WHO Guidelines Research Articles

SCREEN TIME IN PRESCHOOL-AGED CHILDREN

The World Health Organization defines sedentary screen time as the time spent in passive screen-based entertainment (TV, computer, mobile phone), excluding active screen time, specifically time spent playing games requiring physical activity or movement. Researchers agree that preschool-aged children spend longer periods of time in front of screens than recommended for their age, contradicting WHO guidelines on sedentary screen time for children up to 5 years old. The aim of our research was to obtain data on the age at which children are first exposed to screens, determine the duration of screen exposure on a daily basis, the most common type of screen, and the situations in which preschool-aged children use them. The sample consisted of 200 children, aged 48 to 60 months, of both genders. A specially constructed sociodemographic questionnaire was used for the research, which included questions regarding the age at which the child was first exposed to screens, the duration of daily exposure, as well as the most common type of screen and situations in which the child uses them. Informants were the parents of the children included in the study. The research was conducted in preschool institutions in Bosnia and Herzegovina, during February and March 2024. The results of the research show that children are first exposed to screens as early as at the age of 7 to 12 months, and that screen exposure on a daily basis exceeds the recommended time by WHO guidelines for most participants. The most common type of screen to which children are exposed is TV, and the most common situations in which they use them are during meals or while parents perform various household chores. Attention should be directed towards further identifying factors leading to excessive screen usage and providing clear guidelines to parents regarding the timing, content, technology, and joint activities related to screen time for young children in various cultural settings.

Factors Associated with the Practice of Low-Carb and Low-Fat Diets among Participants of the Longitudinal Study of Adult Health (ELSA-Brasil).

In the field of nutrition, both low-carbohydrate (LCD) and low-fat (LFD) diets were initially intended for specific subgroups but are now being embraced by the broader population for various purposes, including aesthetics and overall health. This study aims to assess sociodemographic, health, and lifestyle factors influencing diet choices among public servants in the ELSA-Brasil cohort. Diets were classified as LCD or LFD based on the Brazilian Diabetes Society (<45%) and WHO guidelines (<30%) respectively. A total of 11,294 participants were evaluated (45.3% men; 54.7% women) with a mean age of 52 ± 0.08 years. Having overweight, altered waist circumference, and a history of smoking confers higher chances of adopting an LCD compared to the usual diet, while being over 52 years, non-White race/skin color, in a lower income stratum, and having diagnosis of hypertension and/or diagnosis of diabetes mellitus decrease these chances. Regarding LFDs, belonging to the non-White race/skin color, being over 52 years old, being divorced, and practicing low physical activity decrease the chances of following such a diet compared to the usual diet. In conclusion, factors like age, socioeconomic status, health, and physical activity levels can be the key to understanding why individuals choose restrictive diets beyond clinical advice.

Immune signature in vaccinated versus non-vaccinated aged people with COVID-19 pneumonia

BackgroundA definition of the immunological features of COVID-19 pneumonia is needed to support clinical management of aged patients. In this study, we characterized the humoral and cellular immune responses in presence or absence of SARS-CoV-2 vaccination, in aged patients admitted to the IRCCS San Raffaele Hospital (Italy) for COVID-19 pneumonia between November 2021 and March 2022.MethodsThe study was approved by local authorities. Disease severity was evaluated according to WHO guidelines. We tested: (A) anti-SARS-CoV-2 humoral response (anti-RBD-S IgG, anti-S IgM, anti-N IgG, neutralizing activity against Delta, BA1, BA4/5 variants); (B) Lymphocyte B, CD4 and CD8 T-cell phenotype; (C) plasma cytokines. The impact of vaccine administration and different variants on the immunological responses was evaluated using standard linear regression models and Tobit models for censored outcomes adjusted for age, vaccine doses and gender.ResultWe studied 47 aged patients (median age 78.41), 22 (47%) female, 33 (70%) older than 70 years (elderly). At hospital admission, 36% were unvaccinated (VACno), whilst 63% had received 2 (VAC2) or 3 doses (VAC3) of vaccine. During hospitalization, WHO score > 5 was higher in unvaccinated (14% in VAC3 vs. 43% in VAC2 and 44% VACno). Independently from vaccination doses and gender, elderly had overall reduced anti-SARS-CoV-2 humoral response (IgG-RBD-S, p = 0.0075). By linear regression, the anti-RBD-S (p = 0.0060), B (p = 0.0079), CD8 (p = 0.0043) and Th2 cell counts (p = 0.0131) were higher in VAC2 + 3 compared to VACno. Delta variant was the most representative in VAC2 (n = 13/18, 72%), detected in 41% of VACno, whereas undetected in VAC3, and anti-RBD-S production was higher in VAC2 vs. VACno (p = 0.0001), alongside neutralization against Delta (p = 0141), BA1 (p = 0.0255), BA4/5 (p = 0.0162). Infections with Delta also drove an increase of pro-inflammatory cytokines (IFN-α, p = 0.0463; IL-6, p = 0.0010).ConclusionsAdministration of 3 vaccination doses reduces the severe symptomatology in aged and elderly. Vaccination showed a strong association with anti-SARS-CoV-2 humoral response and an expansion of Th2 T-cells populations, independently of age. Delta variants and number of vaccine doses affected the magnitude of the humoral response against the original SARS-CoV-2 and emerging variants. A systematic surveillance of the emerging variants is paramount to define future vaccination strategies.

Revisiting the fluid requirement during the critical phase of dengue: Does it actually follow a bell-shaped curve?&amp;nbsp;

Plasma leakage due to a transient increase in capillary permeability is the hallmark of dengue haemorrhagic fever. There is no specific antiviral agent for dengue. Therefore, the mainstay of management during the plasma leakage phase is the judicious use of intravenous fluid to ensure adequate organ perfusion and to prevent fluid overload. The current practice guidelines for dengue are empirical. They are mostly based on expert opinions. The rates and amounts of fluid to be administered during the critical phase of the disease have not been studied in randomised controlled trials. It is hypothesised that the rate of fluid leakage during the critical phase follows a bell-shaped curve. Based on this concept, both WHO and Sri Lankan guidelines recommend starting fluid at a lower rate, increasing the rate until the midpoint of the CP, and gradually reducing the infusion rate thereafter. However, the authors believe that the more fluid you give during the critical phase, the more will leak out into the third space. Thus increasing the complications of fluid overload without improving the effective plasma volume. Therefore, administering fluids at an escalating rate may be superfluous and could result in fluid overload.

Translation and examination of construct validity of the Danish version of the Tampa Scale for Kinesiophobia.

This study investigates the construct validity of the Danish Tampa Scale for Kinesiophobia (TSK). The English 17-item scale was translated into Danish adhering to WHO's guidelines. The construct validity of the TSK was examined in a random general population sample of 4,884 18- to 72-year olds with pain within the past 4 weeks. Examination of construct validity adhered to the COSMIN checklist. Structural validity was examined by splitting the sample and conducting exploratory factor analysis on one half and confirmatory factor analysis on the other half. Convergent validity was examined through associations with self-report measures and objective physical performance tests. Reference scores for the TSK were calculated. After translation, all respondents felt confident that they understood the meaning of the items. All but one found the questionnaire acceptable. The exploratory factor analysis suggested that a 1-factor 13-item version without 4 reversed items resulted in the most consistent fit across subgroups of gender, age, and severe pain report. Five different models of the TSK were tested in the confirmatory factor analysis. While none were excellent fits, both one- and two-factor models of the TSK-13 and TSK-11 were acceptable. Two-factor models marginally outperformed one-factor models on goodness of fit. There was no association between TSK scores and muscular fitness or self-reported physical activity. Cardiorespiratory fitness, self-perceived physical fitness, and self-efficacy had weak correlations with TSK scores. Scores showed modest associations with self-report measures of anxiety, illness worry, pain interference, and daily limitations. Based on an overall consideration of results, we recommend using the TSK-13 as a one-dimensional construct for both research and clinical purposes pending further examinations of the TSK in clinical samples. TSK scores from the present study can serve as a standard of reference for levels of Kinesiophobia in the general population.

Serodiagnosis of Secondary Dengue Infection in a Tertiary Care Hospital, Mysuru

Dengue is one among the acute viral infections with the probability of fatal complications. In 2017; NVBDCP reported 157220 positive dengue cases with 250 deaths in India; 17018 cases and 5 deaths in Karnataka. Most primary infections are uneventful. The critical illness like Dengue Haemorrhagic Fever and Dengue Shock Syndrome are generally attributed to serotype cross-reactivity. Identification of secondary dengue infection in the early onset of illness is beneficial. Therefore, methods to discrepate primary and secondary dengue infection are of significant prognostic value. The current study is a hospital based prospective analytical evaluation and was aimed to discriminate secondary from primary dengue virus infection in clinically suspected dengue cases presenting with fever and thrombocytopenia. Patients of all age groups attending Krishna Rajendra Hospital on outpatient and inpatient basis with clinically suspected dengue fever of less than 5 days associated with thrombocytopenia were included in the study. The samples were tested in the VRDL of the Microbiology Department for dengue NS1 antigen and IgM antibodies, positive for both were further subjected to IgG antibodies. IgM /IgG ratio was used to differentiate primary and secondary dengue infections. Dengue infection was categorized based on WHO guidelines. A total of 17,841 samples were tested from May 2017 to December 2023; out of 17841 samples tested 2111 (60.74%) were positive for dengue NS1 and IgM. Of the 2111 dengue NS1 and IgM positive cases, 1700 (80.5%) were having secondary dengue infection, whereas 411 (19.46%) were having primary infection. Early detection of secondary infection helps the clinician in anticipating dengue related complications with appropriate therapeutic intervention, thereby reducing further complications and mortality.

Radiological assessment of radon in groundwater of the northernmost Kashmir Basin, northwestern Himalaya.

This study investigates the radon concentration in groundwater in Kupwara, the northernmost district of the Kashmir valley. It further assesses the annual effective dose experienced by the district's diverse population-infants, children, and adults-attributable to both inhalation of airborne radon released from drinking water and direct ingestion. In addition to this, the calculation of gamma dose rate is also carried out at each of the sampling site of radon. A portable radon-thoron monitor and a portable gamma radiation detector were respectively employed to estimate the activity concentration of radon in water samples and to measure the gamma dose rate. The radon concentration was found to exhibit variability from a minimum of 2.9BqL-1 to a maximum of 197.2BqL-1, with a mean of 26.3 BqL-1 and a standard deviation of 23.3BqL-1. From a total of 85 samples, 10.6% of the samples had radon activity concentrations exceeding the permissible limits of 40BqL-1 set by the United Nations Scientific Committee on Effects of Atomic Radiations as reported by UNSCEAR (Sources and effects of ionizing radiation, 2008) and only 1.2% of the samples have radon activity concentration exceeding the permissible limits of 100BqL-1 set by the World Health Organization as reported by WHO (WHO guidelines for drinking-water quality, World Health Organization, Geneva, 2008). The mean of the annual effective dose due to inhalation for all age groups as well as the annual ingestion dose for infants and children, surpasses the World Health Organization's limit of 100μSvy-1 as reported by WHO (WHO guidelines for drinking-water quality, World Health Organization, Geneva, 2008). The observed gamma radiation dose rate in the vicinity of groundwater radon sites ranged from a minimum of 138nSvh-1 to a maximum of 250nSvh-1. The data indicated no significant correlation between the dose rate of gamma radiation and the radon levels in the groundwater. Radon concentration of potable water in the study area presents a non-negligible exposure pathway for residents. Therefore, the judicious application of established radon mitigation techniques is pivotal to minimize public health vulnerabilities.

Air Quality Dynamics in Sichuan Province: Sentinel-5P Data Insights (2019-2023)

This study assesses air pollution in Sichuan Province, China, from January 2019 to December 2023 using Copernicus Sentinel-5P satellite data. The analysis reveals distinct seasonal variations in levels of Carbon Monoxide (CO), Nitrogen Dioxide (NO₂), Sulfur Dioxide (SO₂), and Ozone (O₃), with urban areas experiencing higher concentrations due to industrial and vehicular emissions. CO and O₃ frequently exceeded WHO guidelines, particularly in winter and summer, indicating significant health risks. While most pollutant levels remained within safety limits, the findings highlight the importance of continuous monitoring and targeted mitigation strategies to improve air quality and safeguard public health, especially in urban environments.

Relationship between short-term ozone exposure, cause-specific mortality, and high-risk populations: A nationwide, time-stratified, case-crossover study

BackgroundPrevious studies reported that short-term exposure to ground-level ozone is associated with mortality risk. However, due to the limited monitored areas, existing studies were limited in assessing the nationwide risk and suggesting specific vulnerable populations to the ozone-mortality risk. MethodsWe performed a nationwide time-stratified case-crossover study to evaluate the association between short-term ozone and cause-specific mortality in South Korea (2015–2019). A machine learning-ensemble prediction model (a test R2 > 0.96) was used to assess the short-term ozone exposure. Stratification analysis was conducted to examine the high-risk populations, and the excess mortality due to non-compliance with the WHO guideline was also assessed. ResultsFor all-cause mortality (1,343,077 cases), the risk associated with ozone (lag0– 1) was weakly identified (odd ratio: 1.005 with 95% CI: 0.997–1.014), and the risk was prominent in mortality with circulatory system diseases. In addition, based on the point estimates, the ozone-mortality risk was higher in people aged less than 65y, and this pattern was also observed in circulatory system disease deaths and urban areas. ConclusionsThis study provides national estimates of mortality risks associated with short-term ozone. Results showed that the benefits of stricter air quality standards could be greater in vulnerable populations.

Pain therapy in palliative care

Complex pain is common in palliative care. The bio-psycho-social and spiritual model is important for understanding and treatment. Differentiation according to nociceptive, neuropathic and mixed pain should be considered. Analgesic therapy is based on the WHO guidelines and the extended WHO analgesic ladder. The pain management plan includes pharmacological and non-pharmacological interventions with involvement of the private and professional network.

Greek School Nurses' Confidence With Diabetes Devices.

Aim School nurses often use diabetes mellitus devices as part of the care provided to students with Type 1 Diabetes Mellitus. The aim of this study was to explore the psychometric properties of the Greek version of the Diabetes Devices Confidence Scale (DDCS). Methods In this cross-sectional, descriptive study, 143 school nurses completed the DDCS. This is a self-administered questionnaire exploring the nurses' confidence in the use of diabetes devices. The scale was translated and culturally adapted according to the WHO guidelines. The Intraclass Correlation Coefficient and Cronbach's Alpha Index were used to explore the reliability and internal consistency, respectively. The construct validity was tested via exploratory and confirmatory factor analysis (EFA, CFA). Data were analyzed via Statistical Package for the Social Sciences (SPSS), version 22.0 (IBM Corp., Armonk, NY, USA). Results Significant correlations were observed between the two administrations (p<0.001) indicating the good reliability of the scale (ICC = 0525, p<0.001) while Cronbach's Alpha was 0.966 suggesting excellent internal consistency. The EFA resulted in a unidimensional solution explaining 53.7% of the total variance. The CFA showed that the model presents good fit to the data. Conclusions The DDCS is a reliable and valid tool to test the nurses' confidence in diabetes devices.

Understanding the multifaceted influence of urbanization, spectral indices, and air pollutants on land surface temperature variability in Hyderabad, India

Hyderabad, similar to many cities worldwide, has experienced accelerated urbanization, leading to increased surface temperature and air pollution. The present study investigated the relationship between land surface temperature (LST) and various air pollutants, urbanization, surface indices, and meteorological parameters, which are associated with Sustainable Development Goals (SDGs), especially Goal 13 (Climate Action) and Goal 11 (Sustainable Cities and Communities). The effect of air pollution on LST across seasons was also examined for five years (2018–2022). LST images collected from MODIS satellite. Data on air pollutants and meteorological parameters were collected from air quality monitoring stations. The results showed that PM2.5 exceeded the WHO guidelines. A weak or moderate relationship was observed between LST and individual air pollutants. However, the association significantly improved when all air pollutants were considered simultaneously. The relationship improved even further when additional parameters such as Normalized Difference Built-up Index (NDBI), Normalized Difference Vegetation Index (NDVI), Digital Elevation Model (DEM), road line density (RLD), and global population density (GPD), were also included. The resulting relationship was very strong (R2 > 0.80) during the summer and winter seasons. The study identified that NH3 had a prominent influence on LST during winter, while PM2.5 and NH3 exhibited a higher influence during summer. The research findings emphasized that LST variations were influenced by both air pollutants and meteorological conditions, along with urbanization factors represented by various parameters and indices. The research underscores the importance of considering these findings in future studies. It suggests the need to explore efficient approaches to address the combined problem of rising LST and concentration of air pollutants in urban areas.

Development and Validation of a UV- Visible Method for Determining Piperine in Bulk and Formulation

Standardization of herbal preparations is crucial because the growing use of herbal medicines and the globalization of the herbal medicinal industries have raised serious concerns about safety among the public and health authorities. However, the majority of the time, it was discovered that the standardization procedure was challenging and time-consuming. Thus, piperine from Piper nigrum in the commercial formulation could be quantitatively determined and standardized using an easy-to-use and trustworthy UV-Visible Spectrophotometric technique. In accordance with WHO guidelines, UV-visible spectrophotometric investigations of several parameters are part of the study. This work presents a spectrophotometric technique in the UV area at 342 nm that is easy to use, quick, sensitive and accurate. It was established how much piperine was present in the sample and validated. Therefore, piperine in the commercial formulations may be reliably quantified using the suggested method.

TB prevention activities in the WHO European Region.

TB preventive treatment (TPT) is the primary available healthcare intervention to reduce the risk of progression from TB infection to TB disease. The WHO Regional Office for Europe established the European Prevention and Systematic Screening Initiative to End TB (PASS) to scale up activities related to the programmatic management of TPT. In the absence of a system to measure and monitor preventive activities, a baseline assessment survey was carried out to provide a reference to monitor the scale-up of the intervention. This was a semi-structured survey including 52 questions that was developed, implemented in the WHO-hosted LimeSurvey data form and sent to focal points in the 55 countries and territories in the European Region between September and October 2023. The questions covered TPT, systematic screening and infection prevention and control. A total of 28 questionnaires were returned, corresponding to an overall 51% response rate. Most national policies for TPT and TB screening are in line with the latest WHO guidelines. However, implementation of TB screening, prevention, and infection control activities is lagging. Results are presented separately for high-priority and low-priority countries. The survey identified several important areas that the PASS initiative will focus on to accelerate efforts towards reaching the targets set at the 2027 UN High-Level Meeting on TB for preventive therapy in the European Region. This will require a massive scale-up of efforts and larger investments, as well as coordinated approaches and interventions across the 'cascade' of prevention, from the identification of target populations to the completion of treatment.

Translation and validation of the hindi version of the HEXACO personality inventory-revised

Background: Recent lexical research in different languages has revealed that there are six personality dimensions instead of the previously proposed five dimensions. To address this issue, the HEXACO Personality Inventory-Revised (HEXACO PI-R), a self-rating scale to assess personality characteristics, was constructed. However, researchers in India faced a language barrier because it was only available in English. Aim: To evaluate the validity and reliability of the Hindi translation of the HEXACO PI-R. Materials and Methods: We followed WHO guidelines for the translation and adaptation of instruments. In forward translation, the scale was translated to Hindi independently by two independent bi-lingual authors. Both versions were reviewed, and a common Hindi version was made. Then, in the second step, an expert panel was formed comprising psychologists, authors, and senior psychiatrists. All the shortcomings were addressed, which resulted in a final Hindi version of the scale. Subsequently, a Hindi Professor, who had no background knowledge of the scale, was consulted to check the Grammar and meaning of the scale. Finally, an independent English Professor with no background knowledge of this scale was consulted to translate the Hindi version to English back. A small pilot study was conducted and a resultant Hindi version of the self-report HEXACO was applied to 10 patients to see the shortcomings, which resulted in the final Hindi version. By convenience sampling 300 volunteers, conversant in both the English and Hindi languages were included. The subjects were initially administered alternately the original English version or the Hindi version of the scale. Then after a gap of 14 days, those who initially received the English version filled up the Hindi translation, while those who received the Hindi version initially filled up the English version of the scale. Results: The scores on the original English scale and the Hindi versions were significantly positively correlated (Spearman’s rho 0.900; P &lt; 0.001). The translated scale showed a high degree of internal consistency and acceptable reliability. An exploratory factor analysis with varimax rotation yielded 6 factors, which were found to have a further 24 facets. The fitness of the model for the overall scale and its sub-factors was found to be acceptable. Results of the Rasch analysis showed the scale had good infit and outfit values. The person’s reliability was good. The Wright map showed a good distribution of the items. Conclusion: The Hindi translation of the HEXACO PI-R is a valid and reliable tool to gauge the personality dimensions of the Hindi-speaking population of India.

How strong is the evidence supporting the WHO guidelines on physical activity, sedentary behaviour and sleep in early childhood?

The WHO issued recommendations about the ideal amount of physical activity, sedentary behaviour and sleep in infants, toddlers and preschool children. To facilitate their interpretation and translation into public health policies, we analysed the quantity and quality of the evidence that supported the development of each WHO recommendation. All data for each exposure-outcome pair analysed in the studies informing WHO guidelines were extracted, and predefined criteria, based upon GRADE methodology, were used to classify each outcome and study result. Among the 237 studies that could be included, 37 were experimental and 200 were observational, yielding 920 analyses of exposure-outcome associations. Sixty-two analyses used a relevant outcome, with or without significant results. Five of the 10 WHO recommendations were based upon zero analyses with significant results on relevant health outcomes. The remaining recommendations were mostly based upon analyses evaluating obesity-related outcomes. Eight of the 10 GLs thresholds were not supported by any significant analysis on clinically relevant outcomes. While these findings should not be interpreted as an attempt to disprove the benefits of healthy lifestyle habits in early childhood, neither to minimize the work of the experts in this complex research field, very limited evidence currently supports the adoption of recommended thresholds as behavioural surveillance and public health interventions targets. Therefore, until further data are available, public health interventions should be developed balancing whether to focus on the achievement of specific targets that are still not supported by high-quality evidence or on the general promotion of healthy behaviours.

Indoor Environmental Quality and Effectiveness of Portable Air Cleaners in Reducing Levels of Airborne Particles during Schools’ Reopening in the COVID-19 Pandemic

Educational buildings tend to fail in the contagion containment of airborne infectious diseases because of the high number of children, for several hours a day, inside enclosed environments that often have inadequate indoor air quality (IAQ) conditions. This study aimed to assess indoor environmental quality and test the effectiveness of portable air cleaners (PACs) in alleviating airborne particle levels in schools of Central–Southern Spain during the period of reopening after the lockdown due to the COVID-19 outbreak. To accomplish this, three sampling campaigns were organized from September to December 2020 to consistently monitor temperature and relative humidity, carbon dioxide, and particulate matter in nineteen classrooms (seven school buildings). Results showed that although the recommendation of maintaining the windows open throughout the day seemed to be effective in promoting, in general, proper ventilation conditions (based on CO2 levels). For the colder campaigns, this practice caused notorious thermal comfort impairment. In addition, a great number of the surveyed classrooms presented levels of PM2.5 and PM10, attributable to outdoor and indoor sources, which exceeded the current WHO guideline values. Moreover, considering the practice of having the windows opened, the installation of 1 unit of PACs per classroom was insufficient to ensure a reduction in particle concentration to safe levels. Importantly, it was also found that children of different ages at different education levels can be exposed to significantly different environmental conditions in their classrooms; thus, the corrective measures to employ in each individual educational setting should reflect the features and needs of the target space/building.

Exploring Systems Thinking and Systemic Design: Insights from a Summer School Experiment Addressing Urban Health Crises

This paper relates urban healthcare crises to the global challenges of overshoot and collapse and suggests systems thinking as an innovative approach towards addressing these amalgamated crisis situations. We begin by reviewing what systems are and how they are structured and behave, highlighting how systems thinking can identify high-leverage interventions and systemic design to achieve effective change. Subsequently, we illustrate how these system concepts were applied in an international, multidisciplinary summer school between European and Southeast Asian partners in collaboration with the World Health Organization’s (WHO) Technical Science for Health Network (Téchne). Examining how ventilation, temperature, humidity, and daylighting control strategies enhance Infection Prevention and Control (IPC), the initiative developed ideas and designs for a multiple disease treatment center that would provide isolation units and create a safe care environment for patients, families, and communities. The design process was informed through consultation with three physically and socio-economically diverse neighborhoods across the Bangkok Metropolitan Region to gain a richer understanding of the varied experiences and approaches in managing the COVID-19 disruption. Leveraging WHO guidelines, students adopted a systemic design approach to develop innovative solutions that could withstand natural hazards and used local materials and natural ventilation to prevent airborne infection and control indoor temperature. In conclusion, we propose a novel working model linking specific stages of systemic thinking and systemic design into a generalized, iterative urban and healthcare design framework that will be further refined as part of specific electives at the KU Leuven Faculty of Architecture and joint summer schools in 2023, 2024 and beyond.

222Rn and 220Rn levels in drinking water, emanation, and exhalation assessment, and the related health implications in the U-bearing area of Poli-Cameroon.

The inherent radioactivity of radon gas presents potential exposure risks to human beings through ingestion and inhalation of its radioisotopes 222Rn (radon) and 220Rn (thoron) from water sources. Recent studies have been conducted to assess radon concentrations in different environmental matrices such as water, air, and soil, due to their detrimental impact on human health. As the main cause of lung cancer in non-smokers and an acknowledged contributor to stomach cancer when ingested, the present study aimed to preliminarily assess radon and thoron levels in the Uranium bearing area of Poli in the Faro division of Cameroon, known for its significant U-deposits. The assessment included measuring 220, 222Rn concentrations in drinking water, emanation, and exhalation, with a specific focus on evaluating the exposure of different age groups within the local population. The radon/thoron levels in water and their related exposure and cancer risk dataindicated no immediate health hazards. However, continuous monitoring and prospective measures are deemed essential due to the area's abundant U-minerals. The emanation measurements showed sparsely distributed data with a singularity at Salaki, where the equipment recorded values of 8.14 × 1012 Bqm-3 and 3.27 × 1012 Bqm-3 for radon and thoron, respectively. Moreover, radon/thoron transfer coefficients from thesoil to theair indicated levels below unity. While the calculated doses suggest minimum potential risk in line with WHO and UNSCEAR guidelines, the obtained results are expected to significantly contribute to the establishment of national standards for radon levels in drinking water, emanation, and exhalation. Furthermore, these findings can play a crucial role in monitoring radon/thoron levels to ensure public health safety.

Evaluation of protamine 2 genes in spermatozoa of teratospermic and oligospermic men in Nigeria

There have been several reports of single nucleotide polymorphisms (SNPs) linked to different kinds of male infertility. The aim of the study was to evaluate single nucleotide polymorphisms in protamine 2 gene (PRM2) in spermatozoa of teratospermic and oligospermic infertile men in Nigeria. At some fertility clinics in Lagos, Nigeria, twenty-two (22) teratospermic and thirty-five (35) oligospermic infertile men as well as thirty (35) normospermic fertile men (control) who volunteered and gave consent were recruited for the cross-section study after meeting the inclusion criteria and confirmation of their fertility statuses by the use of computer-Assisted Sperm Analyzer (CASA). Semen was collected from the participants under the WHO guideline for semen collection and processing. Spermatozoa’s DNA was extracted with the use of Proteinase K Storage Buffer. Nanodrop 1000 spectrophotometer was used to quantify the isolated genomic DNA. PRM II F: 5-AGGGCCCTGCTAGTTGTGA-3' and PRM II R: 3'- CAGATCTTGTGGGCTTCTCG -5, were used as primers. Sequencing of sperm DNA was done using the BigDye Terminator kit on a 3510 ABI sequencer by Inqaba Biotechnological, Pretoria South Africa. Agarose gel electrophoresis was used to show the amplified PRM2. In the study, 7 SNPs in the teratospermic infertile men, 8 SNPs in the oligospermic infertile men and 7 SNPs in the normospermic fertile men were discovered. The SNPs between the teratospermic infertile men and the oligospermic infertile men are significantly different. We propose that considerably larger genome-wide investigations are required to confidently validate these SNPs and find new SNPs linked with male infertility.