Wielkopolska Region Of Poland Research Articles

Risk of Flash Floods in Urban and Rural Municipalities Triggered by Intense Precipitation in Wielkopolska of Poland

This research analyzed interventions of State Fire Service (SFS) units in the Wielkopolska region of Poland that were triggered by extreme precipitation for the period 2010–2021. Our results demonstrated that the most populated and urbanized towns in the Wielkopolska (Greater Poland, west of Warsaw) region are at the most risk in the event of extreme precipitation occurrence as measured by the total number of interventions made by the SFS. The number of SFS unit interventions in towns, standardized to 10,000 inhabitants, indicates that the highest proportional volume of interventions also occurred in smaller towns. In the rural municipalities the number of SFS unit interventions increases along with higher population density and proportion of infrastructure areas. As analyzed in this study, the 12 years from 2010 to 2021 were characterized by a higher number of days with heavy precipitation, for example, 20, 30, 40, and 50 mm, in comparison to the previous periods 1961–2010 and 1981–2010. Intervention databases collected by emergency services are a valuable source of information for hazard mapping. Based on those and other available data, a statistical model was created and factors influencing the local and regional occurrence of interventions were determined. Increasing suburbanization, the rising proportion of impermeable surfaces, and the impact of climate change are of considerable importance in urban flood risk. It is necessary to help municipalities develop abilities to absorb larger amounts of rainwater.

ECONOMIC, ENVIRONMENTAL, AND SOCIAL DIMENSIONS OF FARMING SUSTAINABILITY – TRADE-OFF OR SYNERGY?

Prior studies on the relationships between economic, environmental, and social dimensions of activity on agricultural holdings has yielded inconclusive results. This study examines the interactions between these spheres, with the aim of determining what the relationships between them might be. The study was based on the results of surveys of 120 farms in the Wielkopolska region of Poland, using structural equation modeling. The results showed significant and positive relationships between the economic, social, and environmental dimensions that could create synergies between them. The strongest positive relationships existed between the economic and environmental dimensions. Thus, economic and environmental development can be stimulated simultaneously. Analyzed farms from the Wielkopolska region positively discount the existing support system in the EU to the complementarity between environmental and economic governance. Our research indicates the need for the EU to implement a strategy adjusted to the individual region’s peculiarities in terms of environmental and social policies in rural areas.

Management of the Oral Health of Children During the COVID-19 Pandemic in Poland.

Managing the oral health of children during the time of a health emergency linked to the current COVID-19 pandemic presents specific problems. A high number of non-specific effective infection control protocols are available in dental settings. It is of fundamental importance to implement specific protocols relating to those clinical situations that normally do not represent an emergency but which now fall into that category. The aim of this study was the comparison of data obtained from the Regional National Health Fund (NFZ) relating to the number and the type of procedures in the oral health management of children aged 0–18 years from the Wielkopolska region, with the months of March and April of 2019 being compared with those of the, respective, pandemic period of 2020. The results showed statistical differences in the number of performed procedures when comparing 2019 and 2020; especially in April (n = 53,077 in 2019 but only n = 2,287 in 2020), when lockdown restrictions reached their highest level and when only 30% of the dental clinics for children were open for patients in the Wielkopolska region of Poland. Regarding surgical cases, there were no differences in percentage frequency between April 2019 and 2020 in terms of extractions. However, an increase was observed in abscess incisions (3.5–17.8%) and surgical dressings (1.5–10.07%). There was a decrease in the total number of performed conservative dentistry procedures in April 2020, but temporary fillings in primary and permanent teeth showed a prominent increase: from 6.4% in 2019 to 19.3% in 2020; and 5.8–11.4%, respectively. Pulp treatment and mucosal lesions therapy fall into the dental emergency category during this COVID-19 pandemic. These cases have shown an increase from 3.2% in 2019 to 12.8% in 2020 for pulp treatment, and from 2.3 to 4.3% for the treatment of oral mucosal lesions. As suspected, after the lockdown was implemented, the number of pediatric dental cases were low. Moreover, the analysis revealed differences in the profile of clinical situations that represented the emergency cases and the pandemic treatment protocols. Future implications suggest that dental prophylactic procedures be included in pandemic protocols with even dental services being limited to a form of urgent treatment. New approaches and treatment models should be implemented in the control of the infectious spread of the disease in the management of the oral health of children in this pandemic period.

Communication and functioning of pupils with autism in public school three case studies

Ewelina Zając, Communication and functioning of pupils with autism in public school – three case studies. Interdisciplinary Contexts of Special Pedagogy,no. 24, Poznań 2019. Pp. 139-153. Adam Mickiewicz University Press. ISSN 2300-391X. DOI: https://doi.org/10.14746/ikps.2019.24.08
 The purpose of this article is to characterize the means of communication of three autistic pupils with their teachers and peers as well as their daily functioning in the community of one of the public schools located in the Wielkopolska region of Poland.

First Report of Prunus domestica as the Host of a Phytoplasma Belonging to Group 16SrI, Subgroup B/L

HomePlant DiseaseVol. 103, No. 1First Report of Prunus domestica as the Host of a Phytoplasma Belonging to Group 16SrI, Subgroup B/L PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Prunus domestica as the Host of a Phytoplasma Belonging to Group 16SrI, Subgroup B/LA. Zwolińska, N. Borodynko-Filas, D. Nowaczyk, and B. Hasiów-JaroszewskaA. Zwolińska†Corresponding author: A. Zwolińska; E-mail: E-mail Address: a.zwolinska@iorpib.poznan.plhttp://orcid.org/0000-0003-2681-2915Search for more papers by this author, N. Borodynko-FilasSearch for more papers by this author, D. NowaczykSearch for more papers by this author, and B. Hasiów-JaroszewskaSearch for more papers by this authorAffiliationsAuthors and Affiliations A. Zwolińska † N. Borodynko-Filas D. Nowaczyk B. Hasiów-Jaroszewska , Institute of Plant Protection – National Research Institute, Virology and Bacteriology Department, Poznań, Poland. Published Online:31 Oct 2018https://doi.org/10.1094/PDIS-06-18-0963-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat In July 2016 and 2017, diseased plum trees (Prunus domestica L.) were observed in the orchard localized in the Wielkopolska region of Poland. The symptoms of witches’ brooms with internode shortening, axillary bud growth, and reduced leaf size indicated a potential phytoplasma infection. Samples of shortened shoots were collected from five symptomatic and five asymptomatic plants, respectively. DNA samples were extracted from 2 g of leaf tissues using a modified cetyltrimethylammonium bromide procedure (Maixner et al. 1995) and subsequently used as templates in nested polymerase chain reaction (PCR) for the amplification of genes encoding 16S rRNA; ribosomal proteins (rp) S19, L22, and S3 and elongation factor Tu (tuf) with primers P1/P7 followed by R16F2n/R16R2; rpF1/rpR1 followed by rp(I)F1A/rp(I)R1A and fTuf1/rTuf1 followed by fTufAY/rTufAY, respectively (Duduk et al. 2013; Martini et al. 2007; Schneider et al. 1997). Amplicons of correct sizes (1.2, 1.2, and 0.9 kb) were obtained from all the diseased plants tested (samples Plum1 to Plum5), respectively. No PCR products were obtained from the asymptomatic samples. All PCR products were ligated into pGEM-T Easy Vector Systems (Promega), and plasmid DNA was sequenced by an external company (Genomed, Warsaw, Poland). The 16S rDNA, tuf, and rp genes coding sequences from Plum1 to Plum5 were identical, and therefore one representative sequence of each region was deposited in GenBank under accession numbers MH061193, MH061368, and MH061366, respectively. The R16F2n/R16R2 (MH061193) primed fragment was subjected to in silico restriction digestion using iPhyClassifier, the online tool for phytoplasma classification (https://plantpathology.ba.ars.usda.gov/cgi-bin/resource/iphyclassifier.cgi). The collective restriction fragment length polymorphism patterns indicated that diseased plants were infected by ‘Candidatus Phytoplasma asteris’ of subgroup 16SrI-L. Next, the 385-bp barcode fragments of the EF-Tu gene from representatives of different phytoplasma groups were retrieved from the GenBank database. The phylogenetic analysis was performed based on those sequences and the tuf sequence obtained in this study using the neighbor joining algorithm of MEGA 7 software (https://www.megasoftware.net/). The 1.2-kbp DNA segment containing rp genes was also analyzed. In the phylogenetic trees, the Polish isolate of plum witches’ broom phytoplasma clustered together with ‘Ca. P. asteris’ representatives of ribosomal subgroup 16SrI-B and 16SrI-B/L. Based on all the performed analyses, the plum witches’ broom phytoplasma (PlumWB) was classified as a member of group 16SrI, subgroup B/L, which consists of two heterogeneous 16Sr RNA genes (Jomantiene et al. 2010). To our knowledge, this is the first report of plums infected with ‘Ca. P. asteris’ representing subgroup I-B/L in Poland, suggesting that fruit trees can be perennial reservoirs of the phytoplasma, which has great significance in the pathogen’s epidemiology.

Structure and significance of knowledge networks in two low-tech clusters in Poland

The co-location and networking of firms and institutions, also known as clustering, positively influences the innovativeness of firms. The cluster literature provides a single-sided understanding of how clusters function due to an overemphasis in the literature on clusters in high-tech and developed economies at the expense of clusters in low-tech industries in less-developed regions. Applying social network analysis (SNA), this paper studies two furniture clusters in the Wielkopolska region of Poland. The findings demonstrate that: (1) the critical factor is the impact of institutionalization on the mechanisms of knowledge flows, Marshall’s externalities and, in consequence, innovativeness of firms; and (2) the underlining clusters do not show a tendency to build cluster-external linkages, opposing the dominant premise in the cluster literature. In the absence of national and international relations, managers of small and medium-sized firms and local institutions are the main sources of novelty for the clusters at the sustaining stage of their life cycle. The findings pave the way for initiatives aiming at creating and developing knowledge networks in lagging and catching-up regions in Europe, particularly those specialized in low-tech sectors.

Application of the PCR-DGGE technique to the fungal community of traditional Wielkopolska fried ripened curd cheese to determine its PGI authenticity

Fried ripened curd cheese is a traditional dairy product from the Wielkopolska region of Poland. It is made from cows’ milk and has Protected Geographical Indication (PGI) status. The aim of this study was to use the microbial-culture-independent PCR-DGGE technique to examine whether a link exists between the fungal community present in the product and the geographical origin of the cheese. To look for correlations between the geographical origin and the microbiota composition, the DGGE fingerprinting profiles were subjected to a multivariate analysis, which included k-means clustering and principal component analysis (PCA). The dominant eukaryotic community of this traditional product, which has been investigated here for the first time, was shown to be composed of Galactomyces geotrichum, Kluyveromyces marxianus, Pichia kudriavzevii, Candida inconspicua, and Trichosporon spp. Our results demonstrated that PCR-DGGE is a simple and relatively inexpensive method for the traceability of Wielkopolska fried cheese and could be extended to other microbe-enriched foodstuffs.

Identification of new Brome mosaic virus (BMV) isolates systemically infecting Vigna unguiculata L

Here we describe two Brome mosaic virus (BMV) isolates from the Wielkopolska region of Poland. The BMV-Sr and BMV-Sz isolates were collected from maize [Zea mays L. ssp. Indentata] and triticale [× Triticosecale Wittm. ex A. Camus] plants respectively. Newly emerged BMV isolates, similarly to the BMV-M2 strain derived from an Arkansas isolate, have a wide host range that includes species in the Poaceae and Fabaceae families. Furthermore, immunological reactions of icosahedral virions from non-inoculated cowpea [Vigna unguiculata L.] leaves with a specific immunoglobulin confirmed that each of these isolates can systemically infect cowpea. We characterized the BMV-Sr and BMV-Sz genomic sequences encoding the replication protein (1a), polymerase (2a), complete movement protein (3a) and coat protein (CP) genes. The 1a, 2a, 3a and CP gene sequences showed 98.9, 97.6, 98.4 and 97.7 % nucleotide sequence identity between the Polish isolates respectively. Phylogenetic analysis based on these four genes confirmed the species identity of the isolates. A phylogenetic tree based on RNA3 (3a and CP genes) showed independent clustering of the Polish isolates. Amino acid sequence analysis of the 3a protein revealed that both Polish isolates are characterized by a single amino acid mutation at the 81st position, when compared with the Russian isolate. It had been previously reported that four amino acid mutations in this region determined BMV systemic infection in cowpea. Our results indicate that a single non-synonymous substitution in the cell-to-cell movement protein may be crucial for the nature of cowpea infection.

Selected Factors of Fibrous Plant Production in Poland

The paper presents issues linked with the Polish sector of fibrous plants in terms of economic and production conditions. The author analyzes the situation of flax and hemp producers in which industrial plants have traditionally been cultivated in Poland. He determines the cause of significant reduction in the cultivation area of these plants in the total volume of crops, despite beneficial climatic and soil conditions prevailing in Poland. The paper also presents the economic conditions of the processes linked with agriculture of fibrous plants with special reference to globalization phenomena and current situation in the European Union. Further the paper shows the results of the study carried out among the farmers working in Wielkopolska region of Poland. Their responses indicate that the cultivation of fibrous plants is a marginal form of agricultural activity and it is believed to be difficult and the demand for the produce is not guaranteed. The farmers also would welcome higher economic effectiveness of these crops that could result from agricultural policy instruments, i.e., subsidies to the production of the fibrous raw materials. The paper concludes with the description of the perspectives for the development of this sector of agriculture and possible nontextile applications of the flax and hemp, e.g., in biomedicine, construction, and energy production.

Screening of trace elements in hair of the female population with different types of cancers in Wielkopolska region of Poland.

Background. Cancer constitutes a major health problem worldwide. Thus, search for reliable and practical markers of the disease process remains the key issue of the diagnostic process. Objectives. The study aims at linking the trace element status of an organism, assessed by hair analysis, with the occurrence of cancer diseases. Material and Methods. Hair samples were collected from 299 patients with cancer diseases confirmed by a histopathological test and from 100 controls. Cancer patients were divided into three groups, depending on cancer type: hormone-dependent cancer, cancer of the alimentary tract, and cancer with high glycolytic activity. Mineral element analysis of hair was performed using an atomic emission spectrophotometer with inductively coupled plasma (ICP-OES) and inductively coupled plasma mass spectrometry (ICP-MS). Results. Statistically significantly lower concentrations of selenium, zinc, copper, germanium and boron, iron, and magnesium were observed in the three groups of cancer patients. Disturbance in the axis glucose-insulin and changes in concentrations of heavy metals and toxic elements were also noted. Conclusions. It seems safe to conclude that our results confirmed usefulness of hair element analysis in screening tests for the assessment of the biomarker of various cancer diseases in a female population.

AN ASSOCIATION BETWEEN ADVERSE EVENTS, ANXIETY AND BODY SIZE OF ADOLESCENTS

The aim of the study was to assess the relationship between adverse life events, a tendency to respond with a high level of anxiety, and height and adiposity of adolescents. The sample included 575 persons (309 girls and 266 boys) aged 10-15 (mean 12.73) from the Wielkopolska region of Poland. The influence of adverse events during the 6 months before the examination and anxiety trait, as assessed with a STAIC questionnaire, on body height and BMI was analysed. Also sex, age, chronic diseases and socioeconomic status indicators were assessed. One-way and two-way ANOVA was used for assessment of relationships. Adverse events had no influence on body height and BMI. Subjects with a high level of anxiety trait (>34 score) were shorter (difference z=0.21) than subjects with a normal level of anxiety trait (≤34 score). The association of anxiety trait and body height was significant after adjustment for sex, age, chronic diseases and history of adverse life events. The analysis showed no statistically significant influence of adverse life events on height and BMI and a significant relationship between the general tendency to respond with anxiety and body height of adolescents. This suggests that psychological characteristics associated with the cognitive tendency to interpret events as threatening, and consequently, to respond with stress, may be involved in the variability of biological traits regardless of the objective harmfulness of the situation.

Forecasting the influence of temperature increase on the development of the Colorado potato beetle [Leptinotarsa decemlineata (Say)] in the Wielkopolska region of Poland

The Colorado potato beetle (Leptinotarsa decemlineata) is probably the most dangerous pest species of potatoes. This study assessed the influence of expected climate warming on the number of Colorado potato beetle generations in the Wielkopolska region of Poland using two simulation models, SimLep 1 and NumoGen 1. Two types of data sets were utilised in the simulations: real meteorological data recorded in Winna Góra (52.2N; 17.4E) in the period 2002–2011 and virtual data obtained after transformation of the real data to include an increase in the recorded temperature values between 1 and 6°C. The threat to potato crops from Colorado potato beetle was found to increase in response to expected climate change. A temperature increase of 2°C above that recorded during the last few years would allow the development of two full generations of the beetle, and further temperature increases may even permit the occurrence of three generations.

Statistical analysis of sexual violence cases in Wielkopolska region of Poland – study of prosecutor office data in years 2000-2010

Statistical analysis of sexual violence cases in Wielkopolska region of Poland – study of prosecutor office data in years 2000-2010

Molecular characterisation of the full-length genome of olive latent virus 1 isolated from tomato

Olive latent virus 1 (OLV-1) is a species of the Necrovirus genus. So far, it has been reported to infect olive, citrus tree and tulip. Here, we determined and analysed the complete genomic sequence of an isolate designated as CM1, which was collected from tomato plant in the Wielkopolska region of Poland and represents the prevalent isolate of OLV-1. The CM1 genome consists of monopartite single-stranded positive-sense RNA genome sized 3,699 nt with five open reading frames (ORFs) and small inter-cistronic regions. ORF1 encodes a polypeptide with a molecular weight of 23kDa and the read-through (RT) of its amber stop codon results in ORF1 RT that encodes the virus RNA-dependent RNA polymerase. ORF2 and ORF3 encode two peptides, with 8kDa and 6kDa, respectively, which appear to be involved in cell-to-cell movement. ORF4 is located in the 3' terminal and encodes a protein with 30kDa identified as the viral coat protein (CP). The differences in CP region of four OLV-1 isolates whose sequences have been deposited in GenBank were observed. Nucleotide sequence identities of the CP of tomato CM1 isolate with those of olive, citrus and tulip isolates were 91.8%, 89.5% and 92.5%, respectively. In contrast to other OLV-1 isolates, CM1 induced necrotic spots on tomato plants and elicited necrotic local lesions on Nicotiana benthamiana, followed by systemic infection. This is the third complete genomic sequence of OLV-1 reported and the first one from tomato.

IDENTIFICATION AND CHARACTERIZATION OF AN OLIVE LATENT VIRUS 1 ISOLATE FROM A NEW HOST: SOLANUM LYCOPERSICUM

Isometric virus particles with a diameter of approximately 30 nm were observed in the Wielkopolska region of Poland in greenhouse-grown tomato plants with necrotic foliar symptoms. The viral genome consisted of a single-stranded RNA molecule. RT-PCR with random hexamer primers and sequencing of DNA products revealed 91% identity to Olive latent virus 1 (OLV-1). Further RT-PCR with virus-specific primers confirmed the presence of OLV-1 in symptomatic plants. The host range and the sequence of the coat protein gene of the new OLV-1 isolate, designated CM1, was determined. Differences were observed in biological and genetic traits between the Polish isolate CM1 and other OLV-1 isolates. To our knowledge, this is the first report of OLV-1 in tomato plants.

Detection of Anti-HPV11-L1 Antibodies in Immune Sera from Patients Suffering from Recurrent Respiratory Papillomatosis Using ELISA

Infection with human papillomaviruses (mostly HPV6 and HPV11) may lead to recurrent respiratory papillomatosis (RRP), a chronic disease affecting 2-4/100,000 people. Papillomas have to be removed surgically so patients can breathe normally. Papillomas often grow back and some patients are subjected to a number of operations. In general, asymptomatic HPV-positive people have low levels of antiviral antibodies in their sera, as the human humoral response is weak due to HPV's biology. In patients suffering from RRP who have undergone multiple surgeries, a blood-epithelium barrier breach stimulates the production of anti-HPV antibodies. Our study's aim was to produce HisTag-HPV11-L1 major capsid protein in E. coli cells, and to purify it. We also sought to detect anti-HPV11-L1 antibodies in antisera obtained from RRP patients using ELISA. Clinical samples were collected from 47 patients with RRP (antisera and papillomas), and from 32 controls (sera and oral swabs), from the Wielkopolska region of Poland. Antisera and control sera were used to coat microplates, HisTag-HPV11-L1 antigen was applied, and antibody-antigen complexes were detected by anti-HisTag monoclonal antibody in an ELISA assay. Simultaneously, total cellular DNA was extracted from papillomas and oral squamous cells obtained from controls. All DNA samples were screened for HPV DNA using MY-PCR. All patients were HPV-positive (30% for HPV6 and 70% for HPV11). Statistically significant correlations were found between the amount of anti-HPV11-L1 antibodies in the sera of RRP patients and the number of surgical procedures they underwent. Although HPV virus-like particles are most often used for anti-HPV antibody detection, the ELISA method presented herein is another viable option for use in RRP patients.

The status of agricultural ecosystem examined by microwave data

The Remote Sensing Centre in the Institute of Geodesy and Cartography has undertaken the investigation of applying ENVISAT.ASAR, ALOS.PALSAR, and TerraSAR-X data for modelling of soil moisture under various crops. Radar data are independent of weather conditions and that is why they are very useful in monitoring the dynamic of various soil–vegetation parameters. The aim of the study was to examine the usefulness of radar data for describing the soil–vegetation parameters of agri-environment ecosystem in the Wielkopolska region of Poland. The research on agriculture area has been carried out at ground level by taking measurements of soil moisture, Leaf Area Index, height of the vegetation, and wet and dry biomass. The TerraSAR-X and ALOS.PALSAR images have been applied for classification of agriculture area. The images taken in X band were used for discriminating the structure of vegetation, while the images taken in L-band turned out to be very effective at mapping structure of forests and distinguishing them from non-forest areas. Therefore synergy of images acquired in bands X and L gave good results in classification of forested areas and crops. The influence of soil moisture on backscattering coefficient calculated from ENVISAT.ASAR under various polarisations and incidence angles for different crops distinguished from classification of ENVISAT.ASAR IS6 and IS4 has been examined to find correlations between satellite derived data and soil–vegetation parameters. The best correlation between backscatter and LAI has been obtained by applying ASAR IS6 HH or ASAR IS4 HH images, while the best correlation between backscatter and soil moisture has been obtained applying ASAR IS6 VV or ASAR IS4 VV images. The influence of the crop descriptor such as LAI on backscatter coefficient calculated from ENVISAT.ASAR IS2 HH under various soil moisture conditions as well as the influence of the crop descriptor such as soil moisture on backscatter coefficient calculated from ENVISAT.ASAR IS2 HV under various LAI conditions was examined for wheat using the “water-cloud model”. The relationships between modelled values of soil moisture and LAI and measured values have been derived and discussed.

Song Structure and Repertoire Sharing in the Tawny PipitAnthus campestrisin Poland

Abstract. The present study characterizes the song of Tawny Pipit males (n = 55) recorded in May 2005 in the Wielkopolska region of Poland. Tawny Pipits sang with a very variable rate of 4–28 songs per minute (mean ± SE 16.0 ± 1.35). Songs were thus short, with an average duration of under 0.5 sec. At the same time, songs were relatively complex in structure and consisted of 2–3 (max. 5) units of frequency between 2.7 and 5.3 kHz. Based on visual inspection of sonograms and further cross-correlation analysis, 20 different song types were distinguished. Each male had only a single song type in his repertoire and the rendition of strophes produced by a male were very stereotypical. The songs of different males exhibited varying levels of similarity, from completely different, through sharing some within-song units, to strongly similar on sonograms. However, even the strongly similar songs of different males demonstrated some individuality in frequency parameters or fine note structure. On average, there wer...

The First Report of Tomato torrado virus in Poland.

In 2003 and 2004, unusual disease symptoms, including severe stunting, malformation, and necrosis of the leaves on tomato cv. Grace, were observed in the Wielkopolska Region of Poland. The disease appeared to be associated with the presence of the greenhouse whitefly Trialeurodes vaporariorium. An electron microscopic examination of a negatively stained leaf-dip preparation from an infected plant showed the presence of spherical virus particles approximately 25 to 28 nm in diameter. The virus (designated Wal'03) was shown to be vectored efficiently (100%) by T. vaporariorium and poorly (50 to 70%) by mechanical transmission to tomato. Mechanical inoculation or whitefly transmission caused systemic infection on Nicotiana tabacum (cvs. Xanthi nc, Samsun, and White Burley), N. benthamiana, N. clevelandii, N. debneyi, N. affinis, N. glutinosa, Lycopersicon esculentum, Petunia hybrida, Capsicum annuum, Nicandra physaloides, Physalis floridana, and Solanum tuberosum. The virus did not infect Phaseolus vulgaris, Pisum sativum, Cucumis sativus, Chenopodium quinoa, or Beta vulgaris. Partially purified virus preparations from N. bethamiana or N. tabacum cv. Xanthi centrifuged in a sucrose density gradient sedimented as two separated zones. Viral RNA was extracted from the purified viral preparations with phenol-chloroform, and analysis by denaturing agarose gel electrophoresis revealed RNA 1 (approximately 7,800 bp) and RNA 2 (approximately 5,400 bp). The biological properties and the genomic RNA composition showed significant similarities to that of Tomato necrotic dwarf virus (ToNDV) described from California (1) and the newly identified Tomato torrado virus (ToTV) in Spain (2). Immuno-specific electron microscopy (ISEM) showed Wal'03 virus particles reacted with ToNDV antiserum (provided by W. Wintermantel, Salinas, CA). The genomic sequence of ToTV (GenBank Accession Nos. DQ388879 and DQ388880) was used to design specific primers for analysis by reverse transcription (RT)-PCR: TR1F (5' CAATGTGCCAAAGATGAGCG 3'), TR1R (5' ACTCCCGTGTCTATGTTTTC 3'), TR2F (5' GAAGGACGAAGAGCGACTG 3'), and TR2R (5' AAGGTAGGTATGCGTTTGC 3'), which amplified products of 573 and 892 bp for RNA 1 and RNA 2, respectively. These RT-PCR fragments from Wal'03 were sequenced (GenBank Accession Nos. EF635007 and EF635008) and comparisons with ToTV showed 99 and 98% nucleotide identity for RNA1 and RNA2, respectively. Immunocapture-RT-PCR with leaf tissue from N. benthamiana infected by Wal'03, antiserum against ToNDV, and ToTV-specific primers TR2F and TR2R produced a fragment of the expected size. Sequence of this product showed 100% identity with previously obtained RT-PCR fragments. The similarity of the symptoms on tomato plants, the morphology of virus particles, genome composition and nucleotide sequence identities suggest that Wal'03 and ToTV are the same.

First Report of Beet virus Q on Sugar Beet in Poland.

The objective of this work was to determine whether Beet virus Q (BVQ), a member of the genus Pomovirus, is present in Poland. BVQ, like Beet necrotic yellow vein virus (BNYVV), is transmitted by Polymyxa betae Keskin. Earlier, BVQ was described as the Wierthe serotype of Beet soilborne virus (BSBV). Now, on the basis of its genomic properties (2), BVQ is recognized as a distinct virus species. BVQ is often found in fields where BSBV and BNYVV are present (4). During the fall of 2005, five plants of a cultivar susceptible to rhizomania (cv. Alyssa) and five resistant to rhizomania (cv. Henrietta) were collected from a field in the Wielkopolska Region of Poland, where BSBV and BNYVV had been previously identified, and tested for BVQ (1). All samples were analyzed by a double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA) with antiserum against BNYVV (Bio-Rad, Hercules, CA). Rhizomania was identified only in sugar beet samples of the susceptible variety. The same samples were then tested using a triple antibody sandwich (TAS)-ELISA with commercial antisera against BSBV/BVQ (As-0576.2) and BSBV (As-0576.1) (DSMZ, Braunschweig, Germany). Nine sugar beet plants gave positive reactions with antiserum against BSBV/BVQ and negative reactions with antiserum specific to BSBV. Total RNA extracted from roots of 10 beet samples was then tested using a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) and specific primers designed to amplify a fragment of the RNA2 for BNYVV and BVQ (3). The primers specifically amplified fragments of 545 bp and 291 bp of the BNYVV and BVQ, respectively. BNYVV was detected in all five samples from susceptible sugar beet plants. The presence of BVQ was confirmed in nine of the sugar beer plants, and the RT-PCR products were sequenced. Sequence analysis of the 206-nt amplicon sequence of the Polish isolate of BVQ (GenBank Accession No. DQ309444) indicated 97% nucleotide and 94% amino acid sequence identity with the previously published sequence of BVQ (GenBank Accession No. AJ223596) (2). To my knowledge, this is the first report of the natural occurrence of BVQ on sugar beet in Poland. In Europe, it has been previously reported in Belgium, Bulgaria, France, Germany, Hungary, Italy, the Netherlands, Spain, and Sweden (3,4).