Yeast Alanine Transfer RNA Research Articles

Synthetic biology in China: Review and prospects

Synthetic biology is an emerging science and a typical convergence technology. On the basis of system biology, integrating the principles of engineering science and adopting bottom-up strategies, it aims to reveal the mechanism of life and to build a new generation of biotechnology, through designing and constructing new biological systems or redesigning the existing biological systems, which is therefore summarized in Chinese as “build-to-learn” and “build-to-use”. In early years, Chinese scientists were the first to artificially synthesize the functional protein (bovine insulin) and ribonucleic acid (yeast alanine tRNA). In recent years, they have been engaged in chromosomal synthesis and chromosomal engineering, genome editing, biological chassis construction, quantitative engineering biology, biological parts and gene circuits engineering, synthetic metabolism of natural products and organic chemical products, and enabling technologies (e.g. genome editing and computer simulation), and made a series of important discoveries and innovative achievements. These have given Chinese scientists an important role in the international consortium of synthetic biology. By the time to review 70 years’ development of science and technology in China, this article is to commemorate the pioneers and inspire the early career academics in the field, meanwhile discuss experiences and lessons, and identify future priorities and opportunities. Nowadays, synthetic biology is booming in the world, and Chinese scientists will be delighted to play vital role in it.

The Proposal of Series Projects about Artificial Synthetic Life(1965—1968)

After the total synthesis of crystalline bovine insulin, the research team members, the experts at the appraisal meeting, and the leaders of Ministry of Higher Education and Chinese Academy of Sciences proposed some research plans. But these plans were suspended because of the broken of the Culture Revolution. A year later, the second Beijing science seminar was scheduled to be held in the summer of 1968.It prompted these plans to start again. According to vice Premier Nie Rongzhen’s instructions and the August 24, 1964 night talks of Mao Zedong, the relevant personnel held a series of conferences in 1967—1968, and proposed series projects about artificial synthetic life, such as the determination of crystal structure of insulin, the synthesis of tobacco mosaic virus protein subunit, the synthesis of yeast alanine tRNA.

Yinglai Wang: an admirable biochemist for his foresightedness and selflessness

On July 5, 2001, Nature published an article: “Wang Ying-lai (1907–2001)” in honor of Dr. Yinglai Wang and his contributions to the advancement of total chemical synthesis of biological molecules. It is rather rare for Nature to describe a biochemist in this manner. However, Yinglai Wang is an admired and revered scientist, and as such, deserves such an honor! His scientific achievements and exemplary morality should be acknowledged by the scientific community and must be emulated by people from all walks of life. Yinglai Wang, Ph.D. of Cambridge University, UK, and Academician of the Chinese Academy of Sciences (CAS), was one of the founders of biochemical research in China. His most significant scientific contribution was the relevant leadership he provided in the first total chemical synthesis of crystalline bovine insulin and yeast alanine tRNA. His academic achievements were inseparable from his unique organizing ability and self-giving dedication. In the early days of the People’s Republic of China (1949–1957), biochemical research was unorganized. The country lacked qualified scientists and technicians. Realizing the need to change this situation, Yinglai Wang sent letters to some well-known Chinese scientists working overseas in a systematic way, and summoned them to return to China. His reasons were based on the disciplinary developmental trend of biochemistry. Consequently, from 1951 to 1957, he succeeded in recruiting prominent scientists from abroad including Chenglu Zou, Tianqin Cao, Yourui Zhang, Debao Wang, Jingyi Niu, and Guangyu Zhou, among others, and established the Shanghai Institute of Biochemistry at CAS. In order to support and highlight the scientific research careers of his best research assistants, namely, Qinrong Wu and Jiamu Peng, he introduced them to Chenglu Zou and Tianqin Cao, respectively. The esteemed biochemist’s selfless spirit and untiring encouragement transformed the Shanghai Institute of Biochemistry into a strong and qualified institution capable of completing national key scientific research projects. Under his guidance, the institute enjoyed a democratic and harmonious academic environment. To solve the problem of amino acid scarcity for insulin synthesis, Yinglai Wang founded the Dongfeng Biochemical Reagent Factory in 1958. Under his leadership, the factory produced amino acids and various biochemical reagents to meet the whole country’s need. Forty years before the advocacy for knowledge innovation and the acceleration of industrialization of scientific findings was initiated, he had already championed the model of and worked toward the integration of enterprises, universities, and institutes. Truly, Yinglai Wang was a visionary! The Great Leap Forward Movement (1958–1960) started in Dr. Yinglai Wang (1907–2001)

The background of the total synthesis of yeast alanine transfer RNA

The research findings concerning the total synthesis of yeast alanine transfer RNA (yeast alanine tRNA) were successively published in Chinese Science Bulletin (1982) and Science in China (1983) [1]. The research work started in 1968 and was finished in November 1981. It was the first artificial synthesis of a nucleic acid molecule, which followed the first artificial synthesis of protein, crystalline bovine insulin, in China in 1965, both scientific milestones occurring in China. The composition, sequence and biological functions of the synthesized nucleic acid were identical to those of the natural yeast alanine tRNA. The research lasted for 13 years. From 1982 to 1984, one of the investigators in charge of the research Prof. WANG DeBao (T.P. WANG) presented reports titled “the total synthesis of yeast alanine tRNA” on international symposia concerning tRNA and in leading universities and institutes of the United States, Canada, the United Kingdom, Japan and West Germany, which were highly acclaimed.

The development of biochemistry and molecular biology in China

The development of biochemistry and molecular biology in China

Use of the 1-(2-fluorophenyl)-4-methoxypiperidin-4-yl (Fpmp) protecting group in the solid-phase synthesis of oligo- and poly-ribonucleotides

An approach to the solid-phase synthesis of oligo- and poly-ribonucleotides is described. The synthetic strategy involves the use of building blocks in which two acid-labile groups, 1-(2-fluorophenyl)-4-methoxypiperidin-4-yl (Fpmp) and 9-phenylxanthen-9-yl (Px), respectively, are used to protect the 2′- and 5′-hydroxy functions of ribonucleoside building blocks. The adenine, cytosine and guanine base residues are protected with pivaloyl, benzoyl and phenylacetyl groups, respectively. 2-Cyanoethyl N,N-diisopropylphosphoramidites are used in the coupling steps, and 5-(3nitrophenyl)-1H-tetrazole is used as the activating agent. Following the chain-assembly process, 2′-protected oligo-and poly-ribonucleotides are released from the functionalized controlled-pore glass solid support; the latter stabilized ribonucleic acid (RNA) sequences are purified before they are fully unblocked by treatment with 0.01 mol dm–3 hydrochloric acid (pH 2) at room temperature for 20 h. The efficacy of this methodology is illustrated by the synthesis of the 3′-terminal decamer (r[UCGUCCACCA]), nonadecamer (r[AUUCCGGACUCGUCCACCA]), and heptatriacontamer (37-mer, r[GGAGAGGUCUCCGGUUCGAUUCCGGACUCGUCCACCA]) sequences of yeast alanine tRNA (tRNAAla).

ChemInform Abstract: Synthesis of the 3′‐Terminal Half of Yeast Alanine Transfer Ribonucleic Acid (tRNAAla) by the Phosphotriester Approach in Solution. Part 2.

ChemInformVolume 21, Issue 4 Natural Products ChemInform Abstract: Synthesis of the 3′-Terminal Half of Yeast Alanine Transfer Ribonucleic Acid (tRNAAla) by the Phosphotriester Approach in Solution. Part 2. J. M. BROWN, J. M. BROWN Dep. Chem., King's Coll., London WC2R 2LS, UKSearch for more papers by this authorC. CHRISTODOULOU, C. CHRISTODOULOU Dep. Chem., King's Coll., London WC2R 2LS, UKSearch for more papers by this authorA. S. MODAK, A. S. MODAK Dep. Chem., King's Coll., London WC2R 2LS, UKSearch for more papers by this authorC. B. REESE, C. B. REESE Dep. Chem., King's Coll., London WC2R 2LS, UKSearch for more papers by this authorH. T. SERAFINOWSKA, H. T. SERAFINOWSKA Dep. Chem., King's Coll., London WC2R 2LS, UKSearch for more papers by this author J. M. BROWN, J. M. BROWN Dep. Chem., King's Coll., London WC2R 2LS, UKSearch for more papers by this authorC. CHRISTODOULOU, C. CHRISTODOULOU Dep. Chem., King's Coll., London WC2R 2LS, UKSearch for more papers by this authorA. S. MODAK, A. S. MODAK Dep. Chem., King's Coll., London WC2R 2LS, UKSearch for more papers by this authorC. B. REESE, C. B. REESE Dep. Chem., King's Coll., London WC2R 2LS, UKSearch for more papers by this authorH. T. SERAFINOWSKA, H. T. SERAFINOWSKA Dep. Chem., King's Coll., London WC2R 2LS, UKSearch for more papers by this author First published: January 23, 1990 https://doi.org/10.1002/chin.199004295Citations: 1AboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinkedInRedditWechat No abstract is available for this article.Citing Literature Volume21, Issue4January 23, 1990 RelatedInformation

ChemInform Abstract: Synthesis of the 3′‐Terminal Half of Yeast Alanine Transfer Ribonucleic Acid (tRNAAla) by the Phosphotriester Approach in Solution. Part 1. Preparation of the Nucleoside Building Blocks.

Adenosine and cytidine are converted into their 6-N- and 4-N-(4-t-butylbenzoyl) derivatives [(12) and (13b), respectively] which are then converted into the corresponding 2′-O-(4-methoxytetrahydropyran-4-yl)[(21; B =5b) and (21; B =6b), respectively] and 5′-O-[2-(dibromomethyl)benzoyl]2′-O-(4-methoxytetrahydropyran-4-yl) derivatives [(35; B =5b) and (35; B =6b), respectively]. The conversion of (12) into its 2′,3′-O-methoxymethylene derivative (24) is also described. Guanosine is converted, by two routes, into its 6-O-(3-chlorophenyl)-2-N-phenylacetyl derivative (16a), and the latter compound is converted into its 5′-O-[2-(dibromomethyl)benzoyl]-2′-O-(4-methoxytetrahydropyran-4-yl) and 5′-O-(9-phenylxanthen-9-yl)-2′-O-(4-methoxytetrahydropyran-4-yl) derivatives [(35; B =9b) and (26), respectively]. The preparation of 2′-O-(4-methoxytetrahydropyran-4-yl)-4-O-(2,4-dimethylphenyl)uridine (18) from 2′-O-(4-methoxytetrahydropyran-4-yl)uridine (17a) and its conversion to its 5′-O-[2-(dibromomethyl)benzoyl]derivative (35; B =10) are described. 5-Methyluridine (19; B =27), pseudouridine (19; B =28a) and inosine (19; B =29) are converted into their 2′-O-(4-methoxytetrahydropyran-4-yl) derivatives (21; B =27, 28a, and 29, respectively); (21; B =27) is further converted into its 4-O-phenyl derivative (30), (21; B =28a) is further converted into its 1-N-(4-bromobenzenesulphonyl) and 5′-O-[2-(dibromomethyl)benzoyl]-1-N-(4-bromobenzenesulphonyl) derivatives [(32) and (35; B =28b), respectively], and (21; B =29) is further converted into its 1-N-pivaloyloxymethyl- and 1-N-methyl derivatives [(33a) and (33b), respectively]. The N1,N1,N3,N3-tetramethylguanidinium E-2-nitrobenzaldoximate-promoted removal of O-aryl protecting groups from the 2′-O-(4-methoxytetrahydropyran-4-yl) derivatives of 6-O-(3-chlorophenyl)-2-N-phenylacetylguanosine, 4-O-(2,4-dimethylphenyl)uridine, 5-methyl-4-O-phenyluridine and 1-N-(4-bromobenzenesulphonyl)-5-β-D-ribofuranosyluracil [(21; B =9b), (18), (30), and (32), respectively], and the ammonia-promoted removal of the 1-N-pivaloyloxymethyl group from (33a) are described. Finally, the synthesis of 2-(isopropylthiomethoxymethyl)benzoic acid [Ptmt acid, (40)], the conversion of (18) and (21; B =5b) into their 5′-O-Ptmt derivatives [(41a) and (41b)], and the two-step procedure for the removal of the Ptmt protecting group are described.

Synthesis of the 3′-terminal half of yeast alanine transfer ribonucleic acid (tRNAAla) by the phosphotriester approach in solution. Part 2

The preparation, by the phosphotriester approach in solution, of the 3′-terminal decaribonucleoside nonaphosphate [UpCpGpUpCpCpApCpCpA (48)], nonadecaribonucleoside octadecaphosphate [ApUpUpCpCpGpGpApCpUpCpGpUpCpCpApCpCpA (49)], and heptatriacontaribonucleoside hexatriacontaphosphate [GpGpApGpApGpGpUpCpUpCpCpGpGpTpψpCpGpApUpUpCpCpGpGpApCpUpCpGpUpCpCpApCpCpA (50)] sequences of yeast alanine transfer ribonucleic acid are described. With the exception of the 3′-terminal adenosine residue which was protected as its 2′,3′-O-methoxymethylene [Mm] derivative, the 2′-hydroxy functions were protected with 4-methoxytetrahydropyran-4-yl [Mthp] groups. The 5′-hydroxy functions of intermediate building blocks were protected with 2-(dibromomethyl)benzoyl [Dbmb (2)], 2-(isopropylthiomethoxymethyl)benzoyl [Ptmt (3)] or 9-phenylxanthen-9-yl [Px (4)] groups. The base residue of the adenosine, cytidine, guanosine, uridine, pseudouridine and 5-methyluridine building blocks were protected as in (5), (6), (7), (8), (9), and (10), respectively. Internucleotide linkages were protected with the 2-chlorophenyl group, and the 2,4-dinitrobenzyl (Dnb) group was used for the temporary protection of 3′-phosphodiester functions. The first phosphorylation step (leading to 3′-phosphodiester intermediates) was carried out by treatment with 2-chlorophenyl bis(1,2,4-triazoyl)phosphate (11) in the presence of 1-methylimidazole in tetrahydrofuran followed by triethylamine and water. 1-(Mesitylene-2-sulphonyl)-3-nitro-1,2,4-triazole [MSNT (15)] was used as the condensing agent in the second phosphorylation step. The final unblocking procedure involved treatment with (i)N1,N1,N3,N3-tetramethylguanidinium E-2-nitrobenzaldehyde oximate in dioxane–acetonitrile–water, (ii) concentrated aqueous ammonia, and (iii) 0.01 M hydrochloric acid.

Synthesis of the 3′-terminal half of yeast alanine transfer ribonucleic acid (tRNAAla) by the phosphotriester approach in solution. Part 1. Preparation of the nucleoside building blocks

Adenosine and cytidine are converted into their 6-N- and 4-N-(4-t-butylbenzoyl) derivatives [(12) and (13b), respectively] which are then converted into the corresponding 2′-O-(4-methoxytetrahydropyran-4-yl)[(21; B =5b) and (21; B =6b), respectively] and 5′-O-[2-(dibromomethyl)benzoyl]2′-O-(4-methoxytetrahydropyran-4-yl) derivatives [(35; B =5b) and (35; B =6b), respectively]. The conversion of (12) into its 2′,3′-O-methoxymethylene derivative (24) is also described. Guanosine is converted, by two routes, into its 6-O-(3-chlorophenyl)-2-N-phenylacetyl derivative (16a), and the latter compound is converted into its 5′-O-[2-(dibromomethyl)benzoyl]-2′-O-(4-methoxytetrahydropyran-4-yl) and 5′-O-(9-phenylxanthen-9-yl)-2′-O-(4-methoxytetrahydropyran-4-yl) derivatives [(35; B =9b) and (26), respectively]. The preparation of 2′-O-(4-methoxytetrahydropyran-4-yl)-4-O-(2,4-dimethylphenyl)uridine (18) from 2′-O-(4-methoxytetrahydropyran-4-yl)uridine (17a) and its conversion to its 5′-O-[2-(dibromomethyl)benzoyl]derivative (35; B =10) are described. 5-Methyluridine (19; B =27), pseudouridine (19; B =28a) and inosine (19; B =29) are converted into their 2′-O-(4-methoxytetrahydropyran-4-yl) derivatives (21; B =27, 28a, and 29, respectively); (21; B =27) is further converted into its 4-O-phenyl derivative (30), (21; B =28a) is further converted into its 1-N-(4-bromobenzenesulphonyl) and 5′-O-[2-(dibromomethyl)benzoyl]-1-N-(4-bromobenzenesulphonyl) derivatives [(32) and (35; B =28b), respectively], and (21; B =29) is further converted into its 1-N-pivaloyloxymethyl- and 1-N-methyl derivatives [(33a) and (33b), respectively]. The N1,N1,N3,N3-tetramethylguanidinium E-2-nitrobenzaldoximate-promoted removal of O-aryl protecting groups from the 2′-O-(4-methoxytetrahydropyran-4-yl) derivatives of 6-O-(3-chlorophenyl)-2-N-phenylacetylguanosine, 4-O-(2,4-dimethylphenyl)uridine, 5-methyl-4-O-phenyluridine and 1-N-(4-bromobenzenesulphonyl)-5-β-D-ribofuranosyluracil [(21; B =9b), (18), (30), and (32), respectively], and the ammonia-promoted removal of the 1-N-pivaloyloxymethyl group from (33a) are described. Finally, the synthesis of 2-(isopropylthiomethoxymethyl)benzoic acid [Ptmt acid, (40)], the conversion of (18) and (21; B =5b) into their 5′-O-Ptmt derivatives [(41a) and (41b)], and the two-step procedure for the removal of the Ptmt protecting group are described.

Solid phase synthesis of the 3′-terminal nonadecaribonucleoside octadecaphosphate sequence of yeast alanine transfer ribonucleic acid

The rapid synthesis of the 3′-terminal decaribonucleoside nonaphosphate and nonadecaribonucleoside octadecaphosphate sequences of yeast tRNA Ala by the phosphoramidite approach on controlled pore glass is described; the synthetic products were found to be identical to the authentic oligoribonucleotides, prepared by the phosphotriester approach in solution.

Studies on nucleic acid chemistry: VII. Synthesis of four oligoribonucleotides of dihydrouridine (D) loop of yeast alanine transfer RNA

This article described the preparation and the protection of 3′-DMP and dihydrouridine (Dr) as well as the synthesis of four oligoribonucleotides composed of them. DMP and Dr were obtained by hydrogenation of 3′-UMP and Ur under acidic conditions in the presence of platinum dioxide. They were monomethoxytritylated and benzoylated to (MeOTr)-Dbzp and (MeOTr) Dbzs, respectively. The latter was converted to Dbzs, by demonomethoxytritylation. The oligoribonucleotides containing DMP or Dr—ApGpD, DpApG, ApGpDpC and ApGpDpCpGpG were synthesized via phosphodiester approach and DCC was used as condensing reagent. DpApG was also synthesized via phosphotriester approach and TPST, MSTe, MSNI and MSNT were used as condensing reagents for a preliminary comparison of the coupling yields. These synthetic oligoribonucleotides were checked for purity and nucleotide sequences as usual. ApGpDpCpGpG and DpApG had been used for enzymatic synthesis of ApGpDpCpGpGpDpApG, which had been in turn successfully used for the total syntheses of the 5′-half molecule and the whole molecule of yeast alanine t-RNA

Attempted expression of a human initiator tRNA gene in Saccharomyces cerevisiae.

In attempts to overproduce the wild type and, eventually, mutant human initiator methionine tRNAs for use in structure-function relationship studies, we have investigated the expression of the wild type human initiator tRNA gene in the yeast Saccharomyces cerevisiae, both in vitro and in vivo. We find that the yeast extract, while capable of accurately transcribing several yeast tRNA genes, does not transcribe the human initiator tRNA gene. In addition, when the human initiator tRNA gene is introduced into yeast as part of a 2 mu vector, no expression of the human tRNA gene was detected. A yeast alanine tRNA gene similarly introduced into yeast is expressed efficiently. The block in expression of the human tRNA gene is at the level of transcription and not processing. The yeast cell-free extract can accurately process precursors of the same human initiator tRNA made in a HeLa cell-free extract. Surprisingly, although the human tRNA gene has essentially the same intragenic control elements as the yeast initiator tRNA gene, the human tRNA gene competes extremely poorly for transcription factors in yeast extracts. In the course of screening a yeast DNA bank for initiator tRNA clones we have isolated and sequenced three yeast tRNA genes corresponding to glycine, alanine, and aspartic acid tRNAs. The sequence of glycine tRNA gene differs from the published tRNA sequence in having an additional nucleotide in the variable loop. The alanine tRNA gene codes for a new tRNA. All three genes are transcriptionally active in yeast extracts.

Synthesis of nonanucleotide (14-20) of the dihydrouridine (D) loop of yeast alanine transfer RNA

This paper deals with the synthesis of nonanucleotide AGDCGGDAGp of the dihydrouridine (D) loop of yeast alanine transfer RNA by ligation of chemically or enzymatically synthesized AGDCGG with excessive *pDAGp in the presence of T4-RNA ligase and the choice of the optimum conditions of 5′-phosphorylation and ligation of the fragments AG, AGDC, GG, GGp and DAG which were the constituents of the named nonanucleotide. The final product, nonanucleoside octaphosphate, was obtained by removing 3′-terminal phosphate group of the nonanucleotide with polynucleotide kinase possessing 3′-phosphatase activity and was checked by the sequence analysis in accordance with AGDCGGDAG. It was found that the yield of 5′-phosphorylation of DMP or DAG were almost quantitative at 5-10°C. The synthetic AGDCGGDAGp had been used for the total synthesis of t-RNAyA|a.

The prokaryote-eukaryote interface

Over the past 30 years the study of the sequences of proteins and nucleic acids has produced almost incredible amounts of information, new concepts, and new avenues of research. The beginning was slow: the first peptide hormones sequenced in the early 1950s, the first cytochrome c (horse) in 1961, the first bacterial ferredoxin in 1964, and the first transfer RNA (yeast alanine tRNA) in 1965. In the past 6 years, the rate of data accumulation has accelerated tremendously, primarily due to technological advances in nucleic acid sequencing techniques. For investigators of biological evolution, the sequence data and the new information on genetic mechanisms would prove to be the best evidence for elucidating relationships among the genomes of living organisms and for deducing phylogenetic history. In particular, they needed evidence to decide between the two hypotheses for the origin of eukaryotic cells. Now, less than 20 years since Margulis renewed the investigation of this problem, comparisons of protein and nucleic acid sequences, especially of the small subunit ribosomal RNAs, have answered this question in favor of the endosymbiotic origin of eukaryotic cells. After briefly discussing some of the concepts that helped resolve this controversy and the problems involved in using sequence data for evolutionary studies, we describe a few examples of useful evolutionary trees.

A total synthesis of yeast alanine transfer RNA

ADVERTISEMENT RETURN TO ISSUEPREVArticleNEXTA total synthesis of yeast alanine transfer RNAYu WangCite this: Acc. Chem. Res. 1984, 17, 11, 393–397Publication Date (Print):November 1, 1984Publication History Published online1 May 2002Published inissue 1 November 1984https://doi.org/10.1021/ar00107a003RIGHTS & PERMISSIONSArticle Views160Altmetric-Citations10LEARN ABOUT THESE METRICSArticle Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated. Share Add toView InAdd Full Text with ReferenceAdd Description ExportRISCitationCitation and abstractCitation and referencesMore Options Share onFacebookTwitterWechatLinked InReddit PDF (711 KB) Get e-Alerts Get e-Alerts

Synthesis of the 3′-terminal nonadecanucleotide (58-76) of yeast alanine tRNA

Two new 3'-phosphorylation procedures of oligoribonucleotide have been worked out. By means of using donor with a 3'-terminal phosphate group, under low ratio of donor/acceptor (1:1.1 to 1:2), nonadecanucleotide AUUCCGGACUCGUCCACCAp, which corresponds to the 3'-terrninal nucleotides 58～76 of yeast alanine tRNA, has been synthesized in good yields (87～90%) through ligation by T_4 RNA ligase of four component fragments: AUUC, CGGA, CUCGUCCA and CCAp.

Total synthesis of yeast alanine transfer ribonucleic acid.

By a combination of chemical and enzymatic methods, small oligonucleotides with lengths varying from 2 to 8 nucleotides were synthesized from mononucleotides. The small oligonucleotides were then ligated with T4 RNA ligase into six large oligonucleotides (9 to 19 nucleotides long) which were further ligated to form two half molecules with 35 and 41 nucleotides respectively. Finally, the two synthetic half molecules were annealed and ligated to obtain the whole molecule of yeast alanine tRNA (tRNAAlay). Prior to this, two semi-syntheses were performed, i.e. ligation of the synthetic 5'-half molecule with the natural 3'-half molecule and that of the natural 5'-half molecule with the synthetic 3'-half molecule. Both the semi-synthetic tRNAAlay and the synthetic tRNAAlay occupy the same position as the natural tRNAAlay after electrophoresis on a 20% polyacrylamide gel. They have the same chemical composition (containing 9 modified nucleotides of 7 different species) and structure as the natural tRNAAlay and are biologically active, i.e. accepting and transferring alanine into proteins in a cell-free protein synthesizing system, the accepting activity of the synthetic product is 52-66% of that of the natural tRNAAlay and 91-106% of that of the reconstituted product of the two natural half molecules. The incorporation activity of alanine into proteins of the synthetic 3H-alanine tRNAAlay is 63%, corresponding to 91% of that of the natural tRNAAlay and 115% of that of the reconstituted product of the two natural half molecules. To the best of our knowledge, this is the first time that a natural RNA with biological activity is synthesized.

Synthesis of the 3'-half molecule of yeast alanine tRNA.

This paper deals with the synthesis of the 3'-half molecule of yeast alanine transfer RNA (tRNAAlay) by ligation with T4 RNA ligase of three component oligonucleotide fragments corresponding to nucleotides 36-45(I), 46-57(II) and 58-76(III) in succession extending from the 3'-end to the 5'-end. First, in a ratio of acceptor to donor at 1.5 to 1, we adopted a method of three successive reactions, namely, the 5'-phosphorylation of the nonadecamer (III), ligation with the dodecamer (II) and the 5'-phosphorylation of the ligation product formed; with one isolation step and obtained the 5'-phosphorylated 31mer(46-76) (IV) in an overall yield of 70%. Then the 31mer(IV) as a donor was ligated with 3 times of decamer (I) to form the 41mer(36-76) (V), the 3'-half molecule of tRNAAlay. The yield was 67%. After 5'-phosphorylation, (V) was ligated with the natural 5'-half molecule to form the semi-synthetic tRNAAlay, which was biologically active, i.e. accepting and transferring (3H)-alanine into proteins.

Synthesis of the 5'-half molecule of yeast alanine tRNA.

In this paper, we report the synthesis of the 5'-half molecule of yeast alanine tRNA (tRNAAlay) by ligating three oligonucleotide fragments corresponding to the nucleotide sequences 1-13, 14-22 and 23-35 respectively under the catalysis of T4 RNA ligase (Fig. 1). Because of the high purity of the oligonucleotide fragments and the excellent quality of T4RNA ligase and polynucleotide kinase we prepared, the isolation steps were simplified and the overall yields were much higher. The ligating yield of the docosamer (IV) was 75%, that of the pentatriacontamer (V), 90%, and the isolated yield of the final product was 21% calculated on the basis of the tridecamer (III) used in the first reaction. Under the action of T4 RNA ligase the synthetic 5'-half molecule was joined with the natural 3'-half molecule forming a semi-synthetic tRNAAlay, which possessed the biological activities of both accepting (3H)-alanine and incorporating it into proteins. The correctness of the structure of the synthetic 5'-half molecule was verified by both chemical analysis and biological activity assay.