Blood Samples Of Volunteers Research Articles

Effects of extracellular calcium concentration on platelets aggregation, coagulation indices and thromboelastography

To detect the effect of extracellular Ca2+ concentrations on test results of coagulation-related parameters. Blood samples of outpatient medical volunteers were collected and then different doses of calcium chloride added. The rate of platelet aggregation (n = 42), prothrombin time (PT), thrombin time (TT) and activated partial thromboplastin time (APTT) (n = 21) and parameters of thromboelastography (n = 30) were detected according to the standard protocols by plasma turbidimetry, coagulation and recalcification respectively. When the plasma Ca2+ concentration was in the range of 0.1 - 33.7 mmol/L, the rate of platelet aggregation gradually increased with a increasing concentration of Ca2+. And the rates induced by adenosine diphosphate (ADP) and arachidonic acid (AA) were (51.8 +/- 9.6)% - (94.7 +/- 4.8)% and (64.4 +/- 12.2)% - (93.2 +/- 5.5)% respectively. When the Ca2+ concentration was 39.0 mmol/L, the rate decreased markedly [ADP (9.1 +/- 5.3)%, AA (11.1 +/- 4.5)%, both P < 0.01]. When the Ca2+ concentration was in the range of 0.1 - 33.7 mmol/L, the values of PT gradually increased with a increasing concentration of Ca2+. The values of TT changed in "V"-type and became minimum when the calcium concentration was 4.4 mmol/L. The values of APTT decreased with higher calcium concentrations and could not be determined when the concentration increased above 0.5 mmol/L. When the Ca2+ concentration was in the range of 0.4 - 27.3 mmol/L, the values of reaction time and coagulation time of thromboelastography changed in "V"-type and became nearly minimal at the Ca2+ concentration of about 2.1 mmol/L. The values of alpha angle and maximum amplitude changed in "V"-type and became maximal at the Ca2+ concentration of 2.1 mmol/L. The effect of Ca2+ concentration on the testing results of coagulation-related parameters is significant. A high calcium ( > or = 39 mmol/L) can inhibit the platelet aggregation, coagulation factor activity and blood coagulation. The Ca2+ concentration of 2.1 mmol/L seems to be the optimal concentration for thromboelastography by recalcification method.

Differential regulation of redox proteins and chaperones in HbEβ‐thalassemia erythrocyte proteome

In (hemoglobin, Hb) HbEβ-thalassemia, HbE (β-26 Glu→Lys) interacts with β-thalassemia to produce clinical manifestation of varying severity. This is the first proteomic effort to study changes in protein levels of erythrocytes isolated from HbEβ-thalassemic patients compared to normal. We have used 2-DE and MALDI-MS/MS-based techniques to investigate the differential proteome profiling of membrane and Hb-depleted fraction of cytosolic proteins of erythrocytes isolated from the peripheral blood samples of HbEβ-thalassemia patients and normal volunteers. Our study showed that redox regulators such as peroxiredoxin 2, Cu-Zn superoxide dismutase and thioredoxin and chaperones such as α-hemoglobin stabilizing protein and HSP-70 were upregulated in HbEβ-thalassemia. We have also observed larger amounts of membrane associated globin chains and indications of disruption of spectrin-based junctional complex in the membrane skeleton of HbEβ-thalassemic erythrocytes upon detection of low molecular weight fragments of β-spectrin and decrease in β-actin and dematin content. We have observed interesting changes in the proteomic levels of redox regulators and chaperons in the thalassemic hemolysates and have observed strong correlation or association of the extent of such proteomic changes with HbE levels. This could be important in understanding the role of HbE in disease progression and pathophysiology.

Pharmacokinetics of Ethinylestradiol and Levonorgestrel after Administration of Two Oral Contraceptive Preparations

Serum concentration profiles and pharmacokinetic parameters (cmax, tmax, AUC24, AUC0-00, MRT) of ethinylestradiol (EE2) and levonorgestrel (LNG) were obtained following administration of two combined oral contraceptives. The constituents of the preparations were as follows: Gravistat (0.05 mg EE2, 0.125 mg LNG); Minisiston (0.03 mg EE2, 0.125 mg LNG). In 20 of the volunteers blood samples were taken before and up to 36 hours following the intake of a single table. In 11 women the investigation was carried out at day 21 of a treatment cycle (steady-state condition). In spite of pronounced interindividual variations of the pharmacokinetic data, a clear dependency of EE2 concentration curves on the estrogen dose of the respective preparation could be demonstrated. Under the condition of steady-state (21st day of administration) there was a slight but significant rise of the EE2 peak serum concentrations and a pronounced increase of the LNG levels, closely reflected by elevation of the AUC values. SHBG serum concentration was significantly increased by the 10th day of treatment in all subjects receiving Gravistat, whereas the mean value in the Minisiston-group did not remarkably change. Although LNG is known to be bound to SHBG with high affinity, the missing parallelism between LNG- and SHBG-concentrations suggests other (additional?) mechanisms for the elevated LNG-binding capacity in women taking combined EE2-LNG preparations.

Validation of INAA and AAS analysis protocols for whole blood: A study on cardiovascular and malignant hypertensive patients

Instrumental neutron activation analysis (INAA) and atomic absorption spectrophotometry (AAS) were used to verify the protocols for the quantification of zinc and magnesium in human whole blood. A study was conducted on group of volunteers consisting of 131 patients having cardiovascular diseases (CVD) and 23 malignant hypertension (MH) patients along with 432 control subjects with 218 male and 214 females. The elemental data of these elements has been exploited to establish the base line values in control subjects. The possibility of any relationship between blood Mg and Zn levels with CVD and MH has also been investigated. The mean blood Mg and Zn levels were found to be depleted in both CVD and MH patients as compared to normal subjects. In our findings Mg and Zn were found to have an inverse relation with systolic and diastolic pressure. The reliability of the methods was checked by the concurrent analysis of the IAEA reference material (RM) employing the optimized INAA and AAS protocols. The determined values by both techniques were found to be in good agreement with the IAEA reference values. The elemental data in whole blood samples of normal volunteers has also been compared with Mg and Zn contents reported by other countries.

4β‐Hydroxycholesterol as an endogenous marker for CYP3A4/5 activity. Stability and half‐life of elimination after induction with rifampicin

The oxysterol 4beta-hydroxycholesterol has been suggested as a marker for CYP3A4/5 activity. We have previously shown that plasma 4beta-hydroxycholesterol continues to increase for several weeks after maximal induction of CYP3A4/5 by carbamazepine at the dose given. In the present study we aimed to determine the time course of the decrease in plasma 4beta-hydroxycholesterol after termination of induction of CYP3A4/5 by rifampicin. An additional aim was to determine the variation in plasma level of 4beta-hydroxycholesterol with time in 12 untreated healthy volunteers. Twenty-four healthy subjects were allocated into three study groups of equal sizes. The volunteers were treated with rifampicin (either 20 mg day(-1), 100 mg day(-1) or 500 mg day(-1)) for 2 weeks. Blood samples were taken before, during and after rifampicin treatment. In another group of 12 untreated volunteers blood samples were collected at different time points in order to determine the intraindividual variations in plasma 4beta-hydroxycholesterol concentrations. Plasma levels of 4beta-hydroxycholesterol were determined by isotope-dilution gas chromatography-mass spectrometry. Rifampicin treatment increased plasma 4beta-hydroxycholesterol levels. After termination of rifampicin treatment plasma levels of 4beta-hydroxycholesterol decreased slowly with an apparent half-life of 17 days. The intraindividual variation in plasma levels of 4beta-hydroxycholesterol in untreated subjects was low, with coefficients of variation of between 4.8 and 13.2% over a period of 3 months. After termination of induction of CYP3A4/5, plasma 4beta-hydroxycholesterol levels decreased slowly during 8 weeks. The half-life of elimination (17 days) resembled that of cholesterol rather than other oxysterols. The long half-life results in stable plasma concentrations with time.

Prognostic role of circulating melanoma cells detected by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA in patients with melanoma

A need for factors predictive of prognosis is present in patients who are diagnosed with malignant melanoma. The detection of circulating melanoma cells by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA is a possible negative prognostic factor. The aim of this study was to assess the prognostic value of reverse transcriptase-PCR for tyrosinase mRNA in peripheral blood samples. From January 2000 to February 2003, duplicate blood samples were drawn from 114 melanoma patients following surgery and informed consent, and were tested with reverse transcriptase-PCR, for tyrosinase mRNA. Outer primers for the first PCR were R1 (sense): TTGGCAGATTGTCTGTAGCC and R2 (antisense): AGGCATTGTGCATGCTGCT. For the second round of PCR, nested primers were R3 (sense): GTCTTTATGCAATGGAACGC and R4 (antisense): GCTATCCCAGTAAGTGGACT. Threshold for detection of the technique was determined by adding serially diluted MelJuSo cells to healthy volunteer blood samples. Overall, 91 (79.1%) patients tested negative for tyrosinase mRNA and 24 (20.9%) tested positive. The number of patients who tested positive by stage was 3/38 (7.9%) for stage I, 3/22 (13.6%) for stage II, 5/30 (16.7%) for stage III and 13/24 (54.2%) for stage IV (P< 0.0001). 11/90 (12.2%) patients with no evidence of disease (stage I, II and III) tested positive and 13/24 (54.2%) patients with clinically confirmed distant metastases (stage IV) tested positive (P<0.00001). With median follow-up of 372 days or to death (range: 0-1303 days), median progression-free survival has not been reached for tyrosinase-negative patients and was 265 days for tyrosinase-positive patients (P<0.00001, log-rank test=21.07). Median overall survival was 344 days for tyrosinase-positive patients and has not been reached for tyrosinase-negative patients (P=0.0001, log-rank test=21.38). Stage, Breslow thickness and result of RT-PCR were significant prognostic factors for disease-free survival in a multivariate analysis, and stage was the only significant prognostic factor for overall survival. In conclusion, detection of circulating melanoma cells by reverse transcriptase-PCR for tyrosinase mRNA is a significant adverse prognostic factor for disease-free survival in patients with malignant melanoma.

Effect of Drotrecogin alfa (activated) on platelet receptor expression in vitro

Thrombocytopenia is a common problem in critically ill patients, which is associated with increased mortality. Recently, Drotrecogin alfa (activated) (recombinant human activated protein C (APC)) was shown to reduce mortality in patients with severe sepsis. Only minimal effect of APC on coagulation markers was demonstrated. Nevertheless, low platelet count was identified as a risk factor for bleeding with use of this drug. We conducted this study to evaluate possible influence of APC on in vitro expression of platelet receptors at therapeutic and supra-therapeutic concentrations. Blood samples of volunteers and patients with severe sepsis were adjusted with APC to final concentrations of 0.045 µg mL−1 APC (APC-45, therapeutic dose) and 0.225 µg mL−1 APC (APC-225, five-fold therapeutic dose), respectively. The activation of platelets was mediated by two different agonists. APC had no significant influence on platelet activation, with or without stimulation at both concentrations. In group APC-225, CD62P showed a non-significant decrease. This in vitro study demonstrates that therapeutic plasma concentrations of Drotrecogin alfa (activated) have neither influence on expression of platelet activation markers nor on platelet-granulocyte complexes in blood of volunteers and patients with severe sepsis. Thus, a direct drug-platelet interaction seems unlikely.

Problems in blood alcohol testing of severely injured drivers brought to emergency departments in Japan

Breath alcohol tests are widely used to control DUI (driving under the influence) in Japan. However, this test is not applied to injured drivers transported to emergency hospitals. In such cases, BAC (blood alcohol concentration) testing should be done to prove DUI. In this paper, we tried to clarify two important issues on the BAC testing in Japan using a questionnaire survey and experiments about contamination of antiseptic ethanol. First, we have described the doctor's dilemma with DUI cases; our present questionnaire survey showed that the police often request the doctor to volunteer blood samples of the suspected drunk drivers brought to emergency hospitals since they have not been granted the right to order blood sampling in Japan. Then, doctors face a serious dilemma whether comply with the police request or not, resulting in widely different responses. Secondly, we have estimated the effects of antiseptic ethanol routinely used as a dermal antiseptic on the BAC tests. Our present experiments showed that uptake of ethanol can occur under certain conditions. Given the actual conditions outlined in the questionnaire, there seem to be a definite risk of ethanol contamination in BAC testing. Obviously, the time has come to discuss problems in BAC testing of injured drivers brought to emergency hospitals in Japan.

Are serum S100β proteins and neuron-specific enolase predictors of cerebral damage in cardiovascular surgery?

Objective: To examine whether serum concentrations of S100β protein and neuron-specific enolase (NSE) are predictors of cerebral damage in cardiovascular surgery. Design: Prospective clinical study. Setting: University hospital. Participants: Eighteen patients with conventional cardiopulmonary bypass (CPB), 7 with selective cerebral perfusion (SCP), and 3 volunteers (blood samples). Interventions: None. Measurements and Main Results: S100β and NSE were measured in the blood obtained at 7 time points during and after operation. The concentrations of these markers in the blood from the surgical field and the cell-saver device, and the influence of graded hemolysis (in vitro) on the concentrations of these proteins were also examined. The mean values of S100β in the CPB group (2.08 ± 2.00 ng/mL) and the SCP group (1.46 ±0.77 ng/mL) were highest after aortic declamping and after termination of SCP, respectively. The mean values of NSE in the CPB group (29.1 ± 14.0 ng/mL) and the SCP group (31.2 ± 13.6 ng/mL) were highest after termination of CPB and at the end of the operation, respectively. Three patients suffered from cerebral complications, but the elevation of these markers during operation was indistinguishable from those in the other patients. Peak concentrations of S100β protein in the CPB group and NSE in the SCP group were correlated with the duration of aortic cross-clamping and CPB, respectively. S100β protein and NSE concentrations in the blood from the surgical field were significantly larger than those in arterial blood, whereas the concentrations in the blood in the cell-saving device were not elevated. The concentration of S100β protein was not influenced by the extent of hemolysis, whereas NSE concentration was markedly elevated by hemolysis. Conclusion: A large part of the increases in S100β protein and NSE during CPB and SCP is not attributed to neuronal damage, but to contamination with the blood from the surgical field. To determine whether these markers are useful to predict neurologic complications, it will be necessary to exclude contamination from the surgical field as observed in the present study. Copyright 2003, Elsevier Science (USA). All rights reserved.

The activated clotting time can be used to monitor the low molecular weight heparin dalteparin after intravenous administration

ObjectivesThis study was designed to compare the dose response of dalteparin versus unfractionated heparin (UFH) on the activated clotting time (ACT), and to determine whether the ACT can be used to monitor intravenous (IV) dalteparin during percutaneous coronary intervention (PCI). BackgroundThe use of low molecular weight heparin (LMWH) during PCI has been limited by the presumed inability to monitor its anticoagulant effect using bedside assays. MethodsThis study was performed in three phases. In vitro, ACTs were measured on volunteer (n = 10) blood samples spiked with increasing concentrations of dalteparin or UFH. To extend these observations in vivo, ACTs were then measured in patients (n = 15) who were sequentially treated with IV dalteparin and then UFH. Finally, a larger monitoring study was undertaken involving patients (n = 110) who received dalteparin 60 or 80 international U (IU)/kg alone or followed by abciximab. We measured ACT (Hemochron), activated partial thromboplastin time (aPTT), plasma anti-Xa and anti-IIa levels, tissue factor pathway inhibitor (TFPI) concentration, and plasma dalteparin concentration. ResultsDalteparin induced a significant rise in the ACT with a smaller degree of variance as compared to UFH. Five min after administration of IV dalteparin 80 IU/kg the ACT increased from 125 s (122 s, 129 s) to 184 s (176 s, 191 s) (p < 0.001). The aPTT, anti-Xa and anti-IIa activities, and TFPI concentration also demonstrated significant increases following IV dalteparin. ConclusionsThe ACT and aPTT are sensitive to IV dalteparin at clinically relevant doses. These data suggest that the ACT may be useful in monitoring the anticoagulant effect of intravenously administered dalteparin during PCI.

Determination of 5-methoxypsoralen in human serum

A high performance liquid chromatography with fluorometric and ultraviolet detection described to quantify 5-methoxypsoralen (5-MOP) percutaneous absorption in humans after the application of an essential oil, as well as 5-MOP in bergamot oil and cosmetics by fluorometric and voltammetric measurement, respectively. A μBondapack C 18 analytical column (particle size 5 μm, 3.9×300 mm) eluted with acetonitrile–tetrahydrofuran–water (70:15:15, v/v/v) containing 0.07% trifluoroacetic acid. The quantification limits are 0.05 and 0.26 ng for 5-MOP and 5-geranoxypsoralen, respectively. For fluorometric measurement was found linear over the range 0.05–3.00 μg/ml for psoralens. Five volunteers blood samples were collected over a 2-day period were investigated before and after treatment with bergamot oil. Serum levels of 5-MOP were significantly increased from the 4 h after the application of bergamot essential oil. The hourly mean levels were significantly higher after the application of bergamot essential oil compared to baseline values.

Impact of UVA exposure on psychological parameters and circulating serotonin and melatonin

People tend to feel better after exposure to ultraviolet (UV) radiation. This study was performed to investigate the impact of UVA exposure on psychological and neuroendocrine parameters. Fifty-three volunteers were separated into 42 individuals who had UVA exposure and 11 individuals who had no UVA exposure. The UVA-exposed volunteers had irradiation sessions six times in a three-week period. All volunteers completed two questionnaires at baseline (T1) and at the end of the study (T3). For the determination of serotonin and melatonin serum levels of all volunteers blood samples were collected at baseline (T1), after the first UVA exposure (T2), and at the end of the study after the sixth exposure (T3). UVA-exposed volunteers felt significantly more balanced, less nervous, more strengthened, and more satisfied with their appearance at T3. By contrast, the controls did not show significant changes of psychological parameters. In comparison to T1 and T3, serum serotonin was significantly higher and the serum melatonin was significantly lower for the volunteers exposed to UVA at T2. Both, for exposed and non-exposed volunteers serotonin and melatonin levels did not significantly differ at T1 and T3. It remains obscure, whether the exposure to UVA or other components of the treatment were responsible for the psychological benefits observed. The changes of circulating neuroendocrine mediators found after UVA exposure at T2 may be due to an UVA-induced effect via a cutaneous pathway. Nevertheless, the positive psychological effects observed in our study cannot be attributed to circulating serotonin or melatonin.

POSSIBLE ROLE OF HUMAN GROWTH HORMONE IN PENILE ERECTION

Treatment with recombinant human growth hormone in adult patients with growth hormone deficiency increases nitric oxide and cyclic guanosine monophosphate (cGMP). We examined the functional in vitro effects of recombinant human growth hormone on tissue tension and cyclic nucleotide levels of human corpus cavernosum and detected changes in growth hormone in the cavernous and peripheral blood during different phases of penile erection. Relaxant responses of human corpus cavernosum were investigated using the organ bath technique. Tissue levels of cGMP were determined by a specific radioimmunoassay after dose dependent exposition of isolated human corpus cavernosum strips to recombinant human growth hormone. In 35 healthy potent volunteers blood samples were obtained simultaneously from the corpus cavernosum and cubital vein during different functional conditions of the penis, including flaccidity, tumescence, rigidity and detumescence. Penile erection was induced by audiovisual and tactile stimulation. Serum growth hormone was determined by an immunoradiometric assay. Recombinant human growth hormone elicited dose dependent relaxation of human corpus cavernosum strips in vitro. The relaxing potency of recombinant human growth hormone was paralleled by its ability to elevate intracellular levels of cGMP. In vivo the peripheral growth hormone serum profile of the respective penile conditions did not significantly differ from those of cavernous serum. The main increase in growth hormone to greater than 90% was determined during developing penile tumescence, followed by a transient decrease afterward. These results suggest that penile erection may probably be induced by growth hormone through its cGMP stimulating activity on human corpus cavernosum smooth muscle.

Circulating bronchoepithelial cells expressing mRNA for surfactant protein A in patients with pulmonary fibrosis

There are several unsolved clinical findings in patients with idiopathic pulmonary fibrosis (IPF); (i) predominance of fibrosis in the lower lung fields, (ii) digital clubbing, and (iii) patchy distribution of pulmonary fibrosis. To explain these unsolved problems, we hypothesized that regenerated or premature bronchoepithelial cells may circulate in the blood in patients with IPF. To prove this, we performed the reverse transcriptase-polymerase chain reaction (RT-PCR) for cytokeratin 19 (CK19) and pulmonary surfactant protein A (SPA) in peripheral blood in patients with IPF and pulmonary fibrosis associated with collagen vascular disorders. In addition, 20 patients with chronic pulmonary emphysema as a disease control and 19 normal volunteers were also evaluated for the existence of circulating bronchoepithelial cells.RT-PCR analysis showed that CK19 was expressed in 12 of 38 blood samples (31·6%) of IPF and pulmonary fibrosis associated with collagen vascular disorders, seven of 20 (35·0%) blood samples of chronic pulmonary emphysema, and four of 19 (21·1%) blood samples of normal volunteers. mRNA for SPA was positive in eight of 38 (21·1%) blood samples of IPF. In contrast, SPA expressing cells were not detected in any blood samples obtained from patients with chronic pulmonary emphysema or normal volunteers.This evidence suggests that there were some circulating bronchoepithelial cells expressing mRNA for SPA in peripheral blood of patients with IPF and pulmonary fibrosis associated with collagen vascular disorders.

Chemical analysis of human blood for assessment of environmental exposure to semivolatile organochlorine chemical contaminants.

A chemical method for the quantitative analysis of organochlorine pesticide residues present in human blood was scaled-up to provide increased sensitivity and extended to include organochlorine industrial chemicals. Whole blood samples were extracted with hexane, concentrated, and analyzed without further cleanup by gas chromatography with electron capture detection. The methodology used was validated by conducting recovery studies at 1 and 10 ng/g (ppb) levels. Screening and confirmational analyses were performed by gas chromatography/mass spectrometry on samples collected from potentially exposed residents of the Love Canal area of Niagara Falls, New York and from volunteers in the Research Triangle Park area of North Carolina for 25 specific semivolatile organochlorine contaminants including chlorobenzene and chlorotoluene congeners, hexachloro-1,3-butadiene, pesticides, and polychlorinated biphenyls as Aroclor 1260. Dichlorobenzene, hexachlorobenzene, and beta-hexachlorocyclohexane residues fell in the range of 0.1 to 26 ppb in a high percentage of both the field and volunteer blood samples analyzed. Levels of other organochlorine compounds were either non-detectable or present in sub-ppb ranges.

Percutaneous absorption of triclocarban in rat and man

The route and rate of excretion by rats of the germicide [ 14C] Triclocarban formerly called trichlorocarbanilide, given by parenteral injection has been investigated. Blood levels based radioactivity and by chemical determination after parenteral injection have been compared with those obtained after topical application of [ 14C] Triclocarban in acetone. Absorption of [ 14C] Triclocarban in soaps and in dimethylformamide (DMF) through occluded rat skin has been studied. Other soaps and a hand cleanser containing [ 14C] Triclocarban have been applied to rat skin without occlucion and the effects of duration of contract, concentration and the use of a solubilizer have been investigated. In humans, absorption of Triclocarban through skin after bathing daily for 28 days has been investigated by chemical analysis of blood and urine. The data show that elimination by the rat is rapid and complete principally via the faeces. Blood levels after parenteral injection are low and comparison of the radioactivity and chemical determinations suggest rapid metabolism of the Triclocarban. After application to the skin, blood levels based on 14C are very low. Absorption of [ 14C] Triclocarban through occluded rat skin was greater from DMF than from soaps. With non-occluded rat skin, absorption from soaps was less and was dependent on concentration but independent of duration of contract. The use of a solubilizer did not increase absorption through skin. No measurable Triclocarban (< 25 ppb) was present in blood and urine samples of volunteers during or shortly after a 28-day intensive bathing regimen.