Wheat Dwarf Virus Research Articles

First Report of Barley yellow dwarf virus and Cereal yellow dwarf virus Affecting Cereal Crops in Azerbaijan.

A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5'TTCGGMSARTGGTTGTGGTCCA 3' and YanR-new 5'TGTTGAGGAGTCTACCTATTTNG 3' (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5'TCACSTTCGGRCCGWSTYTWTCAG 3' (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5'TTGTACCGCTTGATCCACGG 3' et CYDV-rev-New 5'GTCTGCGCGAACCATTGCC 3', both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen.

Modification of Non-Vector Aphid Feeding Behavior on Virus-Infected Host Plant

Virus-infected host plants can have positive, neutral or negative effects on vector aphids. Even though the proportion of non-vector aphids associated with a plant far exceeds that of vector species, little is known about the effect of virus-infected plants on non-vector aphids. In the present study, the English grain aphid Sitobion avenae (Fabricius) (Hemiptera: Aphididae), a non-vector of Wheat dwarf virus (WDV) and Cereal yellow dwarf virus-RPV (CYDV-RPV), was monitored on, virus-infected, virus-free and leafhopper/aphid-infested, and virus- and insect-free (control) barley, Hordeum vulgare L. (Poales: Poaceae), plants. Electrical penetration graph recordings were performed. Compared with the control plants, S. avenae on infected plants exhibited reduced non-probing and pathway phase, and increased phloem sap ingestion phase, and more aphids reached sustained phloem ingestion. However, the electrical penetration graph parameters described above showed no significant differences in aphid feeding behavior on virus-free and vector pre-infested plants and the control barley plants during S. avenae feeding. The results suggest that WDV/CYDV-RPV-infected host plants positively affected the feeding behavior of the non-vector aphid S. avenae. Based on these results, the reasons and trends among the virus-infected host plants' effects on the feeding behavior of non-vector aphids are discussed.

Genomic Analysis of the Natural Population of Wheat dwarf virus in Wheat from China and Hungary

During the last decade, the leafhopper transmitted Wheat dwarf virus (WDV) has become a serious problem both in northwestern China and Hungary. In order to study the molecular diversity and population structure of WDV in these two countries, 39 Chinese isolates and 16 Hungarian isolates were collected from different regions of China and Hungary, and their genomes were sequenced. All isolates belonged to the wheat strain of WDV and showed limited genetic diversity. The highest and lowest nucleotide sequence identities among isolates from China and Hungary were 99.9 and 90%, respectively. In all isolates, the lowest nucleotide sequence identity was 89.5% between MO10-1 and KP10-5, which were collected from Martonvásár and Kompolt, Hungary. Phylogenetic analyses showed the genome sequences of 55 WDV isolates belong to two big clades, but no clear correlation to geographical location. Population difference analyses indicated that the Chinese and Hungarian WDV populations have no significant difference. The regions in WDV genome with relatively low nucleotide diversities represented protein coding regions suggested that these regions evolved under negative selection, and might be one of the causes restricting the number of genetic variants.

Erratum to: Real-time PCR assay for the discrimination and quantification of wheat and barley strains of Wheat dwarf virus

Erratum to: Real-time PCR assay for the discrimination and quantification of wheat and barley strains of Wheat dwarf virus

Development of a multiplex polymerase chain reaction for simultaneous detection of wheat viruses and a phytoplasma in China

Barley yellow dwarf viruses (BYDVs, mainly consisting of three strains, GAV, GPV and PAV, in China), barley stripe mosaic virus (BSMV), wheat yellow mosaic virus (WYMV), wheat dwarf virus (WDV) and wheat blue dwarf phytoplasma (WBD) constitute a group of major wheat pathogens that have caused huge yield losses but are scarcely distinguished by their phenotype alone. For the simultaneous detection and discrimination of these seven pathogens in wheat, a multiplex polymerase chain reaction (M-PCR) method was developed in this study through a series of parameter optimizations. Detection and sensitivity tests using samples collected from the field indicate that the M-PCR method can rapidly, simultaneously and relatively effectively detect BYDV-GAV, -GPV, -PAV, BSMV, WYMV, WDV and WBD.

Real-time PCR assay for the discrimination and quantification of wheat and barley strains of Wheat dwarf virus

A rapid method for detection, discrimination and quantification of wheat and barley strains of wheat dwarf virus (WDV) was successfully developed. The sensitivity of quantification of the wheat and barley strains of WDV ranged from an average of 1.2 × 10(7)-1.2 × 10(2) and from an average of 1.4 × 10(7)-1.4 × 10(4) copies of viral genome, respectively. These standard serial dilutions were applied to plant and vector tissues for virus titer calculations. Both strains of WDV were clearly discriminated by specific probes and melting curve analysis. Both TaqMan(®) and SYBR(®) Green technologies provided accurate and reliable methods for monitoring, detection, discrimination, and quantification of WDV.

The virus infection of South-Hungarian corn fields

The past years cereal diseases, including the virus diseases have been increased in Hungary as well as worldwide. The aim of our work was to survey the virus infection of South Hungarian wheat fields. Leaf samples were collected in Szeged at the experimental farm of Cereal Research Nonprofit Co., in April and Junes of 2009 and 2010. DAS ELISA tests were carried out using Loewe antisera of Brome mosaic virus (BMV), Barley yellow dwarf virus (BYDV), Barley stripe mosaic virus (BSMV), Brome streak mosaic virus (BStMV), Wheat dwarf virus (WDV), and Wheat streak mosaic virus (WSMV) and measured with Labsystem Multiscan RC Elisa reader at 405nm. In the samples of 2009 the Wheat dwarf and Wheat streak mosaic viruses were dominated. It was also significant the appearance of the. Barley yellow dwarf virus. 2010. was favourable for the spread of the virus vectors, therefore the incidence of virus diseases increased.

SPREAD OF WHEAT DWARF VIRUS (WDV) ON THE SOUTH OF UKRAINE

There were detected the wheat dwarf virus (WDV) on the wheat and barley grown at the South part of Ukraine. The virus identification was conducted by ELISA-test and Polymerase Chain Reaction (PCR). The WDV distribution and cereals varietal resistance to this virus were analyzed. It was established that the level of WDV infection depends on the time of crops sowing and the climatic conditions.

Quantitative detection of cereal geminiviruses

AbstractThe Geminiviruses _Wheat dwarf virus_ (WDV) and _Barley dwarf virus_ (BDV) cause symptoms such as dwarfing, stunting and yellowing in infected cereals and can lead to reduced yield and even death of the plant. Both viruses are transmitted by the leafhopper _Psammotettix alienus_ Dahlb. in a persistent non propagative manner. WDV is reported in Germany since the early 1990s. In the future an increase of infections is predicted due to global warming which leads to prolonged active periods of the vector in autumn. Furthermore infected plants can hibernate and serve as source of infection in spring.For the first time quantitative PCR assays were developed which allow the sensitive detection and quantification of WDV and BDV both in plants and vectors. Both viruses are detected with primers located in conserved regions of the viral genome. Taqman® Hydrolysis probes were designed for differentiating detection of WDV and BDV. The absolute quantification of viral copies is done by a standard dilution series of cloned viral DNA. The sensitivity of the method was compared to DAS-ELISA. For this purpose, sap of heavily infected plants was diluted with sap of healthy plants. With qPCR, virus was detectable in dilutions of 10-8 whereas the ELISA reaches the limit of detection at dilutions of 10-4.Field plants were analyzed to investigate how many viral copies can be found under natural infection conditions in late spring. ELISA and rating of symptoms were performed in parallel. It could be shown that viral copy number does not correlate with severity of disease symptoms.Winter barley cultivar ‘Rubina’ was inoculated with viruliferous _P. alienus_ under greenhouse conditions to monitor spatial development of infection. Virus titre increased continuously over 4 weeks. The virus was unequally distributed in the plant; the highest amounts were detected in the youngest leaf.Body and head of _P. alienus_ were analyzed separately to quantify virus content. The viruliferous leafhoppers were kept on plants for 7 days to infect them. It became evident that virus content of the vector does not correlate with its ability to infect plants.These highly sensitive and specific PCR assays allow a wide range of applications, e.g. investigations of the development of virus infection in the plant, vector transmission studies and comparisons of virus content of different cultivars for resistance breeding purposes.

First Report of Wheat dwarf virus and Its Vector (Psammotettix provincialis) Affecting Wheat and Barley Crops in Syria

A field survey covering the major cereal-production areas of Syria was conducted during May 2009. A total of 938 wheat and 971 barley samples with typical symptoms of viral infection were collected from 45 wheat and 58 barley fields. All collected samples were tested by the tissue-blot immunoassay (1) at the Virology Laboratory of ICARDA, Syria using six specific cereal virus antisera, including polyclonal antibody AS-0216 for Wheat dwarf virus (WDV) provided by the German Collection of Microorganisms and Cell Cultures (DSMZ). Serological tests showed that WDV was detected in 16 wheat (cv. Cham 8) and five barley (cv. Arabic abiad) samples collected from Al-Hasskah governorate (eastern region of Syria) and showing dwarfing, yellowing, and reduced heading. Samples that reacted with WDV antiserum were transmitted from infected plants to healthy plants of oat (Avena sativa L.), barley (Hordeum vulgare L.), wheat (Triticum aestivum L.), and some grass species using four different leafhopper species, collected from Syrian wheat and barley fields, in a persistent manner. Leafhopper transmission tests indicated that only Psammotettix provincialis Ribaut was able to transmit Syrian barley WDV isolates (SB 1248-09 and SB 1249-09) from infected barley plants to healthy barley (48 plants became infected of 50 plants inoculated) and oats (45 of 50) under greenhouse conditions. The identity of P. provincialis was confirmed by the British Museum. Total DNA was extracted from six WDV-positive samples (three wheat and three barley) and tested by PCR using WDV primer set (WDV-F: 5'-TTGAGCCAATCTTCGTC-3'; WDV-R: 5'-GGAAAGACTTCCTGGGC-3') described by Oluwafemi (2). All six Syrian WDV-positive samples generated amplicons around the expected size (~253 bp). The amplicons from one isolate from wheat (SW 2131-09, GenBank Accession No. HQ113095) and one isolate from barley (SB 1248-09, GenBank Accession No. HQ113096) showed they had 86% sequence identity with each other, suggesting that both isolates can be considered to belong to the same species (3). Barley isolate SB 1248-09 had 99% sequence identity to an Iranian isolate of Barley dwarf virus (FJ620684.1) and 92% identity to most European barley-WDV isolates (e.g., Germany [AM942044.1] and Hungary [FM999832.1]), whereas, the wheat isolate (SW 2131-09) had 98 to 100% identity with most European wheat-WDV isolates (e.g., Czech Rep [FJ546191.1] and Germany [AM296023.1]) and a Chinese isolate (EF536868.1). WDV has been reported to infect cereals in few countries in West Asia and North Africa (Turkey, Tunisia, and Morocco) and causes economic losses on wheat in many countries in Europe (e.g., Sweden). WDV has been reported to be transmitted in a persistent manner only by leafhoppers (P. alienus Dahlbom) (4) to a wide range of cereal and wild grasses. Two strains of WDV are known, one that primarily infects wheat and another that infects barley. To our knowledge, this is the first record of WDV (both strains) infecting wheat and barley crops in Syria and the first report of P. provincialis as a WDV vector worldwide.

Comparition of the Nucleotide Sequences of Wheat Dwarf Virus (WDV) Isolates from Hungary and Ukraine

Wheat dwarf virus (WDV) is the most ubiquitous virus in cereals causing huge losses in both Hungary and Ukraine. The presence of barley-and wheat-adapted strains has been confirmed, suggesting that the barley strain is restricted to barley, while the wheat strain is present in both wheat and barley plants. Five WDV isolates from wheat plants sampled in Hungary and Ukraine were sequenced and compared with known WDV isolates from GenBank. Four WDV isolates belonged to the wheat strain. Our results indicate that WDV-Odessa is an isolate of special interest since it has originated from wheat, but belongs to the barley-adapted strain, providing novel data on WDV biology and raising issues of pathogen epidemiology.

Yearly change of Wheat dwarf virus infection rate during 1996-2010 in winter barley

Yearly change of the infection of Wheat dwarf virus was studied in winter barley during 1996-2010. Surveys were carried out at Kompolt (Rudolf Fleischmann Research Institute, Róbert Károly College), in winter barley breeding lines showing leaf yellowing and stunting symptoms. In 1996, 250 winter barley samples were tested. During the period of 1997–2005, 100 samples were collected in each year. In 2006, 490 winter barley samples were tested. In 2007 and 2008 the number of samples collected was 500 from winter barley. In 2009 year 100, and in 2010 year 100 winter barley samples were collected for virus testing. Virus diagnosis was carried out using DASELISA for the detection of Wheat dwarf virus (WDV), Barley yellow dwarf viruses (BYDV-MAV, BYDV-PAV, BYDV-RMV, BYDV-SGV), and Cereal yellow dwarf virus (CYDV-RPV). During the ten of the last fifteen years, the occurrence of Wheat dwarf virus in infected samples exceeded those of other viruses causing leaf yellowing and dwarfing symptoms. There were years (1997, 2002, 2004, 2007, 2009 and 2010) when only the Wheat dwarf virus played the main role in development of yirus symtoms. A contrasting tendency can be observed between the degrees of infection of WDV and BYDV. With a rise of infection in the WDV, the proportion of BYDV decreased and vice-versa.

Partial resistance to Wheat dwarf virus in winter wheat cultivars

Four Hungarian winter wheat cultivars were investigated for their susceptibility to the geminivirus Wheat dwarf virus (WDV). Previously, two cultivars (Mv Regiment and Mv Emese) were assessed by breeders to exhibit virus symptoms in the field, whereas Mv Dalma and Mv Vekni showed few symptoms. Two inoculation techniques for WDV, vector transmission with the leafhopper Psammotettix alienus and agroinoculation, were used. Leafhopper transmission was more efficient than agroinoculation. However, irrespective of the technique used, no Mv Dalma or Mv Vekni plants showed clear WDV symptoms. In contrast, 3/30 Mv Emese and 4/36 Mv Regiment plants showed dwarfing and chlorosis after agroinoculation and 13/17 and 14/15 plants, respectively, had clear WDV symptoms after vector transmission. WDV‐specific PCR showed that Mv Vekni and Mv Dalma plants could be infected, especially following vector transmission (approximately 50% infection), but at significantly lower frequency than Mv Emese or Mv Regiment plants (100% infection). Furthermore, real‐time PCR showed that WDV DNA accumulated to much lower levels in infected Mv Vekni and Mv Dalma plants than in infected Mv Regiment and Mv Emese plants. The data strongly suggest that Mv Vekni and Mv Dalma are partially resistant to WDV infection. As WDV resistance has not previously been identified in wheat, and because WDV can cause significant yield losses, the resistance of Mv Vekni or Mv Dalma will provide a valuable breeding resource.

Widespread occurrence and molecular characterization of Wheat dwarf virus in Iran

Wheat dwarf virus (WDV), genus Mastrevirus, was associated with yellowing and dwarfing of wheat and barley in many parts of Iran. The complete nucleotide sequence of a barley isolate of the virus consisted of 2733 nucleotides and was most similar to barley isolates of WDV from Turkey, Czech Republic and Germany, but different enough to be regarded as a new strain of the virus. Phylogenetic analysis indicated that mastreviruses causing yellows and dwarfing in wheat and barley form two distinct groups. The Iranian and European barely isolates fall in one group while all wheat isolates are placed in another group. These results confirmed the division of WDV isolates into two distinct strains. WDV was also found in mixed infection with barley yellow dwarf viruses (BYDVs) in barley and wheat plants. Using dot blot hybridization with the full ssDNA genome of the Iranian barley isolate of WDV as a probe and PCR with primers which amplified the full length DNA of the virus, WDV was detected in 46 of 211 BYDV positive barley and wheat samples from northern, northwestern, northeastern, central and southern Iran. It is concluded that in addition to BYDVs, WDV is a major component of the yellows complex in cereal fields in Iran.

Detection of wheat dwarf virus (WDV) in wheat and vector leafhopper ( Psammotettix alienus Dahlb.) by real-time PCR

Wheat dwarf virus (WDV) is a newly emerging pathogen affecting wheat production in China. A real-time PCR method using the TaqMan probe is described for quantitative detection of WDV in wheat tissues and in leafhopper ( Psammotettix alienus Dahlb.). Primers and probes for specific detection of WDV were designed within the conserved region of the coat protein (CP) gene sequence. A sensitivity assay showed the detection limit of the assay was 30 copies, and the standard curve was linear over range 30–3 × 10 6 copies, with good reproducibility. Simultaneously, this real-time PCR assay could be used to detect WDV CP genes in viruliferous leafhoppers. As determined by an end-point dilution comparison, real-time PCR was close to 10 4-fold more sensitive than the indirect enzyme-linked immunosorbent assay for WDV detection. Field samples of wheat and leafhopper collected from different regions of China were detected by both real-time PCR and gel-based PCR. The results showed more positive samples could be identified by real-time PCR than by gel-based PCR. This quantitative detection assay provides a valuable tool for diagnosis and molecular studies of WDV biology.

Development and validation of a method for the detection of altered resistance in transgenic plants against herbivore-pathogen-complexes

AbstractEnhanced or reduced uptake of viruses by vectors and changes in resistance level can be sensitive indicators for metabolic changes in transgenic plants caused by the new trait and not observed by conventional methods. In addition, the plant transformation process itself can lead to such changes. To be able to investigate this hypothesis in cereals we decided to use two highly important insect-transmitted viruses infecting them - Barley yellow dwarf virus (BYDV) and Wheat dwarf virus (WDV). Corresponding molecular tools for their quantification in plants as well as virus vectors had to be developed. Both viruses cause similar symptoms: dwarfing, stunting, leaf discoloration leading to yield losses or death of plant. BYDV (Luteoviridae) is one of the most important cereal-infecting viruses worldwide causing substantial yield losses. In Germany, the strain PAV is widespread. It is transmitted by the aphids Rhopalosiphum padi and Sitobion avenae in a persistent manner. WDV (Geminiviridae) is found in Germany since the early 1990s and has gained importance over the last years. It is transmitted by the leafhopper Psammotettix alienus in a persistent manner. Real-time PCR is the state of the art method for specific detection of viruses even in minor quantities. It allows exact quantification of the virus content of plants and vectors and is hence suited to monitor changes of it. We developed qPCR assays for WDV and RT-qPCR assays for BYDV-PAV based on TaqMan probe technology as well as the DNA-binding dye SybrGreen. The qPCR assays proved to be more sensitive than DAS-ELISA. For example, WDV is detected even at dilutions of 1:10^8^, whereas the corresponding threshold for ELISA is about 1:10^4^. As nucleic acid extraction procedures proved to be time consuming and expensive, detection methods are adopted now for immunocapture procedures. These methods will be applied to the analysis of several transgenic wheat lines.

Activation of geminivirus V‐sense promoters in roots is restricted to nematode feeding sites

Obligate sedentary endoparasitic nematodes, such as the root-knot and cyst nematodes, elicit the differentiation of specialized nematode nurse or feeding cells [nematode feeding sites (NFS), giant cells and syncytia, respectively]. During NFS differentiation, marked changes in cell cycle progression occur, partly similar to those induced by some geminiviruses. In this work, we describe the activation of V-sense promoters from the Maize streak virus (MSV) and Wheat dwarf virus (WDV) in NFS formed by root-knot and cyst nematodes. Both promoters were transiently active in microinjection experiments. In tobacco and Arabidopsis transgenic lines carrying promoter-beta-glucuronidase fusions, the MSV V-sense promoter was activated in the vascular tissues of aerial plant parts, primarily leaf and cotyledon phloem tissue and some floral structures. Interestingly, in roots, promoter activation was restricted to syncytia and giant cells tested with four different nematode populations, but undetectable in the rest of the root system. As the activity of the promoter in transgenic rootstocks should be restricted to NFS only, the MSV promoter may have utility in engineering grafted crops for nematode control. Therefore, this study represents a step in the provision of some of the much needed additional data on promoters with restricted activation in NFS useful in biotechnological nematode control strategies.

Studies on the host range of the barley strain of Wheat dwarf virus using an agroinfectious viral clone

Comparative analysis of the host ranges of the barley and wheat strains of Wheat dwarf virus (WDV; family Geminiviridae; genus Mastrevirus) in Europe has been severely hampered by the lack of an infectious clone of the barley strain. To remedy this situation an agroinfectious clone of a Hungarian isolate of the barley strain (WDV‐Bar[HU]) was constructed and its virulence tested in barley (Hordeum vulgare), wheat (Triticum aestivum), rye (Secale cereale) and oat (Avena sativa) by agroinoculation. Although all four species could be systemically infected by the isolate, infections were asymptomatic in the rye and oat cultivars tested. WDV‐Bar[HU] induced chlorosis and stunting symptoms typical of WDV in barley, while in wheat low infection rates but high mortality of infected seedlings were observed. In contrast, a much higher percentage of wheat plants agroinoculated with a wheat‐strain isolate (WDV‐[Enk1]) became systemically infected. WDV‐[Enk1] in wheat caused symptoms similar to those caused by WDV‐Bar[HU] in barley. WDV‐Bar[HU] was leafhopper‐transmissible to barley seedlings, in which it caused typical WDV symptoms; geminate virus particles were isolated from the infected leaves. Comparison of the genomic sequences of 11 barley strain isolates from Europe and Turkey revealed that whereas WDV‐Bar[HU] represents a typical barley‐strain isolate that is not detectably recombinant, the Turkish barley isolate (WDV‐Bar[TR]) is probably a recombinant between a barley‐strain isolate and an as‐yet‐undescribed WDV‐like mastrevirus species.

Virus Resistance in Cereals: Sources of Resistance, Genetics and Breeding

AbstractIn cereals, soil‐borne viruses transmitted by the plasmodiophorid Polymyxa graminis (e.g., Barley mild mosaic virus, Barley yellow mosaic virus or Soil‐borne cereal mosaic virus), have increased in importance due to the increase of the acreage infested and because yield losses cannot be prevented by chemical measures. Due to global warming, it is also expected that insect transmitted viruses vectored by aphids (e.g., Barley yellow dwarf virus, Cereal yellow dwarf virus), leafhoppers (Wheat dwarf virus) or mites (e.g., Wheat streak mosaic virus), will become much more important even in cooler regions. The environmentally most sound and also most cost effective approach to prevent high yield losses caused by these viruses is breeding for resistance. Therefore, in contrast to other reviews on cereal viruses, this study briefly reviews present knowledge on cereal‐infecting viruses and emphasizes especially the sources of resistance or tolerance to these viruses and their use in molecular breeding schemes.

The nucleotide sequence of barley strain ofWheat Dwarf Virusisolated in Bulgaria

The nucleotide sequence of barley strain of<i>Wheat Dwarf Virus</i>isolated in Bulgaria