaluate the interference of potyviruses (papaya ringspot virus type W, PRSV-W, and zucchini yellow mosaic virus, ZYMV) in the ZLCV resistance of this cultivar. C. maxima ‘Exposicao’ and zucchini (C. pepo) ‘Caserta’ (susceptible control) plants were mechanically inoculated with ZLCV in the cotyledons. Resistance to infection and systemic virus movement were evaluated at 7 and 20 days later. Virus detection was performed using PTA-ELISA and RT-PCR in the cotyledons and upper leaves. The interference of the potyviruses in ZLCV resistance was evaluated in greenhouse and field assays. ZLCV was detected in the inoculated cotyledons of both cultivars, but it did not move systemically in C. maxima ‘Exposicao’. The potyviruses PRSV-W and ZYMV did not interfere in the response of C. maxima ‘Exposicao’ to infection with ZLCV. The resistance of ‘Exposicao’ to ZLCV can be explored in future cucurbitaceae breeding programs.

Evaluation of Weeds as Virus Reservoirs in Watermelon Crops

ABSTRACT: Watermelon is one of the most important vegetable crops in Brazil, which is grouped among the greatest producers worldwide. Viruses stand out among the most damaging disease agents, which can drastically reduce fruit production. In this context, weeds present in the field can also interfere in crop production, acting as reservoirs for viruses. Thus, this study aimed to investigate virus occurrence in weeds at the main watermelon-growing regions in the State of Tocantins. Viruses identification (e.g. potyviruses: Watermelon mosaic virus - WMV; Papaya ring spot virus - type watermelon -PRSV-W; Zucchini yellow mosaic virus- ZYMV; the cucumovirus Cucumber mosaic virus - CMV, and the orthotospovirus Zucchini lethal chlorosis virus - ZLCV) infecting weeds was performed by serology and confirmed by RT-PCR tests. Serological and molecular test results indicate that Amaranthus spinosus, Nicandra physaloides, Physalis angulata and Heliotropium indicum were infected by at least one virus species. The highest infection rate was represented by ZYMV (52.7%), followed by PRSV-W (22.2%); CMV, WMV, and ZLCV that showed the same infection rate (8.3%) each. Plants of P. angulata were infected by all five viruses, singly or in mixed infection, and represented 50% of the total number of infected samples. The highest virus infection rates, 50% and 44.4%, occurred in weeds collected at Lagoa da Confusão and Formoso do Araguaia, respectively. The results on occurrence and distribution of viruses infecting weeds in watermelon commercial plantations in the State of Tocantins provide important information about the role of weeds as virus reservoirs contribute to the knowledge of the epidemiology of these diseases, and enable a proper weed management aiming at reducing the secondary spreading control of viruses by insect vectors.

Cucurbit-infecting viruses in Brazil

Cucurbit crops are grown throughout many Brazilian states and are affected by several viral diseases that represent one of the main constraints to cucurbit production in the country causing severe economic losses. During 2008-2015, a survey was performed in open-field of watermelon (Citrullus lanatus), melon (Cucumis melo), cucumber (C. sativus), pumpkin (Cucurbita spp.), chayote (Sechium edule), and gherkin (C. anguria) crops to determine distribution and relative incidence of six viruses. More than 1050 leaf samples were collected from plants showing virus-like symptoms in more than 20 counties of eight Brazilian states (Goias, Bahia, Sao Paulo, Alagoas, Pernambuco, Ceara, Rio Grande do Norte, and Maranhao) and the Federal District. Samples were screened by dot-ELISA or DAS-ELISA tests using polyclonal antibodies to investigate the occurrence of Papaya ringspot virus-type watermelon (PRSV-W), Watermelon mosaic virus (WMV), Zucchini yellow mosaic virus (ZYMV), Cucumber mosaic virus (CMV), Zucchini lethal chlorosis virus (ZLCV), and Melon yellowing-associated virus (MYaV). In addition, total DNA obtained from leaf samples was tested for geminivirus infections by PCR using a pair of universal primers. Serological tests results indicated that approximately 60% of the samples were infected with at least one of the viruses tested. PRSV-W (40.89%) and ZYMV (25.46%) were the most prevalent viruses detected in all cucurbit species. WMV and CMV were found at low percentage in the leaf samples, 8.76 and 5.02%, respectively. MYaV (22.46%) occurred mainly in melon, while ZLCV (18.11%) was detected mostly infecting watermelon and pumpkins. The occurrence of mixed infection was observed in 17.41% of the leaf samples, especially in combination with PRSV-W. None of the samples tested positive for geminivirus infection by PCR. These data confirm the economic importance of cucurbit-infecting viruses in different Brazilian regions.

Development of a microarray for simultaneous detection and differentiation of different tospoviruses that are serologically related to Tomato spotted wilt virus

BackgroundTospoviruses, the plant-infecting genus in the family Bunyaviridae, are thrips borne and cause severe agricultural losses worldwide. Based on the serological relationships of the structural nucleocapsid protein (NP), the current tospoviruses are divided into six serogroups. The use of NP-antisera is convenient for virus detection, but it is insufficient to identify virus species grouped in a serogroup due to the serological cross-reaction. Alternatively, virus species can be identified by the N gene amplification using specific primers. Tomato spotted wilt virus (TSWV) is the type species of the genus Tospovirus and one of the most destructive plant viruses. Eight known tospoviruses, Alstroemeria necrotic streak virus (ANSV), Chrysanthemum stem necrosis virus (CSNV), Groundnut ringspot virus (GRSV), Impatiens necrotic spot virus (INSV), Melon severe mosaic virus (MeSMV), Pepper necrotic spot virus (PNSV), Tomato chlorotic spot virus (TCSV) and Zucchini lethal chlorosis virus (ZLCV), sharing serological relatedness with TSWV in NP, are grouped in the TSWV serogroup. Most of the TSWV-serogroup viruses prevail in Europe and America. An efficient diagnostic method is necessary for inspecting these tospoviruses in Asia, including Taiwan.MethodsA microarray platform was developed for simultaneous detection and identification of TSWV-serogroup tospoviruses. Total RNAs extracted from Chenopodium quinoa leaves separately inoculated with ANSV, CSNV, GRSV, INSV, TCSV and TSWV were used for testing purposes. The 5’-biotinylated degenerate forward and reverse primers were designed from the consensus sequences of N genes of TSWV-serogroup tospoviruses for reverse transcription-polymerase chain reaction (RT-PCR) amplification. Virus-specific oligonucleotide probes were spotted on the surface of polyvinyl chloride (PVC) chips to hybridize with PCR products. The hybridization signals were visualized by hydrolysis of NBT/BCIP with streptavidine-conjugated alkaline phosphatase. The microarray was further applied to diagnose virus infection in field crop samples.ResultsAmplicons of approximately 0.46 kb were amplified from all tested TSWV-serogroup tospoviruses by RT-PCR using the degenerate primer pair Pr-dTS-f/Pr-dTS-r. Virus species were identified on chips by hybridization of PCR products with respective virus-specific probes. The microarray was successfully used to diagnose TSWV infection in field pepper samples.ConclusionsIn this study, a rapid, sensitive and precise microarray method has been developed to simultaneously detect and identify six TSWV-serogroup tospoviruses. The microarray platform provides a great potential to explore tospoviruses that can help researchers and quarantine staff to prevent invasions of tospoviruses.

A TaqMan real-time RT-PCR assay for detection of Groundnut ringspot virus.

Groundnut ringspot virus (GRSV) is a tospovirus species transmitted in a circulative propagative manner by several thrips species. Traditionally, GRSV is detected by enzyme-linked immunosorbent assay (ELISA) and reverse transcription polymerase chain reaction (RT-PCR), so this paper describes a rapid diagnostic system for the reliable detection of GRSV in plants and individual thrips by real-time RT-PCR. Watermelon GRSV infected leaves and fruits, and individual thrips (Frankliniella schultzei) collected from flowers on infected watermelons were used in the test. We designed a GRSV TaqMan assay to efficiently detect GRSV in all samples. The method had high specificity and could distinguish GRSV from the other tospovirus species, like Tomato spotted wilt virus (TSWV), Tomato chlorotic spot virus (TCSV) and Zucchini lethal chlorosis virus (ZLCV). The test will help us to collect epidemiological data for GRSV in plants and thrips worldwide.

The complete genome of the tospovirus Zucchini lethal chlorosis virus.

BackgroundZucchini lethal chlorosis virus (ZLCV) causes significant losses in the production of cucurbits in Brazil. This virus belongs to the genus Tospovirus (family Bunyaviridae) and seems to be exclusively transmitted by Frankliniella zucchini (Thysanoptera). Tospoviruses have a tripartite and single-stranded RNA genome classified as S (Small), M (Medium) and L (Large) RNAS. Although ZLCV was identified as a member of the genus Tospovirus in 1999, its complete genome had not been sequenced until now.FindingsWe sequenced the full-length genome of two ZLCV isolates named ZLCV-SP and ZLCV-DF. The phylogenetic analysis showed that ZLCV-SP and ZLCV-DF clustered with the previously reported isolate ZLCV-BR09. Their proteins were closely related, except the non-structural protein (NSm), which was highly divergent (approximately 90 % identity). All viral proteins clustered similarly in our phylogenetic analysis, excluding that these ZLCV isolates have originated from reassortment events of different tospovirus species.ConclusionHere we report for the first time the complete genome of two ZLCV isolates that were found in the field infecting zucchini and cucumber.Electronic supplementary materialThe online version of this article (doi:10.1186/s12985-016-0577-4) contains supplementary material, which is available to authorized users.

Identification of natural hosts of Zucchini lethal chlorosis virus

Zucchini lethal chlorosis virus (ZLCV) is a species of the genus Tospovirus, in the family Bunyaviridae, and is transmitted by thrips (Frankliniella zucchini). To date, ZLCV has only been reported in Brazil, where it causes a disease known as lethal chlorosis of zucchini squash. The aim of this study was to identify additional species susceptible to ZLCV through natural infection in the field and to provide subsidies for the establishment of management strategies for the disease. Six hundred fifty-three samples belonging to 44 plant species representing 13 families were analyzed using PTA-ELISA. ZLCV naturally infected the following species: Cucumis anguria (1/12), Datura stramonium (1/59) and Luffa aegyptiaca (1/3). This work provides evidence that the main natural hosts of this tospovirus are concentrated in the cucurbit family. Presently, the management of inoculum sources can minimize the damage caused by this tospovirus.

Serological Identification of Virus in Watermelon Production Fields in the Tocantins State

Watermelon (Citrullus lanatus) cultivated in almost all tropical and subtropical regions of the world, has its largest output in China, and then, according to FAO data, Turkey, Iran and Brazil, being one of the main crops cultivated in State of Tocantins, Brazil. In this work was investigated the occurrence and distribution of the watermelon viruses, totaling 752 samples taken in a stratified experimental design in four representative regions of production: Gurupi (150), Lagoa da Confusao (232), Formoso do Araguaia (265) and Porto Nacional (105). The sampling and collecting the leaves of plants with the presence of symptoms were performed once a week during the entire cultivation cycle. As a result, were observed by Dot-ELISA method, different types of viruses, such as Papaya ringspot W (PRSV-W), Zucchini yellow mosaic virus (ZYMV), Watermelon mosaic virus (WMV) (potyvirus), Cucumber mosaic virus ( CMV) (Cucumovirus) and Zucchini lethal chlorosis virus (ZLCV) (Tospovirus). Of these, PRSV-W was predominant (22%), followed by WMV (15%), ZLCV (11%), CMV (5%) and ZYMV (4%). Mixed infections with PRSV-W + WMV and PRSV-W + ZLCV were also observed around 20% frequency (expressed with symptoms differently from a single infection). The results provide important support for the program management viruses.

Comparative Epidemiology of Three Virus Diseases on Zucchini Squash

AbstractZucchini yellow mosaic virus (ZYMV), Papaya ringspot virus – type W (PRSV‐W) and Zucchini lethal chlorosis virus (ZLCV) cause important diseases on zucchini squash crops in Brazil. ZYMV and PRSV‐W belong to the genus Potyvirus and are transmitted by aphids, whereas ZLCV belongs to Tospovirus and is transmitted by the thrips Frankliniella zucchini. These three viruses may occur simultaneously in the field, and the epidemiology of the corresponding diseases may be determined by interactions among viruses, hosts and vectors. In this work, the progress of the diseases caused by these viruses was studied over a temporal and geographic range for three planting seasons (PS). For the lethal chlorosis (ZLCV), a monomolecular model was found to be the best fit for the data, though only during the third PS. For data collected during the first two PS, the Gompertz model was found to fit the data best. The spatial distribution of disease indicated disease aggregation at the end of the crop cycle. For the yellow mosaic (ZYMV), the model that best fit in the 1st PS was the logistic and in the 2nd and 3rd PS was monomolecular. The spatial pattern of the disease was random when the disease incidence was low but aggregated when the disease incidence was high. The common mosaic (PRSV‐W) showed the lowest incidence in all three PS. An exponential model was the best fit for data collected during all PS, and the spatial pattern of the disease was random. Interactions among the three viruses apparently did not result in changes in the epidemiology of the diseases. Removal of sources of inoculum and planting at an unfavourable time for reproduction of virus vectors are the two main measures recommended for the control of these diseases. The use of insecticide is indicated only for the control of the F. zucchini.

Spatiotemporal Dynamics of Zucchini Squash Lethal Chlorosis and its Relationship with the Frankliniella zucchini Population

Lethal chlorosis of cucurbits, caused by the tospovirus Zucchini lethal chlorosis virus (ZLCV), is an important disease in the Brazilian zucchini squash crop. The virus is transmitted by the thrips Frankliniella zucchini. Progress of the disease in time and space was studied in zucchini squash experimental fields to better understand disease epidemiology. Nine independent experiments were carried out between December 2006 and September 2010. The effects of the disease were assessed every 2–7 days, depending on the experiment. The thrips population was monitored in five of these experiments. For disease progress over time, four models (exponential, monomolecular, logistic and Gompertz) were tested. Disease progress in space analysis included both the index of dispersion and Taylor’s power law. The monomolecular model was the best fit to the disease incidence data, and spatial analysis indicated aggregated diseased plants at the end of the season in most experiments. A correlation was detected between the number of collected thrips and the incidence of zucchini squash lethal chlorosis. The results indicate that the thrips population significantly contributed to the primary spread of disease incidence. We propose that disease management should focus mainly on the elimination of the source of the inoculum.

The wild type of Momordica charantia is not infected by potyviruses that cause disease in papaya and cucurbit crops

In the present work, the susceptibility of wild and domesticated plants of Momordica charantia to viruses from the genus Potyvirus that cause diseases in papaya (Carica papaya) and cucurbit crops was evaluated. The plants were subjected to experimental and natural infection with Papaya ringspot virus types P and W (PRSV-P and PRSV-W) and Zucchini yellow mosaic virus (ZYMV). None of the potyviruses infected the wild type of M. charantia through mechanical or aphid inoculation or under field exposition, whereas the domesticated type was only infected by isolates of ZYMV. In addition, both wild and domesticated types of M. charantia were not infected in natural conditions by an isolate of Zucchini lethal chlorosis virus, genus Tospovirus, transmitted by Frankliniella zucchini. These data clearly indicated that this wild type of M. charantia does not seem to have a role in the epidemiology of the diseases caused by these three potyviruses in Brazil.

Fevillea trilobata as a Natural Host of Zucchini yellow mosaic virus in Brazil.

The antidote vines or nhandirobas (Fevillea trilobata L. [Cucurbitaceae]) are dioecious plant species native to the South American Neotropics (1). Genetic materials of these species are now being domesticated and evaluated as potential crops for seed-oil extraction aiming to produce biodiesel fuel (2). Plants of F. trilobata (Accession No. CNPH-001) were cultivated from seeds under open field conditions during the years 2008 through 2011 in Brasília-DF, Brazil. Approximately 200 plants exhibiting mosaic symptoms and severe leaf malformation (with typical bubble-like patches) were found in all fields every year. Apical mosaic was slightly more severe in female than in male plants. Electron microscopy examination of negatively stained extracts of symptomatic leaf tissue showed the presence of filamentous particles about 700 to 800 nm long. Analysis of ultra-thin sections of the same tissues revealed the presence of lamellar inclusions typical of a potyvirus infection. No aphid colonies were observed on field-grown F. trilobata plants. The virus was mechanically transmitted to healthy Cucurbita pepo cv. Caserta and Luffa cylindrica, causing systemic mosaic. Sap from these infected plants reacted in PTA-ELISA with polyclonal antiserum against Zucchini yellow mosaic virus (ZYMV), but not with antisera against Papaya ringspot virus - type W (PRSV-W), Cucumber mosaic virus (CMV), and Zucchini lethal chlorosis virus (ZLCV). Total RNA extracted from experimentally infected C. pepo was analyzed by RT-PCR using specific pairs of primers for the coat protein gene of ZYMV (3). A cDNA fragment of approximately 1,186 bp was amplified and the nucleotide sequence obtained by direct sequencing. Comparisons of the nucleotide (837 nt) and deduced amino acid (279 aa) sequences of the coat protein genomic segment (GenBank Accession No. JX502677) revealed 93 to 98% and 97 to 98% identity, respectively, with the corresponding nucleotide and amino acid sequences of a group of ZYMV isolates from distinct hosts (AY188994, AY279000, and NC_003224). The infection by ZYMV might cause fruit yield losses to F. trilobata. In addition, the infected F. trilobata crops might work as a reservoir of ZYMV providing inoculum to other cucurbit hosts since it has been managed as a semi-perennial crop. To our knowledge, this is the first report of the genus Fevillea as a natural host of ZYMV.

Scientific Opinion on the pest categorisation of the tospoviruses

The European Commission requested EFSA's Panel on Plant Health to perform the pest categorisation for the 24 viruses of the Tospovirus genus for the EU territory. The following tospoviruses were analysed: Tomato spotted wilt virus (TSWV), Impatiens necrotic spot virus (INSV), Iris yellow spot virus (IYSV), Polygonum ringspot virus (PolRSV), Groundnut ringspot virus (GRSV), Tomato chlorotic spot virus (TCSV), Alstroemeria necrotic streak virus (ANSV), Chrysanthemum stem necrosis virus (CSNV), Melon severe mosaic virus (MSMV), Tomato yellow (fruit) ring virus (TYRV), Tomato zonate spot virus (TZSV), Groundnut yellow spot virus (GYSV), Groundnut chlorotic fan-spot virus (GCFSV), Groundnut bud necrosis virus (GBNV), Zucchini lethal chlorosis virus (ZLCV), Capsicum chlorosis virus (CaCV), Watermelon bud necrosis virus (WBNV), Watermelon silver mottle virus (WSMoV), Tomato necrotic ringspot virus (TNRV), Calla lily chlorotic spot virus (CCSV), Melon yellow spot virus (MYSV), Soybean vein necrosis associated virus (SVNaV), Bean necrotic mosaic virus (BeNMV) and Pepper necrotic spot virus (PNSV). In reaching its conclusions, the Panel considered four parameters to be of critical importance in the risk assessment area: (i) the presence of a tospovirus, (ii) the existence of host plants, (iii) the existence of thrips vector species and (iv) the potential for damage to crops grown in Europe. Based on its analysis, the Panel concluded that the 24 viruses analysed could be allocated to four different risk groups. Seven viruses (GRSV, TCSV, ANSV, CSNV, MSMV, TYRV, TZSV) for which both thrips species vectors and natural or experimental hosts crops are present in the EU territory were considered by the Panel to represent the highest risk to the EU territory. In contrast, three viruses (INSV, IYSV and PolRSV) already present in the risk assessment area were not considered by the Panel to pose a risk justifying the development of full risk assessments.

First report of a tospovirus in a commercial crop of Cape gooseberry in Brazil

Viruses from the genus Tospovirus (family Bunyaviridae) are widespread in the Americas, where the following species have been reported: Tomato chlorotic spot virus (TCSV), Tomato spotted wilt virus (TSWV), Groundnut ringspot virus (GRSV), Chrysanthemum stem necrosis virus (CSNV), Zucchini lethal chlorosis virus (ZLCV), Impatiens necrotic spot virus (INSV), Iris yellow spot virus (IYSV) (Jones, 2005), Alstroemeria necrotic streak virus (ANSV), Melon severe mosaic virus (MeSMV) and Bean necrotic mosaic virus (BeNMV) (Ciuffo et al., 2009; Hassani-Mehraban et al., 2010; Oliveira et al., 2011). This work describes the identification of a virus isolated from a commercial crop of Cape gooseberry (Physalis peruviana) in October 2009 in Santa Maria, State of Rio Grande do Sul, Brazil. The disease was identified in a 5 ha cultivated area, where 100% of the plants were showing symptoms of stunting, mosaic, necrosis and foliar distortion (Fig. 1). Spherical particles measuring 80-100 nm in diameter were observed by electron microscopy, giving the initial evidence that a tospovirus might be involved in the disease. Sap from the infected leaves of five different Cape gooseberry plants were inoculated on healthy indicator plants: Petunia hybrida and Chenopodium amaranticolor reacted with local lesions; Datura stramonium, Solanum gilo, S. lycopersicum, S. nigrum, Physalis angulata, P. floridana and P. peruviana (Fig. 1) displayed systemic symptoms. Host reactions were typical for those caused by tospoviruses and symptoms on Physalis species reproduced those observed in the original samples. Testing by plate trapped-ELISA, a positive reaction was only obtained from all five samples using anti-TCSV antiserum (Embrapa, CNPH, Brazil). Negative ELISA results were obtained using antiserum against four other tospoviruses: Tomato spotted wilt virus, Groundnut ringspot virus, Impatiens necrotic spot virus and Chrysanthemum stem necrosis virus. RT-PCR was performed using primers designed to conserved regions of the tospoviral S RNA (Eiras et al., 2001). This generated 440 bp DNA fragments, whose sequence revealed a high degree of nucleotide identity with TCSV isolates from Argentina (98-99%) and Brazil (93-95%). Alignment of the partial coat protein nucleotide sequences showed that the Physalis TCSV isolate (GenBank Accession No. JQ034525) clustered with other TCSV isolates, sharing a clade with Argentinean isolates (Fig. 2). Cape gooseberry is a fruit crop of great nutritional and economic value, which has gradually gained acceptance in international markets, due to its flavour and medicinal properties. In Brazil, it was introduced as a commercial crop into small farms in southern Brazil (Rufato et al., 2008). To our knowledge, this is the first report of natural occurrence of TCSV in commercial crops of Cape gooseberry. To date the disease is restricted to Rio Grande do Sul State. Further epidemiological studies are necessary for understanding the spread of TCSV into this relatively new introduced crop in Brazil.

Sequence determination and analysis of the NSs genes of two tospoviruses

The tospoviruses groundnut ringspot virus (GRSV) and zucchini lethal chlorosis virus (ZLCV) cause severe losses in many crops, especially in solanaceous and cucurbit species. In this study, the non-structural NSs gene and the 5'UTRs of these two biologically distinct tospoviruses were cloned and sequenced. The NSs sequence of GRSV and ZLCV were both 1,404 nucleotides long. Pairwise comparison showed that the NSs amino acid sequence of GRSV shared 69.6% identity with that of ZLCV and 75.9% identity with that of TSWV, while the NSs sequence of ZLCV and TSWV shared 67.9% identity. Phylogenetic analysis based on NSs sequences confirmed that these viruses cluster in the American clade.

First Report of Papaya ringspot virus-Type W and Zucchini yellow mosaic virus Infecting Trichosanthes cucumerina in Brazil.

Trichosanthes cucumerina L., known as snake gourd, is a cucurbitaceous plant that is probably native to and originally domesticated in India. It is cultivated in humid subtropical and tropical countries of Australia, Latin America, and Africa (2). Plants of this species exhibiting symptoms of mosaic and leaf malformation were found during November 2008 near an experimental field of the Departamento de Fitopatologia e Nematologia, Universidade de São Paulo, Piracicaba, State of São Paulo, Brazil. Electron microscopy examination of negatively stained extract of infected tissue showed the presence of filamentous potyvirus-like particles. Sap from these infected plants reacted in plate-trapped antigen (PTA)-ELISA with the antiserum against Papaya ringspot virus-type W (PRSV-W) or Zucchini yellow mosaic virus (ZYMV), but not with the antiserum against Cucumber mosaic virus (CMV) or Zucchini lethal chlorosis virus (ZLCV). PRSV-W and ZYMV were simultaneously transmitted by mechanical inoculation to four plants of Cucurbita pepo cv. Caserta and one plant of T. cucumerina, causing mosaic. In addition, PRSV-W and ZYMV isolates from our virus collection separately infected one plant of T. cucumerina after mechanical inoculation. Infections were confirmed by PTA-ELISA. Total RNA extracted from infected and healthy T. cucumerina was analyzed by reverse transcription (RT)-PCR using a primer pair specific to the coat protein (CP) gene of PRSV-W (4) or ZYMV (3). Fragments of 864 bp and 1,045 bp were amplified with each pair of primers, respectively. Nucleotide sequences directly obtained from purified PCR products were used for further identification of these potyviruses. The nucleotide and deduced amino acid sequences of part of the CP gene (792 nt) of PRSV-W (GenBank Accession No. GU586789) shared 99 and 98% identity, respectively, with that of the Brazilian isolate PRSV-W-C (GenBank Accession No. 4152). The nucleotide and deduced amino acid sequences of the entire CP gene (837 nt) of ZYMV (GenBank Accession No. 6790) shared 91 to 98% and 94 to 100% identity, respectively, with innumerous isolates of ZYMV deposited in the GenBank (e.g., Accession Nos. AB004640, D13914, AB004641, and AJ420019). Natural infection of T. cucumerina by PRSV-W was reported in Nepal (1). To our knowledge, this is the first report of T. cucumerina infected by PRSV-W and ZYMV in Brazil.

Danos causados pelo Zucchini lethal chlorosis virus (ZLCV) sobre a produção de frutos comerciais de abobrinha de moita 'Caserta'

O ZLCV é um tospovírus encontrado com freqüência causando severos danos em cucurbitáceas. Nesse trabalho avaliaram-se os danos causados pelo ZLCV em abobrinha de moita 'Caserta', em campo na ESALQ/USP, Piracicaba-SP, onde esse vírus é freqüente. Plantas obtidas pela semeadura direta foram monitoradas periodicamente quanto à infecção pelo ZLCV por meio dos sintomas e por PTA-ELISA. Monitorou-se ainda a contaminação com Papaya ringspot virus - type W e Zucchini yellow mosaic virus, desconsiderando a produção dessas plantas. As plantas foram agrupadas em função da época de aparecimento dos sintomas do ZLCV, avaliando a produção de frutos comerciais (FC) e não comerciais (FNC) de cada grupo e comparando com a de plantas que permaneceram sem sintomas até o final do experimento. As plantas que apresentaram sintomas até os 23 dias após a emergência (DAE) não produziram qualquer tipo de frutos. FC foram colhidos de plantas que apresentaram sintomas a partir dos 42 DAE. Mesmo assim, houve redução de 78,5 % na produção de FC. Plantas que mostraram sintomas por ocasião da última colheita (55 DAE) apresentaram redução na produção de FC de 9,6 %. A infecção com o ZLCV até o início da frutificação inviabiliza a produção de FC de abobrinha de moita 'Caserta'.