Water-treated Control Research Articles

First Report of Leaf Spot Disease Caused by Glomerella magna on Lobelia chinensis in China.

Lobelia chinensis is a perennial herbaceous plant in the family Campanulaceae that is native to China, where it grows well in moist to wet soils. It is commonly used as a Chinese herbal medicine. In May 2012, symptoms of leaf spot were observed on leaves of L. chinensis in Nanning, Guangxi Zhuang Autonomous Region, China. The leaf lesions began as small, water-soaked, pale greenish to grayish spots, which enlarged to gray to pale yellowish spots, 4 to 6 mm in diameter. At later stages, numerous acervuli appeared on the lesions. Acervuli were mostly epiphyllous, and 40 to 196 μm in diameter. On potato dextrose agar (PDA), a fungus was consistently recovered from symptomatic leaf samples, with a 93% isolation rate from 60 leaf pieces that were surface sterilized in 75% ethanol for 30 s and then in 0.1% mercuric chloride for 45 s. Three single-spore isolates were used to evaluate cultural and morphological characteristics of the pathogen. Setae were two to three septate, dark brown at the base, acicular, and up to 90 μm long. Conidia were long oblong-elliptical, guttulate, hyaline, and 11 to 20 × 4.1 to 6.3 μm (mean 15.2 × 5.1 μm). These morphological characteristics of the fungus were consistent with the description of Colletotrichum magna (teleomorph Glomerella magna Jenkins & Winstead) (1). The rDNA internal transcribed spacer (ITS) region of one isolate, LC-1, was sequenced (GenBank Accession No. KC815123), and it showed 100% identity to G. magna, GenBank HM163187.1, an isolate from Brazil cultured from papaya (2). Although KC815123 was identified as G. magna, it shows 99% identity to GenBank sequences from isolates of C. magna, and more research is needed to elucidate the relationships between these taxa, especially with consideration to host specificity. Pathogenicity tests were performed with each of the three isolates by spraying conidial suspensions (1 × 106 conidia/ml) containing 0.1% Tween 20 onto the surfaces of leaves of 30-day-old and 6- to 8-cm-high plants. For each isolate, 30 leaves from five replicate plants were treated. Control plants were treated with sterilized water containing 0.1% Tween 20. All plants were incubated for 36 h at 25°C and 90% relative humidity in an artificial climate chamber, and then moved into a greenhouse. Seven days after inoculation, gray spots typical of field symptoms were observed on all inoculated leaves, but no symptoms were seen on water-treated control plants. Koch's postulates were fulfilled by reisolation of G. magna from diseased leaves. To our knowledge, this is the first report of G. magna infecting L. chinensis worldwide.

Dextran sodium sulfate inhibits the activities of both polymerase and reverse transcriptase: lithium chloride purification, a rapid and efficient technique to purify RNA

BackgroundDextran sodium sulfate (DSS) is commonly used in mouse studies to induce a very reproducible colitis that effectively mimics the clinical and histological features of human inflammatory bowel disease (IBD) patients, especially ulcerative colitis. However, the mechanisms of action of DSS remain poorly understood, and observations by our laboratory and other groups indicate that DSS contamination of colonic tissues from DSS-treated mice potently inhibits the quantitative reverse-transcription polymerase chain reaction (qRT-PCR) amplification of mRNA.ResultsA prior study used poly-A-mediated mRNA purification to remove DSS from RNA extracts, but we herein report a second efficient and cost-effective approach to counteract this inhibition, using lithium chloride precipitation to entirely remove DSS from RNAs. We also explored how DSS interferes with qRT-PCR process, and we report for the first time that DSS can alter the binding of reverse transcriptase to previously primed RNA and specifically inhibits the enzymatic activities of reverse transcriptase and Taq polymerase in vitro. This likely explains why DSS-treated colonic RNA is not suitable to qRT-PCR amplification without a previous purification step.ConclusionIn summary, we provide a simple method to remove DSS from colonic RNAs, and we demonstrate for the first time that DSS can inhibit the activities of both polymerase and reverse transcriptase. In order to reliably analyze gene expression in the colonic mucosa of DSS-treated mice, the efficiency rate of qRT-PCR must be the same between all the different experimental groups, including the water-treated control group, suggesting that whatever the duration and the percentage of the DSS treatment, RNAs must be purified.

Pre-harvest calcium application increases biomass and delays senescence of broccoli microgreens

Microgreen consumption has been steadily increasing in recent years due to consumer awareness of their unique color, rich flavor, and concentrated bioactive compounds. However, industrial production and marketing is limited by their short shelf-life associated with rapid deterioration in product quality. This study investigated the effect of pre-harvest calcium application on the post-harvest quality and shelf-life of broccoli microgreens. Broccoli microgreen seedlings were sprayed daily with calcium chloride at concentrations of 1, 10 and 20mM, or water (control) for 10 days. The fresh-cut microgreens were packaged in sealed polyethylene film bags. Package headspace atmospheric conditions, overall visual quality and tissue membrane integrity were evaluated on days 0, 7, 14, and 21, during 5°C storage. Results indicated that the 10mM calcium chloride treatment increased the biomass by more than 50%, and tripled the calcium content as compared to the water-treated controls. Microgreens treated with 10mM calcium chloride spray exhibited higher superoxide dismutase and peroxidase activities, lower tissue electrolyte leakage, improved overall visual quality, and reduced microbial growth during storage. Furthermore, calcium treatment significantly affected expression of the senescence-associated genes BoSAG12, BoGPX6, BoCAT3 and BoSAG12. These results provide important information for commercial growers to enhance productivity and improve postharvest quality and shelf-life, potentially enabling a broadening of the retail marketing of broccoli microgreens.

Systemic Induction of the Small Antibacterial Compound in the Leaf Exudate During Benzothiadiazole-elicited Systemic Acquired Resistance in Pepper.

Plants protect themselves from diverse potential pathogens by induction of the immune systems such as systemic acquired resistance (SAR). Most bacterial plant pathogens thrive in the intercellular space (apoplast) of plant tissues and cause symptoms. The apoplastic leaf exudate (LE) is believed to contain nutrients to provide food resource for phytopathogenic bacteria to survive and to bring harmful phytocompounds to protect plants against bacterial pathogens. In this study, we employed the pepper-Xanthomonas axonopodis system to assess whether apoplastic fluid from LE in pepper affects the fitness of X. axonopodis during the induction of SAR. The LE was extracted from pepper leaves 7 days after soil drench-application of a chemical trigger, benzothiadiazole (BTH). Elicitation of plant immunity was confirmed by significant up-regulation of four genes, CaPR1, CaPR4, CaPR9, and CaCHI2, by BTH treatment. Bacterial fitness was evaluated by measuring growth rate during cultivation with LE from BTH- or water-treated leaves. LE from BTH-treatment significantly inhibited bacterial growth when compared to that from the water-treated control. The antibacterial activity of LE from BTH-treated samples was not affected by heating at 100°C for 30 min. Although the antibacterial molecules were not precisely identified, the data suggest that small (less than 5 kDa), heat-stable compound(s) that are present in BTH-induced LE directly attenuate bacterial growth during the elicitation of plant immunity.

Restoration of Recurrent‐Laryngeal‐Nerve Function after Injury in a Rat Model

Objectives: Recurrent laryngeal nerve (RLN) injury occurs in 4-10% of thyroid surgeries. Spontaneous RLN regeneration takes months and is often incomplete. Lithium promotes neuronal growth in vitro. We developed methods to objectively detect vocal-fold impairment in the rat and tested whether systemic lithium enhances recovery after RLN injury. Methods: The right RLN was crushed in eight adult rats, and osmotic pumps releasing either lithium or water were implanted. Eight sham-operated animals were also implanted with either lithium or water pumps. Vocal-fold motion was captured by microsuspension laryngoscopy and was measured quantitatively by image analysis at the time of surgery and at one and four weeks. Vocalizations, breathing patterns, and laryngeal electromyography were assessed at four weeks. Results: Cessation of unilateral vocal-fold motion was observed simultaneously with every RLN crush. One week after surgery, 50% of “Crush/Water” animals exhibited full vocal-fold motion, compared to 75% of “Crush/Lithium” and 100% of the sham-operated animals. In animals with unilateral vocal-fold immobility, the quantitative analysis also revealed a subtle decrease of vocal-fold movement on the non-operated side. At four weeks after surgery, vocalizations, breathing patterns, vocal-fold motion, and electromyograms were indistinguishable among all groups. Lithium-treated animals weighed 5% less than water-treated controls. Conclusions: Quantitative endoscopy is a sensitive and efficient tool for detecting vocal-fold impairment in rats. While our results might suggest enhanced recovery in lithium treated animals, all animals showed a rapid return of vocal-fold motion. Perhaps more severe nerve injury is necessary to uncover an effect of lithium on nerve regeneration.

Aqueous extract of purple Bordeaux radish, Raphanus sativus L. ameliorates ethanol-induced gastric injury in rats

The aim of this study was to evaluate whether the crude aqueous extract of purple Bordeaux radish (Raphanus sativus L.) (PBR) ameliorates ethanol-induced gastric injury in rats. Animals were divided into the following nine groups: normal, distilled water-treated vehicle control, groups orally administered PBR extract (250, 500 and 1,000 mg/kg, daily for 2 weeks), with or without ethanol treatment (5 ml/kg) 24 h after final administration of PBR extract, and a group treated with ethanol alone. Rats treated with PBR extract (250–1,000 mg/kg) for 2 weeks showed no significant effects on body weight and gastric mucosa. Pretreatment with PBR extract at doses of 500 and 1,000 mg/kg, but not 250 mg/kg, significantly ameliorated ethanol-induced gastric hemorrhages in rats (p < 0.05). The immunoreactivities of inducible nitric oxide (iNOS) and its byproduct nitrotyrosine in the gastric mucosa of ethanol-treated rats pretreated with 500 mg/kg PBR extract were significantly reduced, as compared with rats treated with ethanol alone (p < 0.05). Collectively, these findings suggest that pretreatment with PBR extract ameliorates ethanol-induced damage in the gastric mucosa, which is mediated partly by the anti-oxidative activity of the extract. The precise mechanism of this gastroprotective action of PBR extract should be investigated further.

Induced suppression of soft rot disease in tobacco by combined application of Bacillus subtilis strain B4 and chemical elicitor BTH

In this study, the utility of the combined application of Benzo-(1,2,3)-thidiazole-7-carbothioic acid S-methyl ester (BTH), a systemic acquired resistance (SAR) inducer, and the plant growth-promoting rhizobacteria (PGPR), Bacillus subtilis strain B4 (B4), was investigated for the suppression of soft rot disease caused by Pectobacterium carotovorum SCC1 (SCC1) in tobacco seedlings. Soft rot disease was completely suppressed in tobacco with combined application of B4 strain and 0.1 mM BTH when compared to individual application upon pathogen challenge. In addition, the population of bacterial cells of B4 strain was found to be greater when cultured in growth media in the presence of BTH, compared to the growth of B4 strain in the absence of BTH. Spectrophotometer analysis revealed that there was an increased broad range of compounds in the culture filtrate of B4 strain when grown with BTH, compared to the culture filtrate of B4 strain alone. The combined application of B4 strain and 0.1 mM BTH induced the increased expression of PR1a::GUS on tobacco and elicited systemic resistance against SCC1 when compared to individual application. However, there was low expression of PR1a::GUS in the water-treated control. Hence, the integrated use of BTH and B4 strain might be one of the strategies for biological control of soft rot disease through induced systemic resistance (ISR) in tobacco plants.

Nematotoxicity of drupacine and a Cephalotaxus alkaloid preparation against the plant‐parasitic nematodes Meloidogyne incognita and Bursaphelenchus xylophilus

Species of Cephalotaxus (the plum yews) produce nematotoxic compounds of unknown identity. Consequently, bioassay-guided fractionation was employed to identify the compound(s) in Cephalotaxus fortunei twigs and leaves with activity against plant-parasitic nematodes. A crude alkaloid extract, particularly drupacine, was responsible for much of the nematotoxicity. The ED50 of drupacine for Bursaphelenchus xylophilus was 27.1 µg mL⁻¹, and for Meloidogyne incognita it was 76.3 µg mL⁻¹. Immersion of M. incognita eggs in 1.0 mg mL⁻¹ crude alkaloid extract (the highest tested concentration) reduced hatch by 36%; immersion of second-stage juveniles (J2) resulted in 72-98% immobility. Crude alkaloid extract and drupacine suppressed protease activity in extracts of the microbivorous nematode Panagrellus redivivus by 50% and 80%, respectively. Application of 0.02-0.5 mg mL⁻¹ crude alkaloid extract to soil with M. incognita inoculum did not significantly reduce pepper plant shoot length or weight, compared with nematode-inoculated, water-treated controls, but the number of eggs and J2 per root system respectively decreased by 69% and 73% at 0.5 mg mL⁻¹. Drupacine and a crude alkaloid extract suppress nematode hatch, activity of mixed life stages, and population numbers on plant roots. This is the first demonstration of nematotoxicity of crude Cephalotaxus alkaloids and drupacine.

First Report of Leaf Spot Caused by Corynespora cassiicola on Baphicacanthus cusia in China.

Baphicacanthus cusia is a perennial herbaceous plant in the family Acanthaceae that is native to China, where it grows in warm temperate mountainous or hilly regions. It is commonly used as a Chinese herbal medicine. In March 2012, symptoms of leaf spot were observed on leaves of B. cusia in Long'an County, Guangxi, China, where this plant is extensively cultivated. Symptoms were initially small brown dots which developed into irregular to circular leaf spots. These spots enlarged and overlapped, extending until the 7- to 9-cm-long and 3- to 4-cm-wide leaves withered entirely, mostly within 2 months. On potato dextrose agar (PDA), the same fungus was cultured from 92% of 75 symptomatic leaf samples that had been surface sterilized in a 45-second dip in 0.1% mercuric chloride. Fungal structures were observed on diseased leaves: conidiophores (85 to 460 × 4 to 8 μm) were erect, brown, single or in clusters, and conidia (36 to 90 × 5 to 16 μm) were single or in chains of two to four, brown, cylindrical or obclavate, straight or slightly curved, with 3 to 18 pseudosepta and a conspicuous hilum. Three single-spore isolates were identified as Corynespora cassiicola (Berk & Curt.) Wei based on morphological and cultural characteristics (1). The rDNA internal transcribed spacer (ITS) region of one isolate, ZY-1, was sequenced (GenBank Accession No. JX908713), and it showed 100% identity to C. cassiicola, GenBank FJ852716, an isolate from Micronesia cultured from Ipomoea batatas (2). Pathogenicity tests were performed with each of the three isolates by spraying conidial suspensions (5 × 104 conidia/ml) containing 0.1% Tween 20 onto the surfaces of leaves of 60-day-old, 20-cm tall plants. For each isolate, 30 leaves from five replicate plants were treated. Control plants were treated with sterilized water containing 0.1% Tween 20. All plants were incubated for 36 h at 25°C and 90% relative humidity in an artificial climate chamber, and then moved into a greenhouse. Seven days after inoculation, dark brown spots typical of field symptoms were observed on all inoculated leaves, but no symptoms were seen on water-treated control plants. Koch's postulates were fulfilled by reisolation of C. cassiicola from diseased leaves. To our knowledge, this is the first report of C. cassiicola infecting B. cusia worldwide.

Evaluation of oxidative stress in rats treated subchronically with ethanol

PURPOSE: The aim of the present study was to evaluate the oxidative stress in male Wistar rats treated subchronically with ethanol. MATERIAL AND METHODS: Ethanol was applied orally for 45 days. The daily dose of 7.9 g/kg as a 20% solution was divided in two equal treatments. Oxidative stress was evaluated by the concentration of thiobarbituric acid reacting substances (TBARS), markers of lipid peroxidation. TBARS were determined in rat serum, liver, kidneys, brain and testes. RESULTS: Ethanol-induced toxicity was evidenced by a significantly lower (p<0.001) weight gain of ethanoltreated rats in comparison with distilled water-treated controls. TBARS in ethanol-treated rats were significantly increased (p<0.05) in serum (59.33±7.5 nmol/mL vs the control value of 41.55±3.9 nmol/mL) and in testes (123.98±13.5 nmol/g vs the control value of 89.25±7.5 nmol/g). They were, however, not significantly elevated in the liver, kidneys and brain. This effect in the liver was consistent with the insignificant elevation of liver enzymes in the serum of ethanol-treated rats. CONCLUSION: The results from this study showed that in ethanol-treated rats, lipid peroxidation products were mostly increased in serum and testes as well the latter being more exposed to oxidative stress than other organs examined such as liver, kidneys and brain. Scripta Scientifica Medica 2013; 45(1): 35-39.

Effects of Harpin protein on fruit quality and shelf life of winter jujube (Ziziphus jujuba Mill. cv. Dongzao)

The effects of HarpinXoo protein on fruit quality and shelf life of jujube (Ziziphus jujuba Mill. cv. Dongzao) were investigated in this study. Compared with water-treated control, spraying the winter jujube trees with HarpinXoo protein at 20 μg ml− 1 effectively improved the good fruit rate by 158.5%, significantly reduced the softening fruit rate by 54.6%, turning red index by 70.2% and rotten index by 89.1%, and depressed respiration rate by 45.5% and ethylene production by 48.7% after fruit had been stored for 80 days, resulting in effective extension of the postharvest life of fruit. Moreover, HarpinXoo protein treatment was beneficial for maintaining the quality of jujube fruit stored at 0°C, promoting the formation and retarding the decline of soluble sugar and vitamin C contents of fruit, which are important parameters of fruit quality during storage. After fruit had been stored for 80 days, the soluble sugar and vitamin C contents of treated fruit were more than twice those of control fruit. HarpinXoo protein has potential value for maintaining quality and extending the postharvest life of winter jujube fruit.

First Report of Pitch Canker Disease Caused by Rhizosphaera kalkhoffii on Pinus sylvestris in China.

In November 2010, pitch canker disease was first discovered on Pinus sylvestris var. mongolica Litv. from Daxinganling region in Inner Mongolia Province, China, resulting in severe dieback and bark cracking on the host, accompanied by resin flowing profusely from cankers on the infected branches, cones, and trunks (2). The early stage symptoms consisted of sunken cankers, reddish-brown needles on infected twigs followed by heavy resin soaking of the wood as the disease progressed. Pieces of pitch-soaked wood (3 × 3 mm2) cut from cankerous tissue on branches were surface-sterilized with 0.4% NaOCl for 2 min and then rinsed twice in sterile distilled water. The fragments were placed on potato dextrose agar and incubated at 28°C in the dark. After 7 to 8 days, this process consistently yielded cultures with whitish, dense, aerial mycelium that later darkened to gray. Microconidia were single, oblong to cylindrical, aseptate, and 4 to 10 × 2 to 4 μm. Macroconidia were hyaline, 1- to 2-septate, oblong to cylindrical, with tiny papillae at both ends, and 10 to 13 × 2 to 5 μm, fitting the description of Rhizosphaera kalkhoffii (1). To verify the identification based on morphological features, the internal transcribed spacer (ITS) region of the ribosomal RNA genes was amplified using primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) according to the published protocol (3), and then sequenced and compared to the GenBank database through BLAST search. Comparison of the sequences revealed 98% homology to R. kalkhoffii (EU700375.1 and EU700376.1). Representative sequences of R. kalkhoffii (JQ353721 and JQ353722) were deposited in GenBank. The pathogenicity of two representative isolates of R. kalkhoffii was also confirmed by spraying 40 μl of conidial suspension (4.6 × 106 conidia/ml) on the bark surface of 20 2-year-old healthy pine seedlings, wounded by scratching with a sterilized knife. Sterile distilled water sprays were used for the controls. Within 4 to 8 weeks after inoculation, 90% of inoculated P. sylvestris exhibited symptoms of pitch cankers around the inoculation site similar to those on the original infection. R. kalkhoffii was consistently reisolated from all inoculated plants but not from water-treated controls, fulfilling Koch's postulates. R. kalkhoffii have previously been documented as pathogens of needle blight of Picea pungens (1). To our knowledge, this is the first report of R. kalkhoffii as a pathogen on Pinus sylvestris in China, and furthermore, pitch canker disease is currently listed as a quarantine disease in China, increasing the significance of this report.

Acute bioenergetic intervention or pharmacological preconditioning protects neuron against ischemic injury

Although acute ischemic stroke has high mortality and morbidity rate but yet still has very limited treatment. In this study we have tested the concept of neuron protection by acute bioenergetic intervention or by pharmacological preconditioning with natural antioxidants. Adenosine triphosphate (ATP), pentobarbital, and suramin were encapsulated in pH-sensitive liposomes and used as bioenergy stabilizer. We induced ATP depletion model by incubating cells with media added with ATP-depleting agents for 2 hours. Treatment with bioenergy stabilizer started 10-min post inducing of ATP-depletion. The acute treatment with bioenergy stabilizer significantly increased cell viability in neuro-2a cells. In searching for a pharmacological preconditioning candidate for reducing ischemic injury, we tested cocoa-derived flavanols using bilateral common carotid artery occlusion (BCCAO). We pretreated mice with cocoa-derived flavanols (75 mg/kg) or water orally for 7 days and subjected mice for 12 minutes BCCAO. At 7 days post-ischemia, the number of surviving hippocampal CA1 neurons was significantly higher in the treated mice than in the water-treated controls. The protection from cocoa-derived flavanols was found associated with increased total antioxidant capacity in the brain. Our results indicate that for reducing acute ischemic injury bioenergetic intervention using advanced drug delivery tools is conceptually feasible, and for reducing reperfusion related secondary injury pharmacological preconditioning may provide significant protection.

ISR meets SAR outside: additive action of the endophyte Bacillus pumilus INR7 and the chemical inducer, benzothiadiazole, on induced resistance against bacterial spot in field-grown pepper.

Induced resistance has been recognized as an attractive tool for plant disease management in modern agriculture. During the last two decades, studies on chemically- and biologically elicited induced resistance have revealed previously unknown features of the plant defense response including defense priming. As a biological trigger for induced resistance, plant growth-promoting rhizobacteria (PGPR) are a group of root-associated bacteria that can reduce plant disease severity and incidence, and augment plant growth and yield under greenhouse and field conditions. We evaluated the potential of an endophytic PGPR, Bacillus pumilus INR7, to induce systemic resistance against bacterial spot caused by Xanthomonas axonopodis pv. vesicatoria in pepper. Trials in the greenhouse showed significantly less symptom development in pepper plants inoculated with strain INR7 compared to a water treatment. Furthermore, a single dipping treatment with INR7 before transplantation of pepper plants into the field elicited an induced systemic resistance response against bacterial spot caused by artificially infiltration of X. axonopodis pv. vesicatoria and even against naturally occurring bacterial spot disease. We identified an additive effect on induced resistance after administration of a combination treatment composed of strain INR7 with a chemical inducer, benzothiadiazole (BTH) in the field. The combination treatment stimulated expression of pepper defense marker genes CaPR1, CaTin1, and CaPR4 to a greater extent than did treatment with either agent alone. Similar experiments conducted with tobacco revealed no additive effects under field conditions. Interestingly, co-application of plants with INR7 lifted the growth repressing effect of BTH. Application of BTH onto pepper and tobacco did not affect rhizosphere colonization but supported a higher population density inside plant roots when compared to water-treated control plants. Our results indicate that PGPR can be used in combination with BTH for increased induced resistance capacity under field conditions.

Activation of tomato plant defence responses against bacterial wilt caused by Ralstonia solanacearum using DL-3-aminobutyric acid (BABA)

In this study, we investigated the ability of DL-3-aminobutyric acid (BABA) to protect tomato against bacterial wilt caused by Ralstonia solanacearum. This was combined with studies of accumulation of total phenolic compounds, free and total salicylic acid (SA), and activity of enzymes related to plant defence, i.e., polyphenol oxidase (PPO) and catalase (CAT). Under greenhouse conditions, tomato plants pre-treated by soil drenching with BABA profoundly reduced disease severity of bacterial wilt compared to plants receiving a soil drench with water. Thus, BABA reduced leaf wilting index by 75.3 % and vascular browning index by 69.9 %, without any in vitro inhibitory activity on the pathogen. BABA treatment significantly reduced the population of R. solanacearum in stems of tomato plants and additionally also significantly increased both fresh and dry weight of roots and shoots of tomato plants compared with the inoculated control. Application of BABA resulted in a high increase in PPO activity both in plants with and without inoculation. Compared to water-treated plants, treatment with BABA also induced a significant increase of total phenolic compounds as well as of free and total SA in leaves of both inoculated and non-inoculated tomato plants at all sampling times. CAT activity decreased in tomato plants treated with BABA in comparison with the water-treated control plants and the decrease in activity correlated with an increasing total SA accumulation. These findings suggest that BABA treatment resulted in induction of resistance to bacterial wilt in tomato.

An antibiotic fusaricidin: a cyclic depsipeptide from Paenibacillus polymyxa E681 induces systemic resistance against Phytophthora blight of red-pepper

In this study fusaricidin, a cyclic depsipeptide isolated from Paenibacillus polymyxa E681 (E681), was demonstrated to control Phytophthora blight infection caused by Phytophthora capsici in red-pepper. The minimal inhibitory concentration (MIC) of fusaricidin was found to be 16 ppm against P. capsici. The disease severity of P. capsici was 40% at 0.1 ppm of fusaricidin when compared with water-treated control (81.7%) on post-treatment, whereas the disease severities on pre-treatment were 45% and 83.3% in fusaricidin (0.1 ppm) and water-treated control, respectively, in red-pepper plants. Significant (P < 0.05) disease suppression was observed on treatment with fusaricidin (0.1 ppm) by foliar spray and soil drench. The disease severity was drastically reduced to 3.3% by soil drench of fusaricidin (1.0 ppm), whereas in water-treated control, the disease severity was 83.3% in the first experiment. Fusaricidin at 0.1 ppm reduced disease severity of P. capsici to 27.5% when compared with positive control (43.1%) and water-treated control (66.2%) in the second experiment. Soft rot disease in tobacco was suppressed upon treatment with fusaricidin at 1.0 ppm by leaf infiltration. RT-PCR analyses of Arabidopsis thaliana revealed that there was an up-regulation of pathogenesis-related (PR) gene expression in wild type A. thaliana (Col-0), while there was no accumulation of PR genes, which implies that the mechanism of protection might be based on a salicylic acid-dependent pathway. This is the first report that fusaricidin exhibits protection against plant pathogens in addition to activity as an antibiotic agent. Hence, E681 can play a role in plant protection by secretion of ISR elicitors including fusaricidin.

Screening of several disinfectants to assess their efficacy in controlling mycelia growth, sporangia germination, and recovery of viable Phytophthora ramorum

Phytophthora ramorum is the causal agent of sudden oak death, a very serious disease that causes dieback and death of several important forest species in the USA. It was recently associated with a destructive disease of larch in the United Kingdom. The pathogen has a wide host range including ornamentals such as Rhododendron and Viburnum, and has been recovered from nursery soil samples. Diligent use of effective disinfectants in nurseries can contribute to integrated management strategies for P. ramorum. Nine disinfectants, some at different concentrations and duration, were evaluated in vitro and in vivo for their efficacy in controlling the growth of P. ramorum mycelia and the germination of sporangia. Chemprocide® (1.35%), PerCept™ (diluted 1:16) and 15% bleach treatments were the most consistent in their effectiveness for inhibiting both mycelia growth and sporangia germination. Chemprocide® (1.35%) and 10% bleach treatments were effective also for preventing P. ramorum recovery from contaminated plastic plant saucers and metal surfaces. Isolates representing the three clonal lineages (EU1, NA1, and NA2) of P. ramorum were included in all studies. Interestingly, 10 min treatments of ethanol (70% or 95%) were effective in preventing colony forming unit (CFU) growth, but were not as effective for preventing mycelia growth. Ethanol treatments for 5 min were among the least effective, and in every case was not significantly different from the water-treated controls. Concentration and treatment time were critical factors influencing efficacy in these studies. Differences in CFU production were observed among the clonal lineages with a high of 18 ± 1.19 (n = 66) for EU1 isolates, and a low of 9.0 ± 0.89 (n = 74) for NA2 isolates.

P.1.g.017 Gender differences in rats: behavioural and electrophysiological aspects

Pfiesteria piscicida is an estuarine dinoflagellate involved with fish kills along the east coast of the United States. We previously documented a radial-arm maze learning deficit in rats exposed to Pfiesteria that may be related to cognitive deficits seen in humans after accidental Pfiesteria exposure. The current study elucidated important behavioral parameters of this deficit. There were six dose groups. Forty (10/group) adult female Sprague–Dawley rats were injected (SC) with a single dose of Pfiesteria taken from aquarium-cultured Pfiesteria (35,600, 106,800, or 320,400 Pfiesteria cells/kg of rat body weight or a cell-free filtrate of the 106,800 cells/kg dose). One control group (N = 10) was injected with saline and one (N = 10) with aquarium water not containing Pfiesteria. Half of the rats in each group were tested on an 8-arm radial maze in a standard test room, and the other half were tested on the radial maze in a sound-attenuating chamber. In the standard maze room, there was a significant effect of Pfiesteria (p < 0.05) impairing choice accuracy improvement over the first six sessions of training among rats administered 106,800, 320,400, and the 106,800 cells/kg filtered sample. In contrast, there was no indication of an effect of Pfiesteria when the rats were tested on the same configuration radial maze in the sound-attenuating chamber. After 18 sessions of training in one room, the rats were switched for six sessions of testing in the other room and finally were switched back to their original room for three sessions. There was a significant Pfiesteria-induced deficit when the rats were tested in the standard test room but not when they were tested in the sound-attenuating chamber. When the Pfiesteria-exposed rats were initially switched from the sound-attenuating chamber to the standard test room they performed significantly worse than controls, whereas Pfiesteria-treated rats switched from the standard test room to the sound-attenuating chamber did not perform differently from controls. These results suggest that the Pfiesteria-induced learning impairment may result from the negative impact of distracting stimuli. At the time of the learning impairment, no overt Pfiesteria-related effects were seen using a functional observational battery and no overall response latency effects were seen, indicating that the Pfiesteria-induced choice accuracy deficit was not due to generalized debilitation. In the initial use of the figure-8 maze in this line of research, the rats in the same Pfiesteria treatment groups that showed significant deficits in the radial-arm maze showed greater declines in activity rates in a 1-h figure-8 locomotor activity test. Both the 106,800 and 320,400 Pfiesteria cells/kg groups showed significantly greater linear trends of activity decline relative to tank water-treated controls. This reflected an initial slight hyperactivity in the Pfiesteria-treated animals followed by a decrease to control levels. Pfiesteria effects in the figure-8 maze and in early radial-arm maze training may be useful in a rapid screen for identifying the critical toxin(s) of Pfiesteria in future studies. Published by Elsevier Science Inc.

Leucine accelerates blood ethanol oxidation by enhancing the activity of ethanol metabolic enzymes in the livers of SHRSP rats

Chronic ethanol consumption induces liver diseases, such as alcoholic hepatitis and cirrhosis. The enhancement of alcohol oxidation is important in the prevention of these liver diseases. Chronic supplementation with branched chain amino acids (BCAAs) prevents liver cirrhosis. Therefore, BCAAs may be associated with enhanced ethanol oxidation. To evaluate this hypothesis, we investigated the effect of the administration of individual BCAAs on ethanol oxidation and changes in alcohol-metabolizing enzyme activities following acute alcohol intake in rats. Blood ethanol concentrations and the activities of alcohol-metabolizing enzymes, such as alcohol dehydrogenase (ADH) and low and high Km aldehyde dehydrogenase (ALDH), were measured in the liver following acute ethanol administration in rats; the ethanol was administered 30 min after the treatment with amino acids [such as leucine (Leu), isoleucine (Ile), valine (Val) or alanine (Ala)]. Leu significantly decreased the blood ethanol concentration 1 h after ethanol administration compared to the water-treated control (C) [C 0.46 ± 0.09, Leu 0.18 ± 0.04, Ile 0.27 ± 0.09, Val 0.46 ± 0.1, Ala 0.43 ± 0.06, mean ± SEM (g/l), P < 0.05]. In addition, leucine significantly stimulated ADH activity 30 min after ethanol intake [C 0.042 ± 0.014, Leu 0.090 ± 0.016, Ile 0.042 ± 0.008, Val 0.022 ± 0.010, Ala 0.070 ± 0.016, mean ± SEM (unit/mg protein), P < 0.05] and low Km ALDH activity 15 min after ethanol intake [C 0.51 ± 0.63, Leu 3.72 ± 0.66, Ile 1.26 ± 0.89, Val: ND, Ala 1.86 ± 1.57, mean ± SEM (unit/mg protein), P < 0.05]. However, leucine and its metabolite α-keto-isocaproic acid did not enhance ethanol clearance in isolated rat hepatocytes. These results indicate that leucine accelerates ethanol oxidation by indirectly enhancing ADH and low Km ALDH activities in the liver.

FTY720 Markedly Increases Alloengraftment but Does Not Eliminate Host Anti-Donor T Cells that Cause Graft Rejection on Its Withdrawal

The immunomodulator FTY720 (FTY) is beneficial in models of graft-versus-host disease, solid organ transplantation, and autoimmunity and has been approved for use in patients with multiple sclerosis. FTY modifies the homing and migration of many cell types. We report that FTY has profound positive and negative effects on allogeneic bone marrow (BM) engraftment in sublethally irradiated recipients. FTY increased donor hematopoietic progenitors in the BM, resulting in high donor engraftment in the B cell, myeloid cell, and natural killer cell, but not T cell, lineages. Donor T cell progenitors within the thymus of FTY-treated recipients were dramatically reduced, resulting in a lack of donor T cell reconstitution. In addition to preventing the ingress of donor (and host) T cell progenitors, FTY prevented the egress of fully functional host CD4+CD8- and CD4-CD8+ thymocytes that on cessation of FTY administration were able to exit from the thymus and contribute to a rapid and complete rejection of a well-established donor BM graft. When used in combination with anti-CD40L mAbs to block the CD40L:CD40 costimulatory pathway, FTY markedly enhanced anti-CD40L mAb-mediated alloengraftment promotion. In contrast to FTY alone, the combination of anti-CD40L mAb and FTY resulted in a surprisingly stable, multilineage, long-term donor chimerism. These data illustrate FTY's profound migration modulating effects and suggest a use in combinatorial therapy in achieving stable alloengraftment under nonmyeloablative conditions.