Whitefly-transmitted Geminiviruses Research Articles

How To Be a Successful Monopartite Begomovirus in a Bipartite-Dominated World: Emergence and Spread of Tomato Mottle Leaf Curl Virus in Brazil.

Begomoviruses are members of the family Geminiviridae, a large and diverse group of plant viruses characterized by a small circular single-stranded DNA genome encapsidated in twinned quasi-icosahedral virions. Cultivated tomato (Solanum lycopersicum L.) is particularly susceptible and is infected by >100 bipartite and monopartite begomoviruses worldwide. In Brazil, 25 tomato-infecting begomoviruses have been described, most of which are bipartite. Tomato mottle leaf curl virus (ToMoLCV) is one of the most important of these and was first described in the late 1990s but has not been fully characterized. Here, we show that ToMoLCV is a monopartite begomovirus with a genomic DNA similar in size and genome organization to those of DNA-A components of New World (NW) begomoviruses. Tomato plants agroinoculated with the cloned ToMoLCV genomic DNA developed typical tomato mottle leaf curl disease symptoms, thereby fulfilling Koch's postulates and confirming the monopartite nature of the ToMoLCV genome. We further show that ToMoLCV is transmitted by whiteflies, but not mechanically. Phylogenetic analyses placed ToMoLCV in a distinct and strongly supported clade with other begomoviruses from northeastern Brazil, designated the ToMoLCV lineage. Genetic analyses of the complete sequences of 87 ToMoLCV isolates revealed substantial genetic diversity, including five strain groups and seven subpopulations, consistent with a long evolutionary history. Phylogeographic models generated with partial or complete sequences predicted that the ToMoLCV emerged in northeastern Brazil >700 years ago, diversifying locally and then spreading widely in the country. Thus, ToMoLCV emerged well before the introduction of MEAM1 whiteflies, suggesting that the evolution of NW monopartite begomoviruses was facilitated by local whitefly populations and the highly susceptible tomato host. IMPORTANCE Worldwide, diseases of tomato caused by whitefly-transmitted geminiviruses (begomoviruses) cause substantial economic losses and a reliance on insecticides for management. Here, we describe the molecular and biological properties of tomato mottle leaf curl virus (ToMoLCV) from Brazil and establish that it is a NW monopartite begomovirus indigenous to northeastern Brazil. This answered a long-standing question regarding the genome of this virus, and it is part of an emerging group of these viruses in Latin America. This appears to be driven by widespread planting of the highly susceptible tomato and by local and exotic whiteflies. Our extensive phylogenetic studies placed ToMoLCV in a distinct strongly supported clade with other begomoviruses from northeastern Brazil and revealed new insights into the origin of Brazilian begomoviruses. The novel phylogeographic analysis indicated that ToMoLCV has had a long evolutionary history, emerging in northeastern Brazil >700 years ago. Finally, the tools used here (agroinoculation system and ToMoLCV-specific PCR test) and information on the biology of the virus (host range and whitefly transmission) will be useful in developing and implementing integrated pest management (IPM) programs targeting ToMoLCV.

Characterization of Pathogenicity-Associated V2 Protein of Tobacco Curly Shoot Virus.

V2 proteins encoded by some whitefly-transmitted geminiviruses were reported to be functionally important proteins. However, the functions of the V2 protein of tobacco curly shoot virus (TbCSV), a monopartite begomovirus that causes leaf curl disease on tomato and tobacco in China, remains to be characterized. In our report, an Agrobacterium infiltration-mediated transient expression assay indicated that TbCSV V2 can suppress local and systemic RNA silencing and the deletion analyses demonstrated that the amino acid region 1–92 of V2, including the five predicted α-helices, are required for local RNA silencing suppression. Site-directed substitutions showed that the conserved basic and ring-structured amino acids in TbCSV V2 are critical for its suppressor activity. Potato virus X-mediated heteroexpression of TbCSV V2 in Nicotiana benthamiana induced hypersensitive response-like (HR-like) cell death and systemic necrosis in a manner independent of V2′s suppressor activity. Furthermore, TbCSV infectious clone mutant with untranslated V2 protein (TbCSV∆V2) could not induce visual symptoms, and coinfection with betasatellite (TbCSB) could obviously elevate the viral accumulation and symptom development. Interestingly, symptom recovery occurred at 15 days postinoculation (dpi) and onward in TbCSV∆V2/TbCSB-inoculated plants. The presented work contributes to understanding the RNA silencing suppression activity of TbCSV V2 and extends our knowledge of the multifunctional role of begomovirus-encoded V2 proteins during viral infections.

Hydrogen peroxide protects pepper (Capsicum annuum L.) against pepper golden mosaic geminivirus (PepGMV) infections

Hydrogen peroxide is an important signal molecule in plant defense against biotic and abiotic stress. Pepper golden mosaic virus (PepGMV) is a whitefly-transmitted geminivirus causing significant yield and quality losses in pepper and other horticultural crops in Mexico. Several pesticides have been used trying to control whiteflies and thus, PepGMV disease in host crops. The present work examined the effect of exogenous application of hydrogen peroxide (H2O2) on inducing resistance to PepGMV infection in pepper plants. Experiments were carried out under greenhouse conditions aiming to evaluate phenotypical, biochemical and molecular features in these pepper plants. Hydrogen peroxide at 6, 14 and 18 mM induced tolerance to PepGMV either by absence of symptoms as well as by attenuating and/or delaying them. The protection observed was directly dependent on the concentration of H2O2 sprayed on plants. Moreover, PepGMV DNA levels were inversely proportional to the protection level. Enzymatic and gene expression profiles related with plant defense were induced in protected, in comparison to susceptible control plants. Interestingly, the levels of some phenolic compounds were also associated with plant protection. Taking together, these results suggested that exogenous foliar applications of H2O2 protect pepper plants against PepGMV infection inducing the plant host defense arsenal.

Differential Shape of Geminivirus Mutant Spectra Across Cultivated and Wild Hosts With Invariant Viral Consensus Sequences.

Geminiviruses (family Geminiviridae) possess single-stranded circular DNA genomes that are replicated by cellular polymerases in plant host cell nuclei. In their hosts, geminivirus populations behave as ensembles of mutant and recombinant genomes, known as viral quasispecies. This favors the emergence of new geminiviruses with altered host range, facilitating new or more severe diseases or overcoming resistance traits. In warm and temperate areas several whitefly-transmitted geminiviruses of the genus Begomovirus cause the tomato yellow leaf curl disease (TYLCD) with significant economic consequences. TYLCD is frequently controlled in commercial tomatoes by using the dominant Ty-1 resistance gene. Over a 45 day period we have studied the diversification of three begomoviruses causing TYLCD: tomato yellow leaf curl virus (TYLCV), tomato yellow leaf curl Sardinia virus (TYLCSV) and tomato yellow leaf curl Malaga virus (TYLCMaV, a natural recombinant between TYLCV and TYLCSV). Viral quasispecies resulting from inoculation of geminivirus infectious clones were examined in plants of susceptible tomato (ty-1/ty-1), heterozygous resistant tomato (Ty-1/ty-1), common bean, and the wild reservoir Solanum nigrum. Differences in virus fitness across hosts were observed while viral consensus sequences remained invariant. However, the complexity and heterogeneity of the quasispecies were high, especially in common bean and the wild host. Interestingly, the presence or absence of the Ty-1 allele in tomato did not lead to differences in begomovirus mutant spectra. However, the fitness decrease of TYLCSV and TYLCV in tomato at 45 dpi might be related to an increase in CP (Coat protein) mutation frequency. In Solanum nigrum the recombinant TYLCMaV, which showed lower fitness than TYLCSV, at 45 dpi actively explored Rep (Replication associated protein) ORF but not the overlapping C4. Our results underline the importance of begomovirus mutant spectra during infections. This is especially relevant in the wild reservoir of the viruses, which has the potential to maintain highly diverse mutant spectra without modifying their consensus sequences.

Tomato leaf curl Yunnan virus-encoded C4 induces cell division through enhancing stability of Cyclin D 1.1 via impairing NbSKη -mediated phosphorylation in Nicotiana benthamiana.

The whitefly-transmitted geminiviruses induce severe developmental abnormalities in plants. Geminivirus-encoded C4 protein functions as one of viral symptom determinants that could induce abnormal cell division. However, the molecular mechanism by which C4 contributes to cell division induction remains unclear. Here we report that tomato leaf curl Yunnan virus (TLCYnV) C4 interacts with a glycogen synthase kinase 3 (GSK3)/SHAGGY-like kinase, designed NbSKη, in Nicotiana benthamiana. Pro32, Asn34 and Thr35 of TLCYnV C4 are critical for its interaction with NbSKη and required for C4-induced typical symptoms. Interestingly, TLCYnV C4 directs NbSKη to the membrane and reduces the nuclear-accumulation of NbSKη. The relocalization of NbSKη impairs phosphorylation dependent degradation on its substrate-Cyclin D1.1 (NbCycD1;1), thereby increasing the accumulation level of NbCycD1;1 and inducing the cell division. Moreover, NbSKη-RNAi, 35S::NbCycD1;1 transgenic N. benthamiana plants have the similar phenotype as 35S::C4 transgenic N. benthamiana plants on callus-like tissue formation resulted from abnormal cell division induction. Thus, this study provides new insights into mechanism of how a viral protein hijacks NbSKη to induce abnormal cell division in plants.

Molecular detection and characterisation of Horsegram Yellow Mosaic Virus (HgYMV) infecting Lima bean (Phaseolus lunatus) in India

The present study developed a PCR protocol using designed sequence virus-specific sets of primers (HYMV-A1500F & HYMV-A1500R and D-HYMV-B2200F & D-HYMV-B2200R) for the amplification of the complete DNA-A and DNA-B components of lima bean isolate of Horsegram yellow mosaic virus (HgYMV-Lb). The PCR products were cloned and sequenced. The nucleotide sequences of HgYMV-Lb was determined and compared with those of other whitefly-transmitted geminiviruses. The length of the single-stranded DNA-A and DNA-B components of HgYMV-Lb were 2735 and 2670 nucleotide, respectively. The DNA-A sequences were found most similar to the corresponding sequences of begomovirus species infecting legumes by up to 97% nucleotide identity. The DNA-B sequences were most similar to isolates of both Mungbean yellow mosaic virus and Mungbean yellow mosaic India virus at approximately 70% nucleotide identity. The genome organisation of HgYMV-Lb was also similar to that of a typical begomovirus bipartite genome. The DNA-A component has six Open Reading Frames (AV1/CP, AV2, AC1/REP, AC2/TrAP, AC3/REn, and AC4) and DNA-B has two (BC1 and BV2). The number, size and arrangement of the Open Reading Frames in the genome were similar to the Old world begomoviruses. In addition, phylogenetic analysis of DNA-A sequence clustered HgYMV-Lb into a group of legume-infecting begomoviruses from the Indian sub-continent, particularly with Mungbean yellow mosaic virus. Based on DNA-B sequences, HgYMV-Lb was clustered into the group with Mungbean yellow mosaic virus infecting soybean in Madurai (MYMV-Sb:Mad) and Mungbean yellow mosaic India virus in Bangladesh (MYMIV-BD:Yb). Thus, based on the PCR and sequence analysis, the association of a bipartite begomovirus with lima bean showing symptoms yellow mosaic disease in India was confirmed. Also, it was identified that the begomovirus was a novel isolate of previously described Horsegram yellow mosaic virus.Keywords: Horsegram, Lima bean, Yellow mosaic virus, Begomovirus

Molecular detection and characterisation of Horsegram Yellow Mosaic Virus (HgYMV) infecting Lima bean (Phaseolus lunatus) in India

The present study developed a PCR protocol using designed sequence virus-specific sets of primers (HYMV-A1500F & HYMV-A1500R and D-HYMV-B2200F & D-HYMV-B2200R) for the amplification of the complete DNA-A and DNA-B components of lima bean isolate of Horsegram yellow mosaic virus (HgYMV-Lb). The PCR products were cloned and sequenced. The nucleotide sequences of HgYMV-Lb was determined and compared with those of other whitefly-transmitted geminiviruses. The length of the single-stranded DNA-A and DNA-B components of HgYMV-Lb were 2735 and 2670 nucleotide, respectively. The DNA-A sequences were found most similar to the corresponding sequences of begomovirus species infecting legumes by up to 97% nucleotide identity. The DNA-B sequences were most similar to isolates of both Mungbean yellow mosaic virus and Mungbean yellow mosaic India virus at approximately 70% nucleotide identity. The genome organisation of HgYMV-Lb was also similar to that of a typical begomovirus bipartite genome. The DNA-A component has six Open Reading Frames (AV1/CP, AV2, AC1/REP, AC2/TrAP, AC3/REn, and AC4) and DNA-B has two (BC1 and BV2). The number, size and arrangement of the Open Reading Frames in the genome were similar to the Old world begomoviruses. In addition, phylogenetic analysis of DNA-A sequence clustered HgYMV-Lb into a group of legume-infecting begomoviruses from the Indian sub-continent, particularly with Mungbean yellow mosaic virus. Based on DNA-B sequences, HgYMV-Lb was clustered into the group with Mungbean yellow mosaic virus infecting soybean in Madurai (MYMV-Sb:Mad) and Mungbean yellow mosaic India virus in Bangladesh (MYMIV-BD:Yb). Thus, based on the PCR and sequence analysis, the association of a bipartite begomovirus with lima bean showing symptoms yellow mosaic disease in India was confirmed. Also, it was identified that the begomovirus was a novel isolate of previously described Horsegram yellow mosaic virus . Keywords : Horsegram, Lima bean, Yellow mosaic virus , Begomovirus

Near-Atomic Resolution Structure of a Plant Geminivirus Determined by Electron Cryomicroscopy

African cassava mosaic virus is a whitefly-transmitted geminivirus which forms unique twin particles of incomplete icosahedra that are joined at five-fold vertices, building an unusual waist. How its 22 capsomers interact within a half-capsid or across the waist is unknown thus far. Using electron cryo-microscopy and image processing, we determined the virion structure with a resolution of 4.2Å and built an atomic model for its capsid protein. The inter-capsomer contacts mediated by the flexible N termini and loop regions differed within the half-capsids and at the waist, explaining partly the unusual twin structure. The tip of the pentameric capsomer is sealed by a plug formed by a turn region harboring the evolutionary conserved residue Y193. Basic amino acid residues inside the capsid form a positively charged pocket next to the five-fold axis of the capsomer suitable for binding DNA. Within this pocket, density most likely corresponding to DNA was resolved.

High genetic homogeneity points to a single introduction event responsible for invasion of Cotton leaf curl Multan virus and its associated betasatellite into China.

BackgroundCotton leaf curl Multan virus (CLCuMuV) is a Whitefly Transmitted Geminivirus (WTG) endemic to the India subcontinent and is notorious as a causal agent of cotton leaf curl disease (CLCuD), a major constraint to cotton production in south Asia. We found CLCuMuV infecting Hibiscus rosa-sinensis in Guangzhou, China in 2006. The spread and evolution of the invading CLCuMuV were monitored in the following nine years.FindingsCLCuMuV spread rapidly in the last nine years and became established in Southern China. It infects at least five malvaceous plant species, H. rosa-sinensis, H. esculentus, Malvaiscus arboreus, Gossypium hirsutum and H. cannabinus. Complete nucleotide sequences of 34 geographically and/or temporally distinct CLCuMuV isolates were determined and analyzed together with six other publicly available genomes of CLCuMuV occurring in China. The 40 CLCuMuV isolates were found to share > 99 % nucleotide sequence identity with each other. In all cases tested, the CLCuMuVs were associated with a CLCuMuB. The 36 CLCuMuBs (30 sequenced by us) shared > 98 % nucleotide sequence identity.ConclusionThe high genetic homogeneity of CLCuMuV and CLCuMuB in China suggests the establishment of them from a single founder event.Electronic supplementary materialThe online version of this article (doi:10.1186/s12985-015-0397-y) contains supplementary material, which is available to authorized users.

TYLCV-Is movement in planta does not require V2 protein

Tomato yellow leaf curl virus (TYLCV), a major tomato pathogen causing extensive crop losses, is a whitefly-transmitted geminivirus. V2 mutants of TYLCV-Is and related viruses tend to induce symptomless infection with attenuated viral DNA levels, while accumulating close to wild-type DNA levels in protoplasts, suggesting V2 as a movement protein. The discovery of plant-silencing mechanisms and viral silencing suppressors, V2 included, led us to reconsider V2׳s involvement in viral movement. We studied two mutant versions of the virus, one impaired in V2 silencing-suppression activity, and another carrying a non-translatable V2. While both mutant viruses spread in the infected plant to newly emerged leaves at the same rate as the wild-type virus, their DNA-accumulation levels were tenfold lower than in the wild-type virus. Thus, we suggest that the setback in virus proliferation, previously ascribed to a movement impediment, is due to lack of silencing-suppression activity.

Emergence and diversity of begomoviruses infecting solanaceous crops in East and Southeast Asia

Over the past three decades diseases caused by whitefly-transmitted geminiviruses (begomoviruses) have emerged to be important constraints to the production of solanaceous crops, particularly tomato (Solanum lycopersicum) and peppers (Capsicum spp.), in many tropical and subtropical regions of the world. The most studied of these is Tomato yellow leaf curl virus (TYLCV), which has spread to many other areas from its likely origin in the Mediterranean basin region. The virus is usually associated with the polyphagous and virus-vectoring-efficient B-biotype of its vector whitefly (Bemisia tabaci). However, in Southeast and East Asia, a wide variety of distinct local begomovirus species have been identified from tomato and pepper crops over this period, and TYLCV was detected in Japan only in about 1996, China in 2006 and Korea in 2008, despite B-biotype whiteflies being present in several of the countries of the region since at least the early 1990s. Continental Southeast Asia appears to be a major center of diversity for begomoviruses and some species may have spread across the region; Tomato yellow leaf curl Thailand virus (TYLCTHV) appears to have spread from the Thailand–Myanmar region into southern China and is now displacing the local tomato-infecting species in Taiwan, and Tomato yellow leaf curl Kanchanaburi virus (TYLCKaV) appears to have spread from the Thailand–Vietnam region to Java, Indonesia. Since many of the native tomato- or pepper-infecting begomoviruses and associated satellite DNAs have also been detected in local weed species, it seems likely that their ancestors originated in these weed hosts, but with the expansion and intensification of tomato and pepper production in the region, there was selection for recombinant or mutant forms with greater virulence on tomato and/or pepper. Expansion and intensification of these crops may also have resulted in increased populations of local, and if present, B- or Q-biotype whiteflies, aiding the increase and spread of local begomovirus species.

Cotton leaf curl disease – an emerging threat to cotton production worldwide

Cotton leaf curl disease (CLCuD) is a serious disease of cotton which has characteristic symptoms, the most unusual of which is the formation of leaf-like enations on the undersides of leaves. The disease is caused by whitefly-transmitted geminiviruses (family Geminiviridae, genus Begomovirus) in association with specific, symptom-modulating satellites (betasatellites) and an evolutionarily distinct group of satellite-like molecules known as alphasatellites. CLCuD occurs across Africa as well as in Pakistan and north-western India. Over the past 25 years, Pakistan and India have experienced two epidemics of the disease, the most recent of which involved a virus and satellite that are resistance breaking. Loss of this conventional host-plant resistance, which saved the cotton growers from ruin in the late 1990s, leaves farmers with only relatively poor host plant tolerance to counter the extensive losses the disease causes. There has always been the fear that CLCuD could spread from the relatively limited geographical range it encompasses at present to other cotton-growing areas of the world where, although the disease is not present, the environmental conditions are suitable for its establishment and the whitefly vector occurs. Unfortunately recent events have shown this fear to be well founded, with CLCuD making its first appearance in China. Here, we outline recent advances made in understanding the molecular biology of the components of the disease complex, their interactions with host plants, as well as efforts being made to control CLCuD.

Characterization of a new world monopartite begomovirus causing leaf curl disease of tomato in Ecuador and Peru reveals a new direction in geminivirus evolution.

All characterized whitefly-transmitted geminiviruses (begomoviruses) with origins in the New World (NW) have bipartite genomes composed of a DNA-A and DNA-B component. Recently, an NW begomovirus lacking a DNA-B component was associated with tomato leaf curl disease (ToLCD) in Peru, and it was named Tomato leaf deformation virus (ToLDeV). Here, we show that isolates of ToLDeV associated with ToLCD in Ecuador and Peru have a single, genetically diverse genomic DNA that is most closely related to DNA-A components of NW bipartite begomoviruses. Agroinoculation of multimeric clones of the genomic DNA of three ToLDeV genotypes (two variants and a strain) resulted in the development of tomato leaf curl symptoms indistinguishable from those of ToLCD in Ecuador and Peru. Biological properties of these ToLDeV genotypes were similar to those of Old World (OW) monopartite tomato-infecting begomoviruses, including lack of sap transmissibility, phloem limitation, a resistance phenotype in tomato germplasm with the Ty-1 gene, and functional properties of the V1 (capsid protein) and C4 genes. Differences in symptom phenotypes induced by the ToLDeV genotypes in tomato and Nicotiana benthamiana plants were associated with a highly divergent left intergenic region and C4 gene. Together, these results establish that ToLDeV is an emergent NW monopartite begomovirus that is causing ToLCD in Ecuador and Peru. This is the first report of an indigenous NW monopartite begomovirus, and evidence is presented that it emerged from the DNA-A component of a NW bipartite progenitor via convergent evolution and recombination.

First Report of Tomato yellow leaf curl virus in Acalypha australis in China.

Whitefly-transmitted geminiviruses (WTGs) can cause serious damage to many crops in China, so an investigation of weed hosts of WTGs was carried out in Jiangsu Province, China, in 2012. Fifty-seven symptomless samples of Acalypha australis L., a common weed known as Asian copperleaf, were randomly collected from seven tomato fields in Nanjing and Lianyungang, Jiangsu Province, from July to September. Total DNA of each sample was extracted and PCR was performed using degenerate primers PA and PB to amplify a specific region covering the AV2 gene of DNA-A and part of the adjacent intergenic region (1). DNA fragments were successfully amplified from 27 out of 57 samples and PCR amplicons of 16 samples were sequenced. Alignment results showed that the nucleotide sequence identities ranged from 98 to 100% with Tomato yellow leaf curl virus (TYLCV) accessions. The full-length viral circular DNA genome was amplified using primer pair 1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and 1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) which were designed based on the known sequences amplified by PA and PB. The complete genome sequence (GenBank Accession No. JX910534) was 2,781 nucleotides in length and had 99 to 100% sequence identity with TYLCV accessions (GU434142, GU111505). The dot immunobinding assay using monoclonal antibody against TYLCV confirmed the 27 weed samples positive by PCR were infected by TYLCV. These results demonstrated that A. australis is a host of TYLCV that might play an important role in viral epidemics in tomato fields in China. TYLCV-infected A. australis did not show typical symptoms like leaf curl, chlorosis, and stunting and thus appears to be a symptomless host. In our investigation, the infection rate ranged from 14 to 79% depending on the field sampled, suggesting that the weed may be an important reservoir of TYLCV, especially during the non-tomato planting period. To our knowledge, this is the first report of A. australis as a host of TYLCV in China. Reference: (1) D. Deng et al. Ann. Appl. Biol. 125:327, 1994.

First Report of Ageratum yellow vein China virus Infecting Zinnia elegans in Vietnam.

Whitefly-transmitted geminiviruses belong to the Geminiviridae family, which includes a group of plant DNA viruses that occurs in tropical and subtropical regions worldwide and caused severe leaf curl diseases on many crops. In July 2011, symptoms of mild yellowing and curling of leaves were observed on Zinnia elegans in Hue City, Vietnam. To identify possible begomoviruses, two samples with typical symptoms (Z1 and Z2) were collected and total DNA was extracted using PlantGen DNA Kit (CoWin Biotech Co., China). Using begomovirus-specific degenerate primer pair AV494 and AC1048 to amply geminivirus capsid protein gene (3), a 586-bp DNA fragment was amplified from both collected samples. The PCR products from Z1 and Z2 were cloned and sequenced. The partial sequences from two isolates had 96.8% similarity to each other and most closely related to Ageratum yellow vein China virus (AYVCNV) (98% identity to GenBank Accession Nos. AM940137.1 and AJ849916.1). Using two degenerate primer pairs bego1 (5'-ACMGGCCYATGWAYMGGAAG-3')/bego6 (5'-ACNGGDAARACRATGTGGGC-3') and bego2 (5'-CTTDATRTTBTCRTCCATCC-3')/bego3 (5'-CCWGGATTGCANARSAMGAT-3') to amplify full-length viral genome from Z1 (1). The complete DNA-A sequence from Z1 were determined to be 2,741 nucleotides (JX911332), showed high levels of sequence identity (89% [JN809812] to 98% [AJ849916.1 and AJ558120]) with AYVCNV and shared 98% nucleotide sequence identity with AYVCNV-G68 (AJ849916.1) and AYVCNV-G13 (AJ558120). No DNA-B component nor DNA-β could be detected using primers described previously (4). Zinnia leaf curl virus, Ageratum enation virus, Tobacco leaf curl virus, and Alternanthera yellow vein virus have been reported to be associated with Zinnia leaf curl disease (2). To our knowledge, this is the first report of AYVCNV infecting Z. elegans. AYVCNV was first reported in A. conyzoides on Hainan Island, China, and could infect L. esculentum (Solanaceae), A. conyzoides (Asteraceae), or tobacco (Solanaceae). Our results further corroborate that AYVCNV can infect Asteraceae plants. Therefore, this virus may pose a serious threat to many plants.

Effect of Tomato yellow leaf curl bigeminivirus (TYLCV) infection on tomato cell ultrastructure and physiology

Tomato yellow leaf curl bigeminivirus was isolated in Kuwait and therefore designated as TYLCV-K. The virus was found to be transmitted by whiteflies (Bemisia tabaci Genn.), and produced the characteristic external symptoms on tomato (Solanum lycopersicum L.) test plants. Electron microscopy of ultra-thin sections of infected leaves showed alterations in the ultrastructure of some organelles and uneven thickenings of the cell wall of the phloem tissue associated with severe damage in chloroplasts and abnormal building up of oily inclusions and empty vacuoles. The causal virus was characterized as a whitefly-transmitted monopartite Geminivirus. Viral genomic DNA fragment of 1.1 kb was successfully amplified from TYLCV-K infected tissues using polymerase chain reaction (PCR). The virus identity was confirmed by using Southern and dot-blot hybridizations. Chemical components of tomato leaves, such as photosynthetic pigments, especially chlorophyll a and b, total lipids, saturated and unsaturated fatty acids, reducing sugars and proteins, decreased in infected leaves when compared with healthy leaves of tomato test plants. On the other hand, total phenols accumulated to a greater extent in infected leaves. However, concentration of ascorbic acid (an antioxidant), leaf extract pH and total fatty acids were not dramatically affected by TYLCV-K. The level of increase or decrease of these constituents varied with different stages of plant growth (depending upon the developmental stages of the leaf at the time of infection). Our study showed that the level of some of the chemical constituents in tomato leaves changed in response to TYLCV-K infection.

FIRST REPORT OF A BEGOMOVIRUS INFECTING MIMOSA PUDICA IN INDIA

Mimosa pudica L. (family Fabaceae) is an invasive species with ornamental and medicinal uses (Nayagam et al., 1999), native to Brazil and widespread in tropical and sub-tropical parts of the Americas, Africa and Asia, including India. The vernacular English name (touch-me-not) originates from the fact that the leaves fold inward when touched or shaken and reopen after a few minutes (seismonastic movement). During an extensive survey for whitefly-transmitted geminiviruses, samples were collected in Rajasthan (India) from stunted M. pudica plants with small and yellow leaves. The association of a geminivirus with the disease was suspected due to the presence of Bemisia tabaci (Genn.) on the plants. PCR assays using begomovirus coat protein gene-specific primers (forward 5’-ATGGCGAAGCGACCAG-3’ and reverse 5’TTAATTTGTGACCGAATCAT-3’) (Hallan, 1998), amplified a fragment 771 bp in length from symptomatic, but not from symptomless samples. The amplicons were cloned in pGEMT vector (Promega, USA), selected clones were sequenced in both orientations, and a sequence was deposited in GenBank (accession No. HQ876467). The highest nucleotide sequence identity (97%) was found with both Ageratum yellow vein virus-Guangxi (AYVV-Gx[CN:Gx13:Tom: 02], AJ558120) and [CN:Gx68:03], AJ849916) and Ageratum yellow vein virus-[G129] (AM940137). A nucleotide identity of 92% was found with both Tomato yellow leaf curl Mindanao virus and (EU487046) and Stachytarpheta leaf curl virus (StaLCuv [CN:Hn5.4:01] AJ564743). The sequences showed lower sequence identity (80%) with both Sida yellow vein Vietnam virus (SiYVVNV [VN:Han:05], DQ641696) and Papaya leaf curl China virus (PaLCuCNVPap [CN:Gx22:Tom:02], AJ704604). To the best of our knowledge this is the first published report of a begomovirus associated with Mimosa pudica in India.

Evaluation of DNA fragments covering the entire genome of a monopartite begomovirus for induction of viral resistance in transgenic plants via gene silencing

Tomato-infecting begomoviruses, a member of whitefly-transmitted geminivirus, cause the most devastating virus disease complex of cultivated tomato crops in the tropical and subtropical regions. Numerous strategies have been used to engineer crops for their resistance to geminiviruses. However, nearly all have concentrated on engineering the replication-associated gene (Rep), but not on a comprehensive evaluation of the entire virus genome. In this study, Tomato leaf curl Taiwan virus (ToLCTWV), a predominant tomato-infecting begomovirus in Taiwan, was subjected to the investigation of the viral gene fragments conferring resistance to geminiviruses in transgenic plants. Ten transgenic constructs covering the entire ToLCTWV genome were fused to a silencer DNA, the middle half of N gene of Tomato spot wilt virus (TSWV), to induce gene silencing and these constructs were transformed into Nicotiana benthamiana plants. Two constructs derived from IRC1 (intergenic region flanked with 5' end Rep) and C2 (partial C2 ORF) were able to render resistance to ToLCTWV in transgenic N. benthamiana plants. Transgenic plants transformed with two other constructs, C2C3 (overlapping region of C2 and C3 ORFs) and Rep2 (3' end of the C1 ORF), significantly delayed the symptom development. Detection of siRNA confirmed that the mechanism of resistance was via gene silencing. This study demonstrated for the first time the screening of the entire genome of a monopartite begomovirus to discover viral DNA fragments that might be suitable for conferring virus resistance, and which could be potential candidates for developing transgenic plants with durable and broad-spectrum resistance to a DNA virus via a gene silencing approach.

Structural Modeling and Validation of Rep protein of Begomovirus Strains (TLCBV and TYLCTHV)

AbstractHomology modeling involves taking a known sequence with an unknown structure and mapping it against a known structure of one or several similar (homologous) proteins. It would be expected that two proteins of similar origin and function would have reasonable structural similarity. Therefore it is possible to use the known structure as a template for modeling the structure of the unknown structure. Proteins that share the same function generally have similar structures. During alignment if two proteins show maximum sequence identity they also show a similar folding pattern. This principal has became the foundation of homology modeling.The Geminivirus taxonomic group of plant viruses is characterized by geminate particles and genomes consisting of single-stranded circular DNA molecules of about 2.5 to 2.8 kb in size. Agricultural plants are threatened by many diseases caused by whitefly-transmitted geminiviruses. Since these diseases are in a fast spreading phase, it is urgent to devise rapid diagnosis methods and to produce resistant plants.

Structural Modeling and Validation of Rep protein of Begomovirus Strains (TLCBV and TYLCTHV)

Homology modeling involves taking a known sequence with an unknown structure and mapping it against a known structure of one or several similar (homologous) proteins. It would be expected that two proteins of similar origin and function would have reasonable structural similarity. Therefore it is possible to use the known structure as a template for modeling the structure of the unknown structure. Proteins that share the same function generally have similar structures. During alignment if two proteins show maximum sequence identity they also show a similar folding pattern. This principal has became the foundation of homology modeling.The Geminivirus taxonomic group of plant viruses is characterized by geminate particles and genomes consisting of single-stranded circular DNA molecules of about 2.5 to 2.8 kb in size. Agricultural plants are threatened by many diseases caused by whitefly-transmitted geminiviruses. Since these diseases are in a fast spreading phase, it is urgent to devise rapid diagnosis methods and to produce resistant plants.