Wzy Gene Research Articles

Structural and genetic relationships between the O-antigens ofEscherichia coliO118 and O151

O-antigen (O-polysaccharide) is a highly variable part of the lipopolysaccharide present in the outer membrane of Gram-negative bacteria, which is used as the basis for bacterial serotyping and is essential for the full function and virulence of bacteria. In this work, the structure and genetics of the O-antigens of Escherichia coli O118 and O151 were investigated. Both O-polysaccharides were found to contain ribitol phosphate and have similar structures, the only difference between their backbones being one linkage mode (β1→3 in E. coli O118 vs. β1→2 in E. coli O151), which, most probably, is the linkage between the oligosaccharide repeats (O-units). The O-antigen gene clusters of the two bacteria are organized in the same manner and share high-level identity (>99%). Analysis of the wzy genes from E. coli O118 and O151 strains, which are responsible for the linkage between O-units, revealed only one nucleotide substitution, resulting in one amino acid residue substitution. The possible genetic events that may lead to the structural difference between two O-antigen structures are discussed. Salmonella O47 has the same O-unit backbone and a similar O-antigen gene cluster (OGC) (the DNA identity ranges from 74% to 83%) as E. coli O118 and O151. It was suggested that the OGCs of the three bacteria studied originated from a common ancestor.

Immunological responses induced by asd and wzy/asd mutant strains of Salmonella enterica serovar Typhimurium in BALB/c mice

Attenuated bacteria have long been developed as vaccine candidates but can have some disadvantages, such as the potential for damage to immune organs due to insufficient clearance. To minimize these disadvantages, we generated Salmonella enterica serovar Typhimurium mutants SHJ2104 (asd::cm) and HTSaYA (wzy::km, asd::cm). The wzy gene codes for the O-antigen polymerase, which is involved in lipopolysaccharide (LPS) biosynthesis, and asd codes for aspartate beta-semialdehyde dehydrogenase, which participates in cell wall formation. The strains synthesized LPS with a short-chain length, and showed lower cytotoxicity and reduced intracellular proliferation in animal cells compared to wild-type bacteria. After oral infection, the mutants were cleared in immune tissues, including the Peyer's patch, mesenteric lymph node, and spleen, within 5 days. The LD50 of the mutants in Balb/c mice was estimated to be 10(6) higher than wild-type bacteria when administered either via an oral or i.p. route, indicating that the two strains are highly attenuated. To compare the immune response to and protective effects of the mutants against wild-type bacterial infection, we inoculated the mutants into mice via an oral (1x10(10)CFU) or i.p. (1x10(7) CFU) route once or twice at a two week interval. All immune responses, such as serum IgG and secretory IgA levels, cytokine production, and delayed hypersensitivity, were highly induced by two rounds of immunization. HTSaYA and SHJ2104 induced similar immune responses, and mice immunized with HTSaYA or SHJ2104 via an i.p. route were protected against wild-type Salmonella infection even at 100-fold of the LD(50) (5x10(6) CFU). Taken together, these data indicate that HTSaYA and SHJ2104 could be developed as live attenuated Salmonella vaccine candidates.

Development of a serogroup-specific multiplex PCR assay to detect a set of Escherichia coli serogroups based on the identification of their O-antigen gene clusters

The Escherichia coli serogroups O115, O126, O137, O158, O165, and O173 are pathogenic strains associated with diarrhea. Molecular approaches such as PCR have been proven to be rapid, inexpensive, and accurate. The sequences of the O-antigen-processing genes wzx and wzy are specific for different O antigens and are generally used as the target genes for the detection and identification of E. coli strains belonging to different O serogroups. In this report, the O-antigen gene clusters of these 6 O serogroups were sequenced, and genes were identified on the basis of homology. By screening these sequences against all 186 E. coli and Shigella strains, we found that the sequences of the wzx and wzy genes were serogroup-specific, and 2 specific primer pairs for each serogroup were screened out. A multiplex PCR assay targeting all 6 serogroups was developed. Twenty-nine strains were used to validate the specificity of the assay. The detection sensitivity was 1 ng genomic DNA. As the assay was shown to be accurate and sensitive, it can be used for the identification and detection of strains belonging to these serogroups in stool and other environmental samples after being isolated by culture.

Escherichia coliserogroup O2 and O28ac O-antigen gene cluster sequences and detection of pathogenicE. coliO2 and O28ac by PCR

The O-antigen gene clusters of Escherichia coli serogroups O2 and O28ac were sequenced, and PCR assays were developed to identify strains belonging to these 2 serogroups. Sixteen and 8 open reading frames were mapped to these loci in E. coli O2:H4 U 9-41 and E. coli O28ac:H25 96-3286, respectively. The wzx (O-antigen flippase) and wzy (O-antigen polymerase) genes in the E. coli O2 and O28ac O-antigen gene clusters were selected as targets for PCR assays for their identification. PCR assays targeting the wzx and wzy genes were specific for these serogroups, with one exception. Escherichia coli serogroup O42 strains gave positive results with wzx and wzy PCR assays targeting E. coli O28ac, and antiserum raised against O42 cross-reacted with serogroup O28ac strains. The O-antigen gene cluster of a strain of E. coli serogroup O42 was sequenced, and there were only 3 nt differences between the O-antigen gene clusters of the O28ac and O42 strains. Multiplex PCR assays targeting the O2 wzx gene, the stx1, stx2, hly, eae, and saa genes, and the O28ac wzx, ial, ipaC, and ipaH genes were developed for detecting Shiga toxin-producing E. coli O2 strains and enteroinvasive E. coli O28ac strains, respectively. The O2 and O28ac wzx and wzy genes can be used as diagnostic markers in PCR assays for rapid identification of these serogroups as an alternative to serotyping, and the multiplex PCR assays targeting serogroup-specific genes in combination with virulence genes can be used to identify and to detect pathogenic serogroup O2 and O28ac strains.

Structure of the O-antigen of Salmonella O66 and the genetic basis for similarity and differences between the closely related O-antigens of Escherichia coli O166 and Salmonella O66

O-antigen is a component of the outer membrane of Gram-negative bacteria and is one of the most variable cell surface constituents, leading to major antigenic variability. The O-antigen forms the basis for bacterial serotyping. In this study, the O-antigen structure of Salmonella O66 was established, which differs from the known O-antigen structure of Escherichia coli O166 only in one linkage (most likely the linkage between the O-units) and O-acetylation. The O-antigen gene clusters of Salmonella O66 and E. coli O166 were found to have similar organizations, the only exception being that in Salmonella O66, the wzy gene is replaced by a non-coding region. The function of the wzy gene in E. coli O166 was confirmed by the construction and analysis of deletion and trans-complementation mutants. It is proposed that a functional wzy gene located outside the O-antigen gene cluster is involved in Salmonella O66 O-antigen biosynthesis, as has been reported previously in Salmonella serogroups A, B and D1. The sequence identity for the corresponding genes between the O-antigen gene clusters of Salmonella O66 and E. coli O166 ranges from 64 to 70 %, indicating that they may originate from a common ancestor. It is likely that after the species divergence, Salmonella O66 got its specific O-antigen form by inactivation of the wzy gene located in the O-antigen gene cluster and acquisition of two new genes (a wzy gene and a prophage gene for O-acetyl modification) both residing outside the O-antigen gene cluster.

Escherichia coli O123 O antigen genes and polysaccharide structure are conserved in some Salmonella enterica serogroups

The serotyping of O and H antigens is an important first step in the characterization of Salmonella enterica. However, serotyping has become increasingly technically demanding and expensive to perform. We have therefore sequenced additional S. enterica O antigen gene clusters to provide information for the development of DNA-based serotyping methods. Three S. enterica isolates had O antigen gene clusters with homology to the Escherichia coli O123 O antigen region. O antigen clusters from two serogroup O58 S. enterica strains had approximately 85 % identity with the E. coli O123 O antigen region over their entire length, suggesting that these Salmonella and E. coli O antigen regions evolved from a common ancestor. The O antigen cluster of a Salmonella serogroup O41 isolate had a lower level of identity with E. coli O123 over only part of its O antigen DNA cluster sequence, suggesting a different and more complex evolution of this gene cluster than those in the O58 strains. A large part of the Salmonella O41 O antigen DNA cluster had very close identity with the O antigen cluster of an O62 strain. This region of DNA homology included the wzx and wzy genes. Therefore, molecular serotyping tests using only the O41 or O62 wzx and wzy genes would not differentiate between the two serogroups. The E. coli O123 O-antigenic polysaccharide and its repeating unit were characterized, and the chemical structure for E. coli O123 was entirely consistent with the O antigen gene cluster sequences of E. coli O123 and the Salmonella O58 isolates. An understanding of both the genetic and structural composition of Salmonella and E. coli O antigens is necessary for the development of novel molecular methods for serotyping these organisms.

The cellular level of O-antigen polymerase Wzy determines chain length regulation by WzzB and WzzpHS-2 in Shigella flexneri 2a

The lipopolysaccharide O antigen of Shigella flexneri 2a has two preferred chain lengths, a short (S-OAg) composed of an average of 17 repeated units and a very long (VL-OAg) of about 90 repeated units. These chain length distributions are controlled by the chromosomally encoded WzzB and the plasmid-encoded Wzz(pHS-2) proteins, respectively. In this study, genes wzzB, wzz(pHS-2) and wzy (encoding the O-antigen polymerase) were cloned under the control of arabinose- and rhamnose-inducible promoters to investigate the effect of varying their relative expression levels on O antigen polysaccharide chain length distribution. Controlled expression of the chain length regulators wzzB and wzz(pHS-2) revealed a dose-dependent production of each modal length. Increase in one mode resulted in a parallel decrease in the other, indicating that chain length regulators compete to control the degree of O antigen polymerization. Also, when expression of the wzy gene is low, S-OAg but not VL-OAg is produced. Production of VL-OAg requires high induction levels of wzy. Thus, the level of expression of wzy is critical in determining O antigen modal distribution. Western blot analyses of membrane proteins showed comparable high levels of the WzzB and Wzz(pHS-2) proteins, but very low levels of Wzy. In vivo cross-linking experiments and immunoprecipitation of membrane proteins did not detect any direct interaction between Wzy and WzzB, suggesting the possibility that these two proteins may not interact physically but rather by other means such as via translocated O antigen precursors.

PCR Detection of Enterohemorrhagic Escherichia coli O145 in Food by Targeting Genes in the E. coli O145 O-Antigen Gene Cluster and the Shiga Toxin 1 and Shiga Toxin 2 Genes

Shiga toxin-producing Escherichia coli (STEC) strains belonging to serogroup O145 are an important cause of hemorrhagic colitis and hemolytic uremic syndrome worldwide. Cattle and other animals are potential reservoirs for this pathogen. To develop PCR assays for detection and identification of E. coli O145, the wzx (O-antigen flippase) and wzy (O-antigen polymerase) genes in the O145 O-antigen gene cluster that are specific for this serogroup were selected as targets. Oligonucleotide primers complementary to regions in the E. coli O145 wzx and wzy genes were designed to perform PCR assays with DNA from strains of E. coli O145, non-O145 E. coli serogroups, and other bacterial genera. The assays were highly specific for E. coli O145. A multiplex PCR assay targeting the E. coli O145 wzx and wzy genes and the Shiga toxin 1 (stx(1)) and Shiga toxin 2 (stx(2)) genes and a real-time multiplex PCR assay targeting the O145 wzy, stx(1), and stx(2) genes were developed for detection of STEC O145. The assays were used for detecting STEC O145 in seeded ground beef, lettuce, and raw milk initially inoculated with ca. 2, 20, or 200 CFU/25 g or 25 mL after 8 or 20 h of enrichment at 42 degrees C in modified EC broth containing 20 mg/L of novobiocin. STEC O145 was detected in all samples inoculated with 2 CFU/25 g or 25 mL. The detection limit of the multiplex PCR assays was <or=7.9 x 10(4) CFU/mL, which corresponded to <or=400 CFU/PCR reaction. The PCR assays can be employed to identify enterohemorrhagic E. coli serogroup O145 and to detect low levels of the pathogen in food.

Rarely Occurring 19A-Like cps Locus from a Serotype 19F Pneumococcal Isolate Indicates Continued Need of Serology-Based Quality Control for PCR-Based Serotype Determinations

Determination of the DNA sequences corresponding to all 91 pneumococcal capsular biosynthetic (cps) loci (1, 3, 6, 9) has allowed serotype determinations from pneumococcal isolates and clinical specimens using conventional PCR assays (2, 4, 7, 8, 10). We developed sequential, multiplexed PCR schemes that resolve 33 serologic specificities, including 20 serotypes and 13 serotype subsets (4, 7, 8). We recently expanded the scheme to 40 specificities (www.cdc.gov/ncidod/biotech/strep/pcr.htm). PCR primers targeted serotype-specific open reading frames within central portions of known cps loci (4, 7, 8). Subsequent information (1, 3, 6) revealed that we primarily targeted serotype-specific oligosaccharide repeat unit polymerases (wzy encoded), glycosyl transferases, and flippases (wzx encoded). Our serotype 19A primers, however, targeted the mnaA gene that encodes UDP-N-acetylglucosamine-2-epimerase (8). Although the mnaA sequence differs markedly among the 15 cps loci that harbor it (serotypes 19A, -B, -C, -F; 12A, -B, -F; 9A, -N, -L, -V; 4; 36; 44; 46), due to potential exchanges of heterologous mnaA genes, we recently changed the 19A PCR assay to target wzy (our unpublished data). The wzy19A and wzy19F genes putatively provide the basis of the structural difference between the related 19A and 19F capsules (1). Recently, we evaluated Streptococcus pneumoniae strain 2584-08(19F) that was typed as 19F using the serology-based reaction and found that it yielded a false-positive 19A result with our mnaA-based assay as well as a false-negative 19F PCR result using our wzy19F-specific assay. We found that this strain had an apparently rare multilocus sequence genotype 3040 (ST3040) that is not related to other known genotypes. Strain 2584-08(19F) reactivity with seven different monoclonal antibodies targeting 19A and/or 19F (5, 11) was consistent with results from previously characterized 19F strains (M. H. Nahm, unpublished data). We retrospectively tested 71 diverse 19F isolates using the 19A mnaA assay and found no false positives. We also found no discrepant results among 100 mnaA PCR-based 19A isolates also determined to be 19A based upon quellung reaction results. Unexpectedly, upon testing strain 2584-08(19F) using our newer 19A assay based upon the wzy19A gene sequence (completely conserved within the three available cps19A loci), we again obtained a false-positive 19A result. Using primers 19AFwzyF (5′TTGAAGTTGATGAAAGAAAACGAGG) and 19AFwzyR (5′ATAAAGTTGCCAGTAACTGTACTC), we subsequently amplified and sequenced the 1,335-bp wzy structural gene from 2584-08(19F) and found that the sequence (GenBank accession no. {type:entrez-nucleotide,attrs:{text:FJ829071,term_id:229559728,term_text:FJ829071}}FJ829071) shared 88% sequence identity with wzy19A from known 19A cps loci (GenBank accession no {type:entrez-nucleotide,attrs:{text:CR931675,term_id:68643359,term_text:CR931675}}CR931675 is representative) and only 78% identity with wzy19F from known 19F cps loci (GenBank accession no. {type:entrez-nucleotide,attrs:{text:CR931678,term_id:68643444,term_text:CR931678}}CR931678 is representative). As expected, we found near identity to the wzy19A-based primers and marked divergence from our standard wzy19F-based typing primers. Subsequently, we formulated new serotype 19A identification primers (19AF3 [5′ GAGAGATTCATAATCTTGCACTTAGCCA] and 19AR3 [5′ CATAATAGCTACAAATGACTCATCGCC]) based upon differences between wzy19A and all other wzy genes, including the 2584-08(19F) wzy gene. The current wzy19A-based PCR assay tested positive against 42 serotype 19A isolates and was negative against 31 diverse 19F isolates, including 2584-08(19F). Due to the high homology of the wzy gene of 2584-08(19F) with the serotype 19A wzy gene, we are unable to design a new wzy-specific primer set that would be specific for both 2594-08(19F) and commonly recovered type 19F isolates without giving false-positive PCR results for 19A isolates. We place more priority upon eliminating rare false-positive 19A results than illuminating rarely encountered false nontypeable results for serotype 19F. Based upon cumulative results from concurrent serology- and PCR-based testing of diverse isolate sets, we are confident that the sequential PCR assay is accurate for the vast majority of isolates. However, in view of this newly identified potential for false-positive 19A results, we will continue quellung serotyping in parallel with sequential PCR-based serotype determination until biologically based sequence signatures are identified for each serotype.

The DNA Sequence of the Escherichia coli O22 O-Antigen Gene Cluster and Detection of Pathogenic Strains Belonging to E. coli Serogroups O22 and O91 by Multiplex PCR Assays Targeting Virulence Genes and Genes in the Respective O-Antigen Gene Clusters

Multiplex polymerase chain reaction (PCR) assays were developed for detection of pathogenic strains belonging to Escherichia coli serogroups O22 and O91. The O-antigen gene cluster of E. coli O22 was sequenced to identify genes that could be employed as targets for serogroup-specific PCR assays. The wzx and wzy genes in the O-antigen gene clusters of E. coli O22 and E. coli O91 were selected as target genes. The assays were serogroup-specific when tested against 72 E. coli O22 strains and 57 E. coli O91 strains isolated from food, humans, and animals, representative strains belonging to 168 E. coli O serogroups and non-E. coli bacteria. Furthermore, 72 E. coli O22 strains and 57 E. coli O91 strains isolated from food, water, animals, and humans were tested by the PCR for the presence of six and 19 virulence genes, respectively, associated with pathogenic E. coli strains. Based on the PCR screening results, multiplex PCR assays targeting the O22 wzy gene and the cnf-1 and sfa genes in E. coli O22 and the O91 wzy gene, conserved sequences of stx1 and stx2 genes, and the astA and cdt-III genes in E. coli O91 were developed to detect and identify pathogenic strains belonging to serogroups O22 and O91. Furthermore, E. coli O22 and O91 were detected by multiplex PCR assays targeting the wzx or wzy genes and conserved sequences of the stx1 and stx2 genes in ground beef samples inoculated with approximately two colony-forming units (CFU)/25 g after 18-h enrichment. The results demonstrate that the E. coli O22 and O91 wzx and wzy gene sequences were specific for the respective serogroups and can be used as diagnostic markers for rapid identification of these serogroups as an alternative to serotyping. The multiplex PCR assays targeting the O22 and O91 wzx and wzy genes and virulence genes can be used to identify and to detect pathogenic strains of these serogroups in food and fecal samples.

DNA Sequencing and Identification of Serogroup-Specific Genes in theEscherichia coliO118 O Antigen Gene Cluster and Demonstration of Antigenic Diversity But Only Minor Variation in DNA Sequence of the O Antigen Clusters ofE. coliO118 and O151

The DNA sequence of the O antigen gene cluster of an Escherichia coli serogroup O118 strain was determined, and 13 open reading frames (ORFs) were identified, encoding genes required for O antigen sugar biosynthesis, transfer, and processing. Polymerase chain reaction (PCR) assays targeting the wzx (O antigen flippase) and wzy (O antigen polymerase) genes in the O antigen gene cluster of E. coli O118 were designed for identification of these serogroups. Specificity testing using strains belonging to E. coli O118 isolated from various sources, representative strains of 167 other E. coli O serogroups, and 20 non-E. coli bacteria revealed that the PCR assays were specific for E. coli O118. Thus, the PCR assays can be used for rapid identification of E. coli O118 as an alterative to typing using antisera. However, the PCR assays targeting the E. coli O118 wzx and wzy genes were also positive using E. coli serogroup O151 DNA. Therefore, the sequence of the O antigen gene cluster of E. coli O151 was determined, and it was very similar to that of E. coli O118, with only three nucleotide differences. Although the lipopolysaccharide profiles of O118 and O151 showed differences, multilocus sequence typing of E. coli O118 and O151 strains only revealed minor variation at the nucleotide level. Since E. coli O118 strains are more frequently isolated from humans, animals, and the environment than E. coli O151, serogroup O151 may likely be a minor variant of E. coli O118. Further studies are needed to elucidate this possibility.

O-antigen modal chain length in Shigella flexneri 2a is growth-regulated through RfaH-mediated transcriptional control of the wzy gene

Shigella flexneri 2a 2457T produces lipopolysaccharide (LPS) with two O-antigen (OAg) chain lengths: a short (S-OAg) controlled by WzzB and a very long (VL-OAg) determined by Wzz(pHS-2). This study demonstrates that the synthesis and length distribution of the S. flexneri OAg are under growth-phase-dependent regulation. Quantitative electrophoretic analysis showed that the VL-OAg increased during growth while the S-OAg distribution remained constant. Increased production of VL-OAg correlated with the growth-phase-regulated expression of the transcription elongation factor RfaH, and was severely impaired in a DeltarfaH mutant, which synthesized only low-molecular-mass OAg molecules and a small amount of S-OAg. Real-time RT-PCR revealed a drastic reduction of wzy polymerase gene expression in the DeltarfaH mutant. Complementation of this mutant with the wzy gene cloned into a high-copy-number plasmid restored the bimodal OAg distribution, suggesting that cellular levels of Wzy influence not only OAg polymerization but also chain-length distribution. Accordingly, overexpression of wzy in the wild-type strain resulted in production of a large amount of high-molecular-mass OAg molecules. An increased dosage of either wzzB or wzz(pHS-2) also altered OAg chain-length distribution. Transcription of wzzB and wzz(pHS-2) genes was regulated during bacterial growth but in an RfaH-independent manner. Overall, these findings indicate that expression of the wzy, wzzB and wzz(pHS-2) genes is finely regulated to determine an appropriate balance between the proteins responsible for polymerization and chain-length distribution of S. flexneri OAg.

Sequencing and analysis of the Escherichia coli serogroup O117, O126, and O146 O-antigen gene clusters and development of PCR assays targeting serogroup O117-, O126-, and O146-specific DNA sequences

The O-antigen gene clusters of Escherichia coli serogroups O117, O126, and O146 were sequenced, and 11, 10, and 11 open reading frames (ORFs) were identified, respectively. Genes required for O-antigen sugar biosynthesis, sugar transfer, and sugar processing were identified. Multiplex polymerase chain reaction (PCR) assays were developed targeting the wzx and wzy genes present in the O-antigen gene cluster of these serogroups. The assays were highly serogroup specific when tested against strains belonging to serogroups that were isolated from food, humans, animals, and environmental sources, as well as against representative strains belonging to ca. 165 different E. coli O serogroups and a number of non-E. coli bacteria. Thus, the results demonstrate that the wzx and wzy gene sequences were specific to E. coli O117, O126, and O146 and can be used as diagnostic markers for rapid identification and detection of these serogroups.

Relationship between O-antigen subtypes, bacterial surface structures and O-antigen gene clusters in Escherichia coli O123 strains carrying genes for Shiga toxins and intimin

Escherichia coli O123 strains express a broad spectrum of phenotypes, H serotypes and virulence markers and are able to colonize and to cause disease in different hosts including humans. In this study, two subtypes of E. coli O123 antigen (group I and group II) have been identified based on their cross-reactions with other E. coli O antigens. Investigation of the relationship between O123 group I and group II strains by O serotyping and Fourier transform infrared spectroscopy of whole bacteria revealed surface structural differences between these two groups of E. coli O123 strains. Nucleotide sequence analysis of the O-antigen gene clusters of two E. coli O123 strains representing O123 group I and group II revealed no change at the amino acid level. These findings indicate that the differences in the surface structures of group I and group II strains are not related to genetic heterogeneity in their O-antigen gene clusters. A PCR assay based on O123 antigen-specific wzx and wzy genes was developed and found to be suitable for reliable detection of all subtypes of E. coli O123 strains, which bears an advantage over traditional serological detection.

Structural and molecular characterization of Shigella boydii type 16 O antigen

Shigella is a well-known human pathogen causing dysentery and their typing is solely based on the O antigens. We investigated the chemical structure and gene cluster of Shigella boydii type 16 O antigen. As judged by sugar and methylation analyses along with NMR spectroscopy data, the O antigen has an O-acetylated branched pentasaccharide repeating O unit, which consists of two d-mannose residues ( d-Man), one residue each of d-glucuronic acid ( d-GlcA), N-acetylglucosamine ( d-GlcNAc) and d-galactose ( d-Gal), and the structure of the O unit was established. The O antigen gene cluster of S. boydii type 16 was identified and shown to contain putative genes for the synthesis of GDP- d-Man, genes encoding sugar transferases, O unit flippase (Wzx) and O antigen polymerase (Wzy) as expected. The function of the wzy gene was characterized by mutation test. Genes specific to S. boydii type 16 O antigen gene cluster were identified by screening 186 Escherichia coli and Shigella type strains, and can be used to develop PCR assays for detection of type 16 strains.

DNA sequence of theEscherichia coliO103 O antigen gene cluster and detection of enterohemorrhagicE. coliO103 by PCR amplification of thewzxandwzygenes

Escherichia coli serogroup O103 has been associated with gastrointestinal illness and hemolytic uremic syndrome. To develop PCR-based methods for detection and identification of this serogroup, the DNA sequence of the 12,033-bp region containing the O antigen gene cluster of Escherichia coli O103 was determined. Of the 12 open reading frames identified, the E. coli O103 wzx (O antigen flippase) and wzy (O antigen polymerase) genes were selected as targets for development of both conventional and real-time PCR assays specific for this serogroup. In addition, a multiplex PCR targeting the Shiga toxin (Stx) 1 (stx1), Shiga toxin 2 (stx2), wzx, and wzy genes was developed to differentiate Stx-producing E. coli O103 from non-toxigenic strains. The PCR assays can be employed to identify E. coli serogroup O103, replacing antigen-based serotyping, and to potentially detect the organism in food, fecal, or environmental samples.

The O-antigen gene cluster of Shigella boydii O11 and functional identification of its wzy gene

Shigella strains are human pathogens and their identification is usually based on their O-antigens. The O-antigen gene cluster of Shigella boydii O11 was sequenced. All the expected genes for the synthesis of the O-antigen were identified on the basis of homology and genes for the biosynthesis of dTDP- l-Rhamnose, genes encoding sugar transferases, as well as genes encoding O unit flippase ( wzx) and O-antigen polymerase ( wzy). The identity of the putative wzy gene was confirmed by showing that a wzy deficient mutant strain of S. boydii O11 produced a semi-rough LPS phenotype. The predicted wzx gene has an opposite transcription direction to that of all of the other genes in the S. boydii O11 O-antigen gene cluster. This unusual feature for the wzx gene has only previously been reported in S. boydii O6. Further comparison revealed an evolutionary relationship between O6 and O11 O-antigen gene clusters. Adjacent-gene PCR showed that Escherichia coli O105 and S. boydii O11, which share the identical O-antigen, also have the same genes and organization for their respective O-antigen gene clusters. Three genes specific for the S. boydii O11 and E. coli O105 gene clusters were identified.

RAPID detection and quantification of E. coli O157/O26/O111 in minced beef by real-time PCR.

To develop a real-time PCR detection procedure for Escherichia coli O111, O26 and O157 from minced meat. Strains (n = 8) of each of E. coli O26, E. coli O111 and E. coli O157 were inoculated at ca 10-20 CFU g(-1) into minced retail meat and enriched for 6 h at 41.5 degrees C as follows: E. coli O26 in tryptone soya broth (TSB) supplemented with cefixime (50 microg l(-1)), vancomycin (40 mg l(-1)) and potassium tellurite (2.5 mg l(-1)); E. coli O111 in TSB supplemented with cefixime (50 microg l(-1)) and vancomycin (40 mg l(-1)); E. coli O157 in E. coli broth supplemented with novobiocin (20 mg l(-1)). DNA was extracted from the enriched cultures, and detected and quantified by real-time PCR using verotoxin (vt1 and vt2) and serogroup (O157 per gene; O26 fliC-fliA genes and O111 wzy gene) specific primers. The methods outlined were found to be sensitive and specific for the routine detection of E. coli O111, O26 and O157 in minced beef. The enrichment, isolation and detection procedures used in this study provide a rapid routine-based molecular method for the detection and differentiation of E. coli O26, O111 and O157 from minced meat.

A single nucleotide exchange in the wzy gene is responsible for the semirough O6 lipopolysaccharide phenotype and serum sensitivity of Escherichia coli strain Nissle 1917.

Structural analysis of lipopolysaccharide (LPS) isolated from semirough, serum-sensitive Escherichia coli strain Nissle 1917 (DSM 6601, serotype O6:K5:H1) revealed that this strain's LPS contains a bisphosphorylated hexaacyl lipid A and a tetradecasaccharide consisting of one E. coli O6 antigen repeating unit attached to the R1-type core. Configuration of the GlcNAc glycosidic linkage between O-antigen oligosaccharide and core (beta) differs from that interlinking the repeating units in the E. coli O6 antigen polysaccharide (alpha). The wa(*) and wb(*) gene clusters of strain Nissle 1917, required for LPS core and O6 repeating unit biosyntheses, were subcloned and sequenced. The DNA sequence of the wa(*) determinant (11.8 kb) shows 97% identity to other R1 core type-specific wa(*) gene clusters. The DNA sequence of the wb(*) gene cluster (11 kb) exhibits no homology to known DNA sequences except manC and manB. Comparison of the genetic structures of the wb(*)(O6) (wb(*) from serotype O6) determinants of strain Nissle 1917 and of smooth and serum-resistant uropathogenic E. coli O6 strain 536 demonstrated that the putative open reading frame encoding the O-antigen polymerase Wzy of strain Nissle 1917 was truncated due to a point mutation. Complementation with a functional wzy copy of E. coli strain 536 confirmed that the semirough phenotype of strain Nissle 1917 is due to the nonfunctional wzy gene. Expression of a functional wzy gene in E. coli strain Nissle 1917 increased its ability to withstand antibacterial defense mechanisms of blood serum. These results underline the importance of LPS for serum resistance or sensitivity of E. coli.

Two functional O-polysaccharide polymerase wzy ( rfc) genes are present in the rfb gene cluster of Group E1 Salmonella enterica serovar Anatum

Defined regions of the rfb gene cluster of Group E1 Salmonella enterica serovar Anatum were introduced into a mutated derivative of this strain that lacks O-polysaccharide polymerase activity. Three different kinds of assays performed on the various transformants all indicate that two functional wzy ( rfc) genes reside within the Group E1 Salmonella rfb gene cluster. The product of ORF9.6, positioned near the center of the rfb gene cluster, joins O-polysaccharide repeat units together by α-glycosidic linkages to produce antigen O10, the major serological determinant of Group E1 S. enterica. The product of ORF17.4, positioned at the downstream end of the rfb gene cluster, can join repeat units together by β-glycosidic linkages to produce antigen O15, the major serological determinant of Group E2 S. enterica.