Zealand Isolates Research Articles

Phylogenetic lineages of tuberculosis isolates in New Zealand and their association with patient demographics

In New Zealand, the lineage genotypes of Mycobacterium tuberculosis clinical isolates and their role in the epidemiology of tuberculosis (TB) are currently unknown. 1) To measure the relative frequency of each phylogenetic lineage of the M. tuberculosis complex in New Zealand, and 2) to examine its relationship with patient demographics and multidrug-resistant TB (MDR-TB). All non-duplicate M. tuberculosis complex isolates recovered in 2010 and 2011 underwent large sequence polymorphism and/or single nucleotide polymorphism analyses. Mycobacterial interspersed repetitive units (MIRU) profiling was also performed for cluster identification. New Zealand isolates were dominated by lineage 4 (Euro-American: 37.8%, 95%CI 33.6-42.2), followed by lineage 1 (Indo-Oceanic: 22.6%, 95%CI 19.1-26.5), lineage 2 (East Asian: 19.5%, 95%CI 16.2-23.3) and lineage 3 (East-African Indian, which included Central Asian: 17.7%, 95%CI 14.5-21.3). Lineage 2 accounted for 58.1% of MDR-TB cases from 2002 to 2011. Among immigrants, the predominant lineages corresponded to high prevalence lineages in the country of origin. In New Zealand-born individuals, Māori and NZ Europeans share the same predominant lineage, lineage 4, with a higher proportion of non-unique MIRU types observed in Māori cases. Lineage 3 was more prevalent in Māori than in NZ Europeans. In New Zealand, M. tuberculosis complex phylogenetic lineage is associated with TB epidemiology in terms of ethnicity, country of origin and MDR-TB.

Experimental exposure indicates the amphibian chytrid pathogen poses low risk to New Zealand's threatened endemic frogs

AbstractThe spread of chytridiomycosis, an emerging infectious disease caused by the fungal pathogen Batrachochytrium dendrobatidis (Bd), is one of many threats facing amphibians worldwide. Ascertaining the severity of this threat to particular amphibian species is necessary if managers are to prioritize conservation actions. In New Zealand, Bd has been detected on both threatened endemic (Leiopelma spp.) and widespread introduced (Litoria spp.) anuran species, but Le. archeyi, one of four native species, has demonstrated low susceptibility to chytridiomycosis in captivity. To determine potential impacts of Bd on New Zealand's native anuran fauna, we assessed the susceptibility of two native species, Le. pakeka and Le. hochstetteri, to chytridiomycosis. We exposed Bd‐naïve individuals to a virulent New Zealand isolate of Bd, and monitored infection status with quantitative real‐time polymerase chain reaction. Both species demonstrated low susceptibility and all individuals cleared Bd infection (Le. hochstetteri by week 10, Le. pakeka by week 15). Furthermore, no frogs demonstrated clinical signs of chytridiomycosis. Since Le. archeyi has similarly demonstrated low susceptibility, this appears to be a genus‐wide trend, which warrants further study of the mechanism of this response. These findings, in agreement with results from field surveys and analyses of skin peptide defenses, suggest that Bd poses a low risk to leiopelmatids. An investigative study of potential susceptibility to Bd, such as this one, can better equip managers to target imminent threats and focus conservation plans for at‐risk amphibian fauna.

Pseudomonas syringae pv. actinidiae (PSA) isolates from recent bacterial canker of kiwifruit outbreaks belong to the same genetic lineage.

Intercontinental spread of emerging plant diseases is one of the most serious threats to world agriculture. One emerging disease is bacterial canker of kiwi fruit (Actinidia deliciosa and A. chinensis) caused by Pseudomonas syringae pv. actinidiae (PSA). The disease first occurred in China and Japan in the 1980s and in Korea and Italy in the 1990s. A more severe form of the disease broke out in Italy in 2008 and in additional countries in 2010 and 2011 threatening the viability of the global kiwi fruit industry. To start investigating the source and routes of international transmission of PSA, genomes of strains from China (the country of origin of the genus Actinidia), Japan, Korea, Italy and Portugal have been sequenced. Strains from China, Italy, and Portugal have been found to belong to the same clonal lineage with only 6 single nucleotide polymorphisms (SNPs) in 3,453,192 bp and one genomic island distinguishing the Chinese strains from the European strains. Not more than two SNPs distinguish each of the Italian and Portuguese strains from each other. The Japanese and Korean strains belong to a separate genetic lineage as previously reported. Analysis of additional European isolates and of New Zealand isolates exploiting genome-derived markers showed that these strains belong to the same lineage as the Italian and Chinese strains. Interestingly, the analyzed New Zealand strains are identical to European strains at the tested SNP loci but test positive for the genomic island present in the sequenced Chinese strains and negative for the genomic island present in the European strains. Results are interpreted in regard to the possible direction of movement of the pathogen between countries and suggest a possible Chinese origin of the European and New Zealand outbreaks.

First Report of Cherry leaf roll virus in Hydrangea macrophylla.

Hydrangea is a popular, summer flowering, ornamental shrub that is native to south and east Asia and North and South America, which is now cultivated throughout the world. Currently, 13 viruses belonging to eight genera have been reported in Hydrangea spp. (1). In April 2011, virus-like disease symptoms, including severe leaf deformation and chlorosis, were observed on two Hydrangea macrophylla 'Sumiko' plants from Australia being held in quarantine in New Zealand. Systemic symptoms of veinal necrosis, necrotic halo spots, and severe leaf deformation were observed on Nicotiana occidentalis '37B' 7 days after inoculation with sap from the symptomatic hydrangea plants. Upon reinoculation with sap of symptomatic leaves from N. occidentalis, necrotic ringspots and tip necrosis, typical of nepovirus infection, were observed on leaves of N. tobacum and Chenopodium quinoa, respectively. Transmission electron microscopy of negatively stained sap from symptomatic leaves of N. occidentalis revealed the presence of isometric particles ~28 nm in diameter. Total nucleic acid was extracted from the symptomatic leaves of N. occidentalis with an InviMag Plant DNA Mini Kit (Invitek GmbH, Berlin, Germany) and a KingFisher mL workstation (Thermo Scientific, Waltham, MA). Reverse transcription (RT)-PCR using the reverse primer of Werner et al. (2) and a forward primer, 5'-CGGTGGAGATGCCGGTCCTA-3' (this study), specific to the 3'-untranslated region (3'-UTR) of Cherry leaf roll virus(CLRV) produced an amplicon of ~1,150 bp from N. occidentalis. A consensus sequence of 1,140 bp generated from four clones of the PCR product (GenBank Accession No. JN418885) was 99 and 98% identical at the nucleotide level to a CLRV isolate from Rumex AGBC (GenBank No. AB168099) and Chinese chives (GenBank No. AB168098), respectively. N. occidentalis also tested positive for CLRV using polyclonal antiserum in a double antibody sandwich-ELISA (BIOREBA, Reinach, Switzerland). The presence of CLRV in the original samples and N. occidentalis was confirmed by direct sequencing of the 380-bp amplicons obtained by immunocapture RT-PCR using CLRV-specific primers (2) and the same antiserum. BLASTn analysis of these amplicons (data not submitted to GenBank) also showed 99% nucleotide identity to a New Zealand isolate from a Rubus sp. (GenBank No. AJ877162). The hydrangea plants were released from quarantine because the same strain of CLRV had previously been reported in New Zealand. To our knowledge, this is the first report of CLRV in hydrangea. CLRV is a seed and pollenborne nepovirus and can be transmitted mechanically and by grafting. Since hydrangeas are mainly vegetatively propagated and are less commonly grown from seeds, the natural spread of CLRV will depend on the movement of infected propagation material. It is unknown whether this virus causes reduction in flower quality in hydrangea as reported in other hosts but any impact on flower quality may be of economic significance in commercial nurseries.

MULTILOCUS SEQUENCE TYPING OF ‘CANDIDATUS LIBERIBACTER SOLANACEARUM’ ISOLATES FROM NORTH AMERICA AND NEW ZEALAND

SUMMARY ‘Candidatus Liberibacter solanacearum’ is associated with Zebra Chip (ZC) disease of potato. ZC disease has seriously affected potato cultivation in North America and New Zealand. Genotyping ‘Ca. L. solanacearum’ isolates in different geographical regions will reveal genetic diversity and the epidemiological relationships of diseases associated with this bacterium. In this study, a panel of 10 multilocus sequence typing (MLST) markers for ‘Ca. L. solanacearum’ was developed and used to characterize genetic relationships among ‘Ca. L. solanacearum’ isolates in North America (USA and Mexico) and New Zealand. MLST analysis detected two sequence types (ST-1 and ST-2) for each of the 10 loci. Both types are present among US isolates while only one type was detected in Mexico (ST-1) and New Zealand (ST-2) isolates, respectively. This marker system provides a useful tool for genotyping and assessing genetic diversity of ‘Ca. L. solanacearum’ populations.

Production of pinnatoxins E, F and G by scrippsielloid dinoflagellates isolated from Franklin Harbour, South Australia

A pinnatoxin producing dinoflagellate was isolated in cyst form from sediments from Franklin Harbour, South Australia, December 2009. One isolate (CAWD180) produced pinnatoxin G, E, F and A (87, 10, 41 and 1.3 pg/cell respectively; liquid chromatograph–mass spectrometer, LC-MS, analysis) and another (CAWD183) produced pinnatoxin G only (13 pg/cell). Australian strains were identical to pinnatoxin E and F producers isolated from Northland, New Zealand (2008), based on large subunit (LSU) rDNA and ITS spacer region sequence data. Cysts were capable of division and produced more toxin per cell than the excysted motile form. Crude extracts of mass cultures were tested for toxicity in mice by intraperitoneal (i.p.) injection, gavage and voluntary consumption, and toxicity ratios were 1.0:1.8:4.5 (CAWD180) and 1.0:2.9:7.8 (CAWD183). This is similar to the ratios for New Zealand isolates, but differs from other cyclic imines for which oral toxicity can be 10–1000-fold less than i.p. administration.

First Report of a Carlavirus in Fuchsia spp. in New Zealand.

The genus Fuchsia has 110 known species and numerous hybrids. These ornamental plants with brightly colored flowers originate from Central and South America, New Zealand, and Tahiti, but a wider variety are now grown all over the world. Few viruses have been reported in Fuchsia spp.: a carlavirus, Fuchsia latent virus (FLV) (1-3), a cucumovirus, Cucumber mosaic virus (CMV) (3), and two tospoviruses, Impatiens necrotic spot virus (INSV) and Tomato spotted wilt virus (TSWV) (4). In August 2009, five plants, each representing a different cultivar of Fuchsia hybrid, from home gardens in the Auckland and Southland regions of New Zealand, displayed variable symptoms including mild chlorosis, mild mottle, or purple spots on leaves. Plants tested negative for CMV, INSV, and TSWV using commercial ImmunoStrips (Agdia Inc., Elkhart, IN); however, flexuous particles of ~650 to 700 nm were found by electron microscopy in all samples. Local lesions were also observed on Chenopodium quinoa plants 4 weeks after sap inoculation. Total RNA was extracted from all plants with a RNeasy Plant Mini Kit (Qiagen Inc., Doncaster, Australia) and tested by reverse transcription (RT)-PCR using two generic sets of primers (R. van der Vlugt, personal communication) designed to amplify fragments of ~730 and 550 bp of the replicase and coat protein genes of carlaviruses, respectively. Amplicons of the expected size were obtained for all samples, cloned, and at least three clones per sample were sequenced. No differences within clones from the same samples were observed (GenBank Accession Nos. HQ197672 to HQ197681). A BLASTn search of the viral replicase fragment showed the highest nucleotide identity (76%) to Potato rough dwarf virus (PRDV) (EU020009), whereas the coat protein fragment had maximum nucleotide identity (70 to 72%) to PRDV (EU020009 and DQ640311) and Potato virus P (DQ516055). Sequences obtained were also pairwise aligned using the MegAlign program (DNASTAR, Inc., Madison, WI) and results showed that the isolates had 83 to 97% identity to each other within each genome region. Further sequences (HQ197925 and HQ197926) were obtained from a Fuchsia plant originating from Belgium, a BLASTn analysis showed high nucleotide identity (84 to 99%) to the New Zealand isolates. The low genetic identity to other Carlavirus members suggests that these isolates belong to a different species from those previously sequenced. On the basis of electron microscopy and herbaceous indexing, the isolates had similar characteristics to a carlavirus reported from Fuchsia in Italy (1) and FLV reported in Canada (2). The Italian carlavirus isolate was obtained and tested with the same primers by RT-PCR. Pairwise analysis of the Italian sequences (HQ197927 and HQ197928) with the New Zealand and Belgian sequences showed between 84 and 95% similarity within each genome region. These results suggest that the carlavirus infecting these plants is the same virus, possibly FLV. To our knowledge, this is the first report of this carlavirus infecting Fuchsia spp. in New Zealand, but the virus has probably been present for some time in this country and is likely to be distributed worldwide.

Comparison of 45 variable number tandem repeat (VNTR) and two direct repeat (DR) assays to restriction endonuclease analysis for typing isolates of Mycobacterium bovis

Restriction endonuclease analysis (REA), developed 25 years ago for genotyping Mycobacterium bovis strains, is an important tool for bovine tuberculosis control in New Zealand. While REA gives excellent discrimination, it is technically difficult to perform compared to PCR-based typing systems which are faster and simpler to operate. Genotyping of M. bovis by the use of variable number tandem repeat loci (VNTR) and spoligotyping, either alone or together, has now become the preferred approach for typing M. bovis. Here, we evaluated the widest range of VNTR loci yet investigated for M. bovis, including two VNTR loci not previously studied, one of which (4155) had particular utility for characterizing New Zealand isolates. VNTR typing provided substantial geographical resolution of 26 of the most commonly found REA types and this was improved by the addition of two PCR assays based on parts of the direct repeat (DR) locus. Overall, 68 REA types of M. bovis common in New Zealand were discriminated into 33 VNTR/DR groups by using a minimum of nine VNTR and two DR assays. These 11 VNTR/DR assays concorded for three isolates each of 45 of the REA types but showed some variation with at least one of the VNTR/DR assays for the remaining 23 REA types. Major differences were found in allelic variation of some VNTRs between isolates from New Zealand and other countries, emphasizing the importance of adapting M. bovis typing systems to suit individual countries.

Dothistromin biosynthesis genes allow inter‐ and intraspecific differentiation between Dothistroma pine needle blight fungi

SummaryDothistroma septosporum and D. pini are the causal agents of Dothistroma needle blight (DNB) of Pinus spp. in natural forests and plantations. The main aim of this study was to develop molecular diagnostic procedures to distinguish between isolates within D. septosporum, for use in biosecurity and forest health surveillance programmes. This is of particular interest for New Zealand where the population is clonal and introduction of a new isolate of the opposite mating type could have serious consequences. Areas of diversity in the dothistromin toxin gene clusters were identified in D. septosporum (51 isolates) and D. pini (6 isolates) and used as the basis of two types of diagnostic tests. PCR‐restriction fragment length polymorphism (RFLP) of part of the dothistromin polyketide synthase gene (pksA) enabled distinction between two groups of D. septosporum isolates (A and B) as well as distinguishing D. septosporum and D. pini. The intergenic region between the epoA and avfA genes allowed further resolution between some of the A group isolates in RFLP assays. These regions were analysed further to develop a rapid real‐time PCR method for diagnosis by high‐resolution melting (HRM) curve analysis. The pksA gene enabled rapid discrimination between D. septosporum and D. pini, whilst the epoA–avfA region distinguished the New Zealand isolate from most other isolates in the collection, including some isolates from DNB epidemics in Canada and Europe. Although this study is focused on differences between the New Zealand isolate and other global isolates, this type of diagnostic system could be used more generally for high‐throughput screening of D. septosporum isolates.

Molecular characterisation of Australasian isolates of aquatic birnaviruses

An aquatic birnavirus, first isolated in Australia from farmed Atlantic salmon in Tasmania in 1998, has continued to be re-isolated on an infrequent but regular basis. Due to its low pathogenicity, there has been little urgency to undertake a comprehensive characterisation of this aquatic birnavirus. However, faced with possible incursions of any new aquatic birnaviruses, specific identification and differentiation of this virus from other, pathogenic, aquatic birnaviruses such as infectious pancreatic necrosis virus (IPNV) are becoming increasingly important. The present study determined the nucleic acid sequence of the aquatic birnavirus originally isolated in 1998, as well as a subsequent isolate from 2002. The sequences of the VP2 and VP5 genes were compared to that of other aquatic birnaviruses, including non-pathogenic aquatic birnavirus isolates from New Zealand and pathogenic infectious pancreatic necrosis virus isolates from North America and Europe. The deduced amino acid (aa) sequences indicate that the Australian and New Zealand isolates fall within Genogroup 5 together with IPNV strains Sp, DPL, Fr10 and N1. Thus, Genogroup 5 appears to contain aquatic birnavirus isolates from quite diverse host and geographical ranges. Using the sequence information derived from this study, a simple diagnostic test has been developed that differentiates the current Australian isolates from all other aquatic birnaviruses, including the closely related isolates from New Zealand.

The evolution and distribution of phage ST160 withinSalmonella entericaserotype Typhimurium

Salmonellosis is an internationally important disease of mammals and birds. Unique epidemics in New Zealand in the recent past include two Salmonella serovars: Salmonella enterica subsp. enterica serovar Typhimurium definitive type (DT) 160 (S. Typhimurium DT160) and S. Brandenburg. Although not a major threat internationally, in New Zealand S. Typhimurium DT160 has been the most common serovar isolated from humans, and continues to cause significant losses in wildlife. We have identified DNA differences between the first New Zealand isolate of S. Typhimurium DT160 and the genome-sequenced strain, S. Typhimurium LT2. All the differences could be accounted for in one cryptic phage ST64B, and one novel P22-like phage, ST160. The majority of the ST160 genome is almost identical to phage SE1 but has two regions not found in SE1 which are identical to the P22-like phage ST64T, suggesting that ST160 evolved from SE1 via two recombination events with ST64T. All of the New Zealand isolates of DT160 were identical indicating the clonal spread of this particular Salmonella. Some overseas isolates of S. Typhimurium DT160 differed from the New Zealand strain and contained SE1 phage rather than ST160. ST160 was also identified in New Zealand isolates of S. Typhimurium DT74 and S. Typhimurium RDNC-April06 and in S. Typhimurium DT160 isolates from the USA. The emergence of S. Typhimurium DT160 as a significant pathogen in New Zealand is postulated to have occurred due to the sensitivity of the Salmonella strains to the ST160 phage when S. Typhimurium DT160 first arrived.

Investigation of a pig herd with animals seropositive for classical swine fever and where porcine circovirus-associated disease had been diagnosed

AIM: To investigate the cause of classical swine fever (CSF) virus-seropositive animals in a nucleus pig-breeding herd in New Zealand, where porcine circovirus-associated disease had been diagnosed. CASE HISTORY AND CLINICAL FINDINGS: An exotic disease investigation was undertaken to exclude CSF and porcine reproductive and respiratory syndrome (PRRS) on a nucleus pig-breeding herd comprising approximately 300 breeding sows, 1,000 weaners, and 650 grower pigs. The herd was experiencing poor reproductive performance in sows, and breeding records showed a declining farrowing rate attributable to a single manager. The growing pigs (10–15 weeks old) were experiencing respiratory disease and wasting, and the mortality rate by pen varied between 9 and 20%. Post-mortem changes in affected grower pigs were consistent with circovirus-associated diseases. DIAGNOSTIC TESTING: Serological screening using an IDEXX-ELISA gave negative results for PRRS virus antibodies, but two grower pigs and one sow tested positive for CSF virus antibodies. These three seropositive animals remained positive to CSF virus, using three commercial ELISA test kits, over 27 weeks. A newly developed virus neutralisation test (VNT), using a New Zealand isolate of border disease (BD) virus, demonstrated that the seropositive pig sera had higher antibody titres to BD virus than to bovine viral diarrhoea (BVD) virus and CSF virus. PCR performed on tonsil, kidney, ileum and spleen gave negative results for CSF virus, and histopathology on lymph nodes, intestine, lung, kidney, liver and brain showed no evidence of the disease. Virus isolation performed on a number of samples was negative. CLINICAL RELEVANCE: The seropositive samples for CSF virus found in this investigation were likely to be a cross reaction to a pestivirus other than CSF virus. The finding of a possible endemic pestivirus capable of being transmitted between sheep and pigs on this farm may explain findings from previous serological survey work in New Zealand, and supports experience elsewhere, where BD virus was found to be the predominant ruminant pestivirus infecting pigs. The results show that pestivirus cross reactivity can result in unexpectedly high titres, and that testing with a full set of (local) pestiviruses is necessary to reach the correct conclusion. The investigation has direct relevance where pig herds with a low seroprevalence are encountered during surveillance for CSF.

Molecular Identification of Sphaceloma perseae (Avocado Scab) and its Absence in New Zealand

Avocado scab was recorded as present in New Zealand in international databases on the basis of one isolate (ICMP 10613) identified by morphological features as Sphaceloma perseae. However, sequence analysis of the rDNA internal transcribed spacer (ITS) region showed that this isolate was dissimilar to the ITS region of other Sphaceloma species, and to S. perseae. By phylogenetic analysis, isolate ICMP 10613 was identified as a species of Phaeosphaeria. To identify S. perseae reliably and quickly, specific polymerase chain reaction (PCR) primers were developed and tested. These PCR primers detected the authentic strain and another strain available from international collections, but did not detect isolate ATCC 11190, or the New Zealand isolate ICMP 10613 which were deposited as S. perseae. No other fungi commonly present in New Zealand avocado orchards were amplified by these primers, nor were three other species of Elsinoe (E. ampelina, E. fawcettii and E. pyri). By phylogenetic analysis of ITS sequence, the atypical isolate ATCC 11190 was identified as Elsinoe araliae, whereas isolate ICMP 10613 was identified as Phaeoseptoria sp. (anamorphic Phaeosphaeria). Re-examination of the scar symptoms on New Zealand avocado fruit showed they were dissimilar to herbarium specimens of S. perseae from Florida and from Cuba. Leaf symptoms typical of this disease have not been found in New Zealand, and isolations from over 1000 scars on fruit onto selective media yielded no fungi identifiable as S. perseae. These results show that ICMP 10613 was mis-identified as S. perseae. The record of avocado scab in New Zealand was shown to be incorrect, and there is no evidence that the causal fungus occurs in New Zealand.

First Report of Alternaria carotiincultae on Carrot Seed Produced in New Zealand.

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5' TTCCCCCGTCTCCACTTCTTCATG 3') and Bt1b (5' GACGAGATCGTTCATGTTGAACTC 3') (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand.

WALNUT BLIGHT SUSTAINABLE MANAGEMENT RESEARCH IN NEW ZEALAND

Walnut blight Xanthomonas arboricola pathovar juglandis is the most significant pest or disease issue in New Zealand commercial walnut (Juglans regia) production. Typical management has involved selection of less humid regions and copper based sprays. Research in New Zealand has included determining cultivars that show a promise of lower blight susceptibility and investigation of the effect of timing and form of copper sprays. There has been no clear success in the use of adjuvants to improve the efficacy of copper based sprays and no effective alternatives to copper sprays elucidated in research to date. Mankocide had previously demonstrated improved efficacy over Kocide even at lower copper levels. In this research, there was no apparent benefit in incorporating extra Mancozeb with Mankocide to match the copper mole for mole with dithiocarbamate. The use of copper methionine as an alternative form of copper yielded low efficacy on walnut blight. Efficacy of copper sprays was reduced by using copper methionine as a form of copper. Bacteriophages of X. arboricola pv. juglandis have a demonstrated capability of lysing all New Zealand isolates of the pathogen that have been collected in preliminary work. The potential of bacteriophages as a biological control agent is discussed but there is a need for a reliable bioassay to progress research further.

Genetic diversity ofCucumber mosaic virusinfecting vanilla in French Polynesia and Réunion Island

Partial coat protein sequence analysis of Cucumber mosaic virus (CMV) isolates from Vanilla tahitensis crops in French Polynesia and V. planifolia crops on Reunion Island detected several different sequence variants of CMV isolates that were related to their geographic origin. French Polynesian isolates showed high molecular variability and clustered into two subgroup IB clades and one putative subgroup IA clade. The Reunion isolates grouped into a single subgroup IB clade. Experimental inoculation with a New Zealand isolate (NZ100) belonging to the CMV-II subgroup, demonstrated that vanilla is able to be infected by a very diverse range of CMV isolates.

A history of facial eczema (pithomycotoxicosis) research

Facial eczema (pithomycotoxicosis), a photosensitisation of ruminants grazing pasture, has been known in New Zealand for over 100 years, but its cause, a toxin produced by a largely saprophytic fungus, Pithomyces chartarum, growing on litter at the base of pasture and sporing profusely under warm moist conditions in late summer and autumn, was found only 50 years ago. As the fungus spores it produces the toxin sporidesmin which, when eaten by sheep, cattle, goats or deer, causes liver injury with inflammation and blockage of bile ducts. Phylloerythrin, a photodynamic breakdown product of chlorophyll, is no longer excreted but circulates in the blood, causing lesions of unpigmented skin when the affected animal is exposed to sunlight. Lesions do not appear until at least a week after sporidesmin has been ingested, and this lag period delayed discovery of the causative agent, first thought to have been an abnormal metabolite of rapidly growing ryegrass. However, before the role of P. chartarum was discovered, the pathology of the disease had been described, toxic extracts had been made from herbage mown from pastures associated with facial eczema outbreaks, and the weather conditions preceding outbreaks had been defined. When the causative agent was identified, cultures of P. chartarum on artificial media produced sporidesmin for chemical characterisation and animal dosing trials. Control of facial eczema in the field was first by avoiding toxic pasture, detected by P. chartarum spore counts on herbage, later by reducing P. chartarum pasture populations by spray application of substituted thiabendazole fungicides, and later still by protecting animals with oral doses of zinc at close to toxic levels. Sheep vary widely in their sensitivity to sporidesmin, either under field conditions in facial eczema outbreaks or when dosed orally with sporidesmin, and breeding resistant animals by selection after sporidesmin challenge is the best long‐term control method at present. Whilst facial eczema outbreaks have been most severe in New Zealand, the disease has been reported from an increasing number of countries with warm temperate climates in which ruminants are intensively grazed on pasture. The great majority of New Zealand isolates of P. chartarum produce sporidesmin, but varying proportions of those in other countries do not.

Evolving Trends in the Dereplication of Natural Product Extracts. 2. The Isolation of Chrysaibol, an Antibiotic Peptaibol from a New Zealand Sample of the Mycoparasitic Fungus Sepedonium chrysospermum

By the application of an HPLC bioactivity profiling/microtiter technique in conjunction with capillary NMR instrumentation and access to the AntiMarin database the conventional evaluation/isolation dereplication/characterization procedures can be dramatically truncated. This approach is illustrated using the isolation of a new peptaibol, chrysaibol (1), from a New Zealand isolate of the mycoparasitic fungus Sepedonium chrysospermum. The unique nature of chrysaibol was recognized by bioactivity-guided fractionation using HPLC bioactivity profiling/microtiter plate analysis in conjunction with capillary NMR instrumentation and the AntiMarin database. 2D NMR techniques, in combination with MS fragmentation experiments, determined the planar structure of chrysaibol (1), while the absolute configurations of the amino acid residues were defined by Marfey's method. Chrysaibol (1) was cytotoxic against the P388 murine leukemia cell line (IC50 6.61 microM) and showed notable activity against Bacillus subtilis (IC50 1.54 microM).

Genetic variability in the G protein gene of human respiratory syncytial virus isolated from the Campinas metropolitan region, Brazil

Human respiratory syncytial virus (hRSV) is recognized as the most important viral agent of serious respiratory tract diseases in the pediatric population worldwide. A prospective study for hRSV was conducted in children ageing less than 1 year admitted in two university hospitals in Campinas, São Paulo, Brazil. The aim of the present study was to investigate the genetic variability of both A and B subgroups of hRSV isolated during an epidemic period in the Campinas metropolitan region, Brazil, by sequencing a variable region of the G protein gene. Phylogenetic trees were constructed from alignments of sequences available in the GenBank database and Brazil isolates for hRSV A and B. The data demonstrate that Brazilian isolates clusters together with A and B viruses from Kenya, New Zealand, South Africa, West Virginia, United States (CH, Rochester), and other Brazilian isolates. Phylogenetic analysis of subgroup A isolates showed that the sequences obtained on the present study falls on three clusters, namely GA2, GA5, and SAA1 that co-circulate during the analyzed period. Subgroup B isolates detected belongs to three genotypes, GB3 (SAB3) and BA (BAIII). Different subgroup B genotypes were detected and BA isolates present in our samples showed some degree of genetic variability. This is one of the first reports on the molecular epidemiology of hRSV strains from the Campinas metropolitan region, São Paulo state, Brazil. And is also the first description of the circulation pattern of hRSV genotypes in two university hospitals, revealing interesting differences between the two subgroups of the virus.

In this issue

In this issue