Whole-body Fluorescence Imaging Research Articles

Telomerase-Specific Virotheranostics for Human Head and Neck Cancer

Long-term outcomes of patients with squamous cell carcinoma of the head and neck (SCCHN) remain unsatisfactory despite advances in combination of treatment modalities. SCCHN is characterized by locoregional spread and it is clinically accessible, making it an attractive target for intratumoral biological therapies. OBP-301 is a type 5 adenovirus that contains the replication cassette in which the human telomerase reverse transcriptase promoter drives expression of the E1 genes. OBP-401 contained the replication cassette and the green fluorescent protein (GFP) gene. The antitumor effects of OBP-301 were evaluated in vitro by the sodium 30-[1-(phenylaminocarbonyl)-3,4-tetrazolium]-bis(4-methoxy-6-nitro)benzene sulfonic acid hydrate assay and in vivo in an orthotopic xenograft model. Virus spread into the lymphatics was also orthotopically assessed by using OBP-401. Intratumoral injection of OBP-301 resulted in the shrinkage of human SCCHN tumors orthotopically implanted into the tongues of BALB/c nu/nu mice and significantly recovered weight loss by enabling oral ingestion. The levels of GFP expression following ex vivo infection of OBP-401 may be of value as a positive predictive marker for the outcome of telomerase-specific virotherapy. Moreover, whole-body fluorescent imaging revealed that intratumorally injected OBP-401 could visualize the metastatic lymph nodes, indicating the ability of the virus to traffic to the regional lymphatic area and to selectively replicate in neoplastic lesions, resulting in GFP expression and cell death in metastatic lymph nodes. These results illustrate the potential of telomerase-specific oncolytic viruses for a novel therapeutic and diagnostic approach, termed theranostics, for human SCCHN.

Real-Time In Vivo Green Fluorescent Protein Imaging of a Murine Leishmaniasis Model as a New Tool for Leishmania Vaccine and Drug Discovery

Leishmania species are obligate intracellular protozoan parasites that cause a broad spectrum of clinical diseases in mammalian hosts. The most frequently used approach to quantify parasites in murine model systems is based on thickness measurements of the footpad or ear after experimental infection. To overcome the limitations of this method, we used a Leishmania mutant episomally transfected with enhanced green fluorescent protein, enabling in vivo real-time whole-body fluorescence imaging, to follow the progression of Leishmania infection in parasitized tissues. Fluorescence correlated with the number of Leishmania parasites in the tissue and demonstrated the real-time efficacy of a therapeutic vaccine. This approach provides several substantial advantages over currently available animal model systems for the in vivo study of immunopathogenesis, prevention, and therapy of leishmaniasis. These include improvements in sensitivity and the ability to acquire real-time data on progression and spread of the infection.

Disparity between prostate tumor interior versus peripheral vasculature in response to verteporfin‐mediated vascular‐targeting therapy

Photodynamic therapy (PDT) is a light-based cancer treatment modality. Here we employed both in vivo and ex vivo fluorescence imaging to visualize vascular response and tumor cell survival after verteporfin-mediated PDT designed to target tumor vasculature. EGFP-MatLyLu prostate tumor cells, transduced with EGFP using lentivirus vectors, were implanted in athymic nude mice. Immediately after PDT with different doses of verteporfin, tumor-bearing animals were injected with a fluorochrome-labeled albumin. The extravasation of fluorescent albumin along with tumor EGFP fluorescence was monitored noninvasively with a whole-body fluorescence imaging system. Ex vivo fluorescence microscopy was performed on frozen sections of tumor tissues taken at different times after treatment. Both in vivo and ex vivo imaging demonstrated that vascular-targeting PDT with verteporfin significantly increased the extravasation of fluorochrome-labeled albumin in the tumor tissue, especially in the tumor periphery. Although PDT induced substantial vascular shutdown in interior blood vessels, some peripheral tumor vessels were able to maintain perfusion function up to 24 hr after treatment. As a result, viable tumor cells were typically detected in the tumor periphery in spite of extensive tumor cell death. Our results demonstrate that vascular-targeting PDT with verteporfin causes a dose- and time-dependent increase in vascular permeability and decrease in blood perfusion. However, compared to the interior blood vessels, peripheral tumor blood vessels were found less sensitive to PDT-induced vascular shutdown, which was associated with subsequent tumor recurrence in the tumor periphery.

Diet and Abdominal Autofluorescence Detected by in Vivo Fluorescence Imaging of Living Mice

We investigated the effect of diet on abdominal autofluorescence detected by in vivo fluorescence imaging (FLI) of living mice. Groups of mice were fed a regular, alfalfa-free, or purified diet, and whole-body FLI was performed without the administration of fluorescent probes. In addition, quantum dots were injected intravenously into mice fed one of the three diets, and FLI was performed 3 and 24 hours later. Intense autofluorescence originating from the animals' intestinal contents was observed in mice fed the regular diet. Intestinal autofluorescence decreased substantially after feeding with the alfalfa-free diet and further after feeding with the purified diet. The decline was rapid and took only 1 to 2 days; however, it may have been affected by an intake of feces. The reticuloendothelial system was clearly delineated using a low dose of quantum dots in mice fed the purified diet. On the other hand, intestinal autofluorescence was visible 24 hours postinjection in mice given the alfalfa-free diet and definitely impaired the image quality in mice fed the regular diet. The use of a low-fluorescence diet, especially a purified diet, rapidly reduces intestinal autofluorescence and is expected to enhance the potential of in vivo FLI.

新型DR-WFOI活体小动物实时分子成像系统

Digital radiography (DR) and whole-body fluorescent optical imaging (WFOI) have been widely applied in the field of molecular imaging, with the advantages in tissues and functional imaging. The integration of them contributes to the development and discovery of medicine. We introduce an equipment, performance of which is better than that of another molecular imaging system manufactured by Kodak Corp. It can take real-time small animal imaging in vivo, with lower cost and shorter development cycle on the LabVIEW platform. At last, a paradigm experiment on a nude mouse with green fluorescent protein (GFP) transgenic tumor is given to present a real-time DR-WFOI fusion simultaneous image.

An Imageable Metastatic Treatment Model of Nasopharyngeal Carcinoma

Nasopharyngeal carcinoma is highly prevalent in southern China and is often resistant to current treatment options. Clinically relevant mouse models are necessary for further understanding and drug discovery in this disease. Two nasopharyngeal carcinoma cell lines, stably expressing green fluorescent protein (GFP), 5-8F-GFP and 6-10B-GFP, were established. The cells were orthotopically injected into the nasopharynx or ectopically into the subcutis of nude mice. Whole-body fluorescence imaging was used to monitor the growth of the primary tumor as well as angiogenesis and metastasis. The metastatic behavior of 5-8F and 6-10B were distinct in the orthotopic model. Orthotopic implantation of highly metastatic 5-8F cells resulted in brain invasion, cervical lymph node metastases, and pulmonary metastases similar to what is often observed in patients. Cell line 6-10B was less metastatic, which occasionally resulted in pulmonary metastasis. GFP enabled imaging of micrometastasis. Neither 5-8F nor 6-10B were metastatic in the s.c. site. These results indicated that, in addition to the cancer cell type, the host microenvironment was critical for metastasis to occur consistent with the "seed-and-soil" hypothesis. 5-8F was highly sensitive to 5-fluorouracil (5-FU), whereas 6-10B was moderately sensitive. The imageable orthotopic model should play a critical role in elucidating the mechanisms involved in the growth, progression, metastasis, and angiogenesis of nasopharyngeal carcinoma and for evaluation of novel compounds with potential efficacy.

Detection of myeloma in skeleton of mice by whole-body optical fluorescence imaging

Development of new therapies for myeloma has been hindered by the lack of suitable preclinical animal models of the disease in which widespread tumor foci in the skeleton can be detected reliably. Traditional means of detecting skeletal tumor infiltration such as histopathology are cumbersome and labor-intensive and do not allow temporal monitoring of tumor progression or regression in response to therapy. To resolve this problem, we modified the Radl 5TGM1 model of myeloma bone disease such that fluorescent myeloma tumors can be optically imaged in situ. Here, we show that murine myeloma 5TGM1 tumor cells, engineered to express enhanced green fluorescent protein (eGFP; 5TGM1-eGFP cells), can be imaged in a temporal fashion using a fluorescence illuminator and a charge-coupled device camera in skeletons of live C57BL/KaLwRij mice. High-resolution, whole-body images of tumor-bearing mice revealed that myeloma cells homed almost exclusively to the skeleton, with multiple focal tumor foci in the axial skeleton, consistent with myeloma tumor distribution in humans. Finally, the tested antitumor treatment effect of Velcade (bortezomib), a proteasome inhibitor used clinically in myeloma, was readily detected by GFP imaging, suggesting the power of the technique in combination with the Radl 5TGM1-eGFP model for rapid preclinical assessment and sensitive monitoring of novel and potential therapeutics. Whole-body GFP imaging is practical, convenient, inexpensive, and rapid, and these advantages should enable a high throughput when evaluating in vivo efficacy of new potential antimyeloma therapeutics and assessing response to treatment.

In vivo imaging of cidofovir treatment of cowpox virus infection

Variola virus and other members of the genus Orthopoxviruses constitute a prominent bioterrorism and public health threat. Treatment with the anti-viral drug cidofovir inhibits replication of orthopoxviruses in vitro and in vivo. In this study, we visualized the effect of cidofovir on viral kinetics in orthopoxvirus infected mice by using whole-body fluorescence imaging (FI). We engineered a cowpox virus (CPV) expressing the enhanced green fluorescent protein (GFP). Single-step growth curves and calculated 50% lethal doses (LD 50) of wild-type CPX (Wt-CPV) and GFP-expressing CPX (GFP-CPV) were comparable. Whole-body FI first detected GFP fluorescence in the mesenteric tissue of untreated animals on post-infection day (PID) 1. On PID 3 GFP signal was detected throughout the mesentery, in all abdominal organs by PID 5 and in most major organs, except for the heart and brain by PID 6. Infected animals treated with 25 mg/kg of cidofovir also began showing signs of viral replication on PID 1, however, the fluorescent signal was limited only to discrete foci throughout the course of the infection. This work describes the first use of an established Orthopox model of infection to evaluate drug efficacy and track virus progression on a macroscopic level.

Monitoring changes of serum protein markers in metastatic colorectal carcinoma model

To investigate the changes of several protein markers in a metastatic colorectal carcinoma model by serum proteomic analysis. The pEGFP-N1 plasmid with enhanced expression of green fluorescence protein (EGFP) was transfected into human colon carcinoma cell line SW480 to obtain a stable SW480-EGFP cell line, the SW480-EGFP cells were then injected subcutaneously into nude mice. The harvested tumor cells were implanted orthotopically into the colon of the nude mice. Real-time tumor growth and metastasis formation were visualized by whole-body fluorescent imaging system. Serum samples at different metastatic stages were collected and differential proteomic profiles were investigated by two-dimensional gel electrophoresis (2DE) and matrix-assisted laser absorption/ionization time of flight mass spectrometry (MALDI-TOF MS). The SW480- EGFP cells enabled to express EGFP stably. The rates of subcutaneous and orthotropic tumor formation were 100%. The metastasis rates to local lymph nodes, liver and lung were 100%, 40% and 30%, respectively. Furthermore, 5 differentially expressed proteins were analyzed by serum proteome technologies, including haptoglobin alpha chain, apolipoprotein E, apolipoprotein A-IV, Ig kappa chain V region chain L and transferrin. Visualized metastatic model of colorectal carcinoma was successfully established. Several differentially expressed serum proteins collected at different stages after the occurrence of metastasis were identified. These differentially expressed proteins may be candidate serum biomarkers for diagnosis and therapeutic evaluation of colorectal carcinoma metastasis.

Inhibition of Pulmonary and Skeletal Metastasis by a Transforming Growth Factor-β Type I Receptor Kinase Inhibitor

Transforming growth factor-beta (TGF-beta) signaling has been shown to promote invasion and metastasis in various models of human cancers. In this study, we investigated the efficacy of a TGF-beta type I receptor kinase inhibitor (TbetaRI-I) to limit early systemic metastases in an orthotopic xenograft model of lung metastasis and in an intracardiac injection model of experimental bone and lung metastasis using human breast carcinoma MDA-MB-435-F-L cells, a highly metastatic variant of human breast cancer MDA-MB-435 cells, expressing the enhanced green fluorescent protein (EGFP). Treatment of the cells with the TbetaRI-I had no effect on their growth but blocked TGF-beta-stimulated expression of integrin alpha(v)beta(3) and cell migration in vitro. Systemic administration of the TbetaRI-I via i.p. injection effectively reduced the number and size of the lung metastasis in both orthotopic xenograft and experimental metastasis models with no effects on primary tumor growth rate compared with controls. TbetaRI-I treatment also reduced the incidence of widespread early skeletal metastases in the femur, tibia, mandible, and spine detected by whole-body EGFP fluorescence imaging. Tumor burden in femora and tibiae was also reduced after TbetaRI-I treatment as detected by histomorphometry analysis compared with the placebo controls. Our results indicate for the first time that abrogation of TGF-beta signaling by systemic administration of the TbetaRI-I can inhibit both early lung and bone metastasis in animal model systems and suggest antimetastatic therapeutic potential of the TbetaRI-I.

The Bisphosphonate Olpadronate Inhibits Skeletal Prostate Cancer Progression in a Green Fluorescent Protein Nude Mouse Model

Metastatic bone disease is one of the major causes of morbidity and mortality in prostate cancer patients. Bisphosphonates are currently used to inhibit bone resorption and reduce tumor-induced skeletal complications. More effective bisphosphonates would enhance their clinical value. We tested several bisphosphonates in a green fluorescent protein (GFP)-expressing human prostate cancer nude mouse model. The in vivo effects of four bisphosphonates, including pamidronate, etidronic acid, and olpadronate, on bone tumor burden in mice intratibially inoculated with PC-3-GFP human prostate cancer cells were visualized by whole-body fluorescence imaging and X-ray. The PC-3-GFP cells produced extensive bone lesions when injected into the tibia of immunocompromised mice. The skeletal progression of the PC-3-GFP cell growth was monitored by GFP fluorescence and the bone destruction was evaluated by X-ray. We showed that 3,3-dimethylaminopropane-1-hydroxy-1,1-diphosphonic acid (olpadronate) was the most effective bisphosphonate treatment in reducing tumor burden as assessed by GFP imaging and radiography. The GFP tumor area and X-ray score significantly correlated. Reduced tumor growth in the bone was accompanied by reduced serum calcium, parathyroid hormone-related protein, and osteoprotegerin. The serum calcium, parathyroid hormone-related protein, and osteoprotegerin levels were significantly correlated with GFP area and X-ray scores. Treatment with olpadronate reduced tumor growth in the bone measured by GFP and X-ray imaging procedures. Imaging of GFP expression enables monitoring of tumor growth in the bone and the GFP results complement the X-ray assessment of bone disease. The data in this report suggest that olpadronate has potential as an effective inhibitor of the skeletal progression of clinical prostate cancer.

Diagnosis of peritonitis using near-infrared optical imaging of in vivo labeled monocytes-macrophages

Peritonitis is an inflammatory process characterized by massive monocytes-macrophages infiltration. Since early diagnosis is important for a successful therapeutic outcome, the feasibility for a selective labeling and imaging of macrophages for highly sensitive optical imaging was assessed. After in vitro incubation of mouse macrophages J774A.1 with the far-red/near-infrared fluorochrome DY-676, distinct fluorescence intensities (1026+/-142 a.u.) were detected as compared to controls (552+/-54 a.u.) using a whole-body small animal near-infrared fluorescence (NIRF) imaging system. Macrophage labeling was confirmed by confocal laser scanning microscopy (CLSM) and fluorescence-activated cell sorting, (FACS). The fluorochrome was also found to be predominantly distributed within compartments in the cytoplasm. Additionally, peritonitis was induced in mice by intraperitoneal injection of zymosanA. After intravenous injection of fluorochrome (55 nmol/kg) and using whole-body fluorescence imaging, higher fluorescence intensities (869+/-151 a.u.) were detected in the peritoneal area of diseased mice as compared to controls (188+/-41 a.u.). Furthermore, cells isolated from peritoneal lavage revealed the presence of labeled monocytes-macrophages. The results indicate that in vivo diagnosis of peritonitis by near-infrared optical imaging of labeled monocytes-macrophages is feasible. Possibly, early stages of other inflammatory diseases could also be detected by the proposed diagnostic method in the long term.

PKC δ Inhibition Restores PTEN Activity in Myeloma Cells and Prolongs Survival of GFP+ Myeloma SCID/NOD Mice In Vivo.

PTEN, a cellular phosphatase involved in the regulation of phosphatidylinositol phosphates (PIPs), is often inactivated in myeloma cells either through gene mutation or via phosphorylation of serine and threonine residues in the PTEN C-terminal domain that also results in loss of its activity and stability. The loss of PTEN function results in a failure to de-phosphorylate PIPs with a corresponding increase in Akt kinase activity. We have recently reported that PKCδ inhibition with Rottlerin (3 μM) induces cell death in sensitive and resistant myeloma cell lines (MM1S, MM1R, 8226S and U266) ( Blood 2002, 100,11,393a). In addition Rottlerin blocked constitutive as well as IGF-1 induced phosphorylation of Akt abrogating its kinase activity and suppresses the phosphorylation of FKHR, GSK 3α/β and Bad, downstream substrates of Akt, triggerring activation of the intrinsic apoptotic pathway with loss of the mitochondrial membrane potential (Δψ) and cleavage of caspases 9, 3 and PARP. PKCδ inhibition also suppressed, upstream of Akt, ser 241-PDK1 phosphorylation by PIPs. These findings led us to investigate the PTEN status in human myeloma cell lines (MM1S, 8226S and U266). While normal PTEN expression was detected in these cell lines, PTEN was universally phosphorylated on ser 380 in its C-terminal domain, resulting in loss of its activity. Rottlerin completely suppressed the phosphorylation of this serine residue, restoring PTEN function and dephosphorylating PIPs. In order to verify that Rottlerin exhibited its effects by inhibiting PKCδ, we first stably overexpressed PKCδ in the 8226S cells. PKCδ overexpression partially protected these cells against rotttlerin cytotoxicity and abrogated rottlerin induced AKT inhibition and PTEN activation. Furthermore transfection of 8226S cells with a mammalian PKCδ siRNA expression plasmid (sense strand of shRNA: 5′_AAGAACGCTTCAACATCGACATTCAAGATGCGATGTTGAAGCGTTCTTTTTTTG_3′expression plasmid) reduced PKCδ expression by nearly 90% and more importantly it reduced PTEN, Akt and GSK 3α/β phosphorylation. Finally, we examined the effect of Rottlerin on the viability of GFP+ myeloma SCID/NOD mice in vivo. 4 to 6 weeks old SCID/NOD mice were irradiated (300 rads) and 24 h later received tail vein injections of 5 x 106 RPMI-8226/S-GFP+ cells. Treatment with Rottlerin (3mg/kg ip) every other day was effective in slowing tumor growth as monitored by whole-body real-time fluorescence imaging and prolonged median survival of GFP+ myeloma SCID/NOD mice compared to a non-treated control cohort. In summary, our work provides evidence that PKCδ inhibition restores PTEN function in wild type PTEN expressing myeloma cells and is a valid biological target for the treatment of multiple myeloma.

High Correlation of Whole-Body Red Fluorescent Protein Imaging and Magnetic Resonance Imaging on an Orthotopic Model of Pancreatic Cancer

We have developed genetically fluorescent orthotopic models of human pancreatic cancer. In these models, noninvasive fluorescent protein imaging (FPI) of internal primary tumors and metastatic deposits has been carried out. Whole-body tumor images are easily and inexpensively obtained using FPI, permitting both detection and quantification of tumor load. In this study, we simultaneously compared single mice with a highly fluorescent, red fluorescent protein-expressing orthotopic pancreatic cancer xenografts with both FPI and high-resolution magnetic resonance imaging (MRI). Images were acquired at multiple time points after tumor implantation in the pancreas. Indwelling pancreatic primary tumors and metastatic foci were detected by both FPI and MRI. Moreover, a strong correlation existed between images taken with these two technologies. FPI permitted rapid, high-throughput imaging without the need for either anesthesia or contrast agents. Both FPI and MRI enabled accurate imaging of tumor growth and metastasis, although MRI enabled tissue structure to be visualized as well. FPI has high resolution and is exceedingly rapid with instant image capture. We suggest a complimentary role for these two imaging modalities.

PARTICLES HOME IN ON DISEASED CELLS

NANOPARTICLES THAT REveal pancreatic cancer cells in mice have been developed in the laboratory of Ralph Weissleder at Harvard Medical School. Currently, tools for early detection of pancreatic cancer in humans are lacking, and the nanoparticles may be a step toward better diagnosis of this deadly disease. Weissleder and coworkers thought that decorating certain fluorescent magnetic nanoparticles—already being used clinically for magnetic resonance imaging—with small molecules would enable the nanoparticles to be taken up selectively by specific cells. The researchers have now shown that this idea works. For example, nanoparticles studded with isatoic or 5-chloroisatoic anhydride are selectively taken up by pancreatic cancer cells in mice. Their presence inside those cells can be revealed by whole-body fluorescence or magnetic resonance imaging ( Nature Biotechnot. , published Oct. 23, dx.doi.org/10.1038/nbtll59). Weissleder's approach is novel, says Robert S. Langer, professor of chemical engineering at ...

Optical molecular imaging of lymph nodes using a targeted vascular contrast agent

We develop a highly specific antibody-dye conjugate for optical imaging of peripheral lymph nodes. The contrast agent consists of the monoclonal antibody recognizing endothelial ligands for the lymphocyte homing receptor L-selectin, MECA-79, and a near-infrared (near-IR) fluorescent indotricarbocyanine dye. The targeting and biodistribution behavior of MECA-79 is studied after radio-iodination and intravenous injection into mice demonstrating specific uptake in lymph nodes and accumulation in high endothelial venules (HEV). After conjugation of MECA-79 with indotricarbocyanine dye, the fluorescence imaging properties of the MECA-79 dye conjugate are examined by intravenous injection in nude mice and laser-induced fluorescence whole-body imaging in vivo. The MECA-79 antibody-dye conjugate accumulates in peripheral lymph nodes, whereas an isotype antibody-dye conjugate does not. Specific lymph node near-IR fluorescent signals become detectable within minutes after injection, and stable imaging persists for more than 24 h. The results demonstrate that vascular targeting of endothelial expression of glyocproteins is feasible to visualize the accumulation of near-IR fluorescent MECA-79 in lymph nodes, making this technology potentially useful to characterize processes of inflammation.

Anti-Tumor Activity of KOS-953, a Cremophor-Based Formulation of the hsp90 Inhibitor 17-AAG.

We have previously shown that inhibitors of the hsp90 molecular chaperone (including geldanamycin, 17-allylamino-17-demethoxy-geldanamycin (17-AAG) and other members of the ansamycin family) have in vitro and in vivo activity against MM cells (including drug-sensitive and -resistant cells) and confer sensitization to several other anti-tumor agents. An extensive program of phase I clinical trials in solid tumors has documented biological activity of 17-AAG with manageable hsp90 inhibitor-related toxicities and has identified maximum tolerated doses for further clinical development. These first trials involved an intravenous formulation of 17-AAG in DMSO and egg-phospholipids. As such, it is believed that the formulation may have contributed to some of the observed side effects of 17-AAG administration; and conversely, that alternative formulations of 17-AAG in clinically inert excipients might potentially allow for administration of higher doses of 17-AAG and more favorable clinical outcomes. In this study, we describe the in vitro and in vivo clinical profile of KOS-953, a cremophor-based 17-AAG formulation. In our in vitro studies, KOS-953 exhibits comparable anti-MM activity to DMSO-based 17-AAG, including activity against a broad spectrum of MM cell lines and primary cells which are both sensitive and resistant to cytotoxic chemotherapeutics, proteasome inhibitor bortezomib, thalidomide or its derivatives. Consistent with prior experience on DMSO-based formulations of 17-AAG, KOS-953 triggered intracellular depletion of several key kinases, including Akt, Raf, IKK-a; decreased the constitutive and cytokine-induced activity of NF-κB; and suppressed expression of diverse intracellular anti-apoptotic proteins (e.g. FLIP, XIAP, survivin); leading to tumor cell sensitization to other pro-apoptotic agents (e.g. cytotoxic chemotherapy, PS-341). Importantly, we evaluated the in vivo anti-tumor activity of KOS-953 in our SCID/NOD mouse model of diffuse MM bone lesions. In this model, mice with bioluminescence imaging-confirmed diffuse skeletal lesions were randomly assigned to receive either KOS-953 (50 mg/kg i.p., twice weekly) or equal volume of vehicle. Mice in both cohorts were followed-up serially by whole-body real-time fluorescence imaging and whole-body bioluminescence imaging, models previously validated in separate studies of our group. The primary endpoint of the study was the overall survival of mice, defined as time between injection of tumor cells and sacrifice for hind limb paralysis, moribund state, or death. KOS-953 treatment was associated with prolongation of overall survival of mice (p<0.05, log-rank test), and was well tolerated, without vital organ tissue damage in histopathologic analyses. These findings indicate that alternative 17-AAG formulations, such as cremophor-based ones, can deliver biologically-active doses of 17-AAG and achieve anti-tumor responses. Coupled with our accumulating experience on the role of hsp90 for MM cell proliferation, survival and drug-resistance, the current study therefore provides the preclinical framework for further clinical evaluation of hsp90 inhibitors, such as KOS-953, to improve treatment outcome in MM.

Real-time whole-body imaging of an orthotopic metastatic prostate cancer model expressing red fluorescent protein.

We describe here, a whole-body imageable spontaneous metastatic model of human prostate cancer developed by surgical orthotopic implantation (SOI) and visualized by red fluorescent protein (RFP) expression. Human prostate cancer PC-3 cells were transduced with the pLNCX2-DsRed-2-RFP retroviral vector containing the RFP and neomycin-resistance genes. A stable RFP-expressing PC-3 clone was selected in 800 microg/ml G418 in vitro and injected subcutaneously in nude mice. Stable high-level expression of RFP was maintained in the subcutaneously-growing tumors. To utilize RFP expression for metastasis studies, fragments of the subcutaneously-growing tumor, which were comprised of RFP-expressing cells, were implanted by SOI in the prostate of nude mice. Primary tumor growth, progression, and subsequent lymphatic metastases were visualized in live, intact animals in real time by whole-body RFP fluorescence imaging. In total, 100% of the experimental animals developed lymphatic metastasis, the growth of which was monitored in real time by whole-body imaging. The aggressive lymphatic metastasis in this model reflects one of the major metastatic routes of prostate cancer in human patients. Intravital RFP imaging visualized single cancer cells in the lung and bladder. Open RFP imaging at autopsy visualized extensive primary growth and highly disseminated lymph-node metastases. The long-wavelength emission of RFP enabled high sensitivity and resolution of microscopic tumor growth using appropriate imaging techniques. The model should be useful for the real-time evaluation of novel therapeutics for metastatic prostate cancer.

A novel triple-modality reporter gene for whole-body fluorescent, bioluminescent, and nuclear noninvasive imaging

Two genetic reporter systems were developed for multimodality reporter gene imaging of different molecular-genetic processes using fluorescence, bioluminescence (BLI), and nuclear imaging techniques. The eGFP cDNA was fused at the N-terminus with HSV1-tk cDNA bearing a nuclear export signal from MAPKK (NES-HSV1-tk) or with truncation at the N-terminus of the first 45 amino acids (Delta45HSV1-tk) and with firefly luciferase at the C-terminus. A single fusion protein with three functional subunits is formed following transcription and translation from a single open reading frame. The NES-TGL (NES-TGL) or Delta45HSV1-tk/GFP/luciferase (Delta45-TGL) triple-fusion gene cDNAs were cloned into a MoMLV-based retrovirus, which was used for transduction of U87 human glioma cells. The integrity, fluorescence, bioluminescence, and enzymatic activity of the TGL reporter proteins were assessed in vitro. The predicted molecular weight of the fusion proteins (~130 kDa) was confirmed by western blot. The U87-NES-TGL and U87-Delta45-TGL cells had cytoplasmic green fluorescence. The in vitro BLI was 7- and 13-fold higher in U87-NES-TGL and U87-Delta45-TGL cells compared to nontransduced control cells. The Ki of (14)C-FIAU was 0.49+/-0.02, 0.51+/-0.03, and 0.003+/-0.001 ml/min/g in U87-NES-TGL, U87-Delta45-TGL, and wild-type U87 cells, respectively. Multimodality in vivo imaging studies were performed in nu/ nu mice bearing multiple s.c. xenografts established from U87-NES-TGL, U87-Delta45-TGL, and wild-type U87 cells. BLI was performed after administration of d-luciferin (150 mg/kg i.v.). Gamma camera or PET imaging was conducted at 2 h after i.v. administration of [(131)I]FIAU (7.4 MBq/animal) or [(124)I]FIAU (7.4 MBq/animal), respectively. Whole-body fluorescence imaging was performed in parallel with the BLI and radiotracer imaging studies. In vivo BLI and gamma camera imaging showed specific localization of luminescence and radioactivity to the TGL transduced xenografts with background levels of activity in the wild-type xenografts. Tissue sampling yielded values of 0.47%+/-0.08%, 0.86%+/-0.06%, and 0.03%+/-0.01%dose/g [(131)I]FIAU in U87-NES-TGL, U87-Delta45-TGL, and U87 xenografts, respectively. The TGL triple-fusion reporter gene preserves the functional activity of its subunits and is very effective for multimodality imaging. It provides for the seamless transition from fluorescence microscopy and FACS to whole-body bioluminescence imaging, to nuclear (PET, SPET, gamma camera) imaging, and back to in situ fluorescence image analysis.

Survival efficacy of adjuvant cytosine analog CS-682 treatment of human pancreatic cancer in an orthotopic metastatic model monitored by fluorescence whole-body imaging

Survival efficacy of adjuvant cytosine analog CS-682 treatment of human pancreatic cancer in an orthotopic metastatic model monitored by fluorescence whole-body imaging