Visfatin Gene Research Articles

Plasma level and expression of visfatin in the porcine hypothalamus during the estrous cycle and early pregnancy

Visfatin appears to be an energy sensor involved in the regulation of female fertility, which creates a hormonal link integrating the control of energy homeostasis and reproduction. This study evaluates the expression levels of visfatin gene and protein in selected areas of the porcine hypothalamus responsible for gonadotropin-releasing hormone synthesis: the mediobasal hypothalamus (MBH) and preoptic area (POA), and visfatin concentrations in the blood plasma. The tissue samples were harvested from gilts on days 2–3, 10–12, 14–16, and 17–19 of the estrous cycle, and on days 10–11, 12–13, 15–16, 27–28 of pregnancy. Visfatin was localized in the cytoplasm and nucleus of cells creating both studied hypothalamic structures. The study demonstrated that visfatin gene and protein expression in MBH and POA depends on hormonal status related to the phase of the estrous cycle or early pregnancy. Blood plasma concentrations of visfatin during the estrous cycle were higher on days 2–3 in relation to other studied phases of the cycle, while during early pregnancy, the highest visfatin contents were observed on days 12–13. This study demonstrated visfatin expression in the porcine hypothalamus and its dependence on the hormonal milieu related to the estrous cycle and early pregnancy.

Visfatin and resistin: role in health and disease

Adipose tissue is an endocrine organ secreting numerous neuroendocrine and peripheral peptides known as adipokines. The analysis of the essential scientific papers published from 2002 to the present has been made. Despite the fact that the role of adipokines remains controversial, their participation in metabolism, inflammation and the functioning of the endocrine system has been convincingly proven. Visfatin is an endocrine, autocrine, and paracrine peptide with many functions, including enhancing cell proliferation, nicotinamide biosynthesis, and a hypoglycemic effect. Resistin is a peptide hormone originally found in mice as a factor that induces insulin resistance. The article provides systematic information about publications concerning the study of the role of visfatin gene polymorphism. The molecular and endocrine mechanisms of visfatin and resistin and their role in the development of diabetes mellitus, insulin resistance, endothelial dysfunction, cardiovascular disease and atherosclerosis are presented. The role of these adipokines in the formation of perinatal complications in cases of impaired carbohydrate metabolism in pregnant women was evaluated according the analysis of published data. The review also demonstrates that hyperglycemia, obesity, excessive weight gain during gestation lead to impaired synthesis and function of the analyzed cytokines in adipose tissue, and to the development of fetal macrosomia. It is shown that visfatin and resistin can be considered as biological markers of pathological processes, and the further study will create the prerequisites for developing new preventive strategies and optimizing the treatment process.

2284-PUB: Overweight/Obesity in Young T1D Patients Is Differently Associated to First Degree Relatives’ History or Features According to Their Gender

Introduction: Obesity is increasing in T1D patients worldwide and is related to cardiovascular (CV) disease. Objective: To identify the background characteristics linked to overweight/obesity and CV risk factors during insulin treatment in T1D patients. Methods: We performed anthropometric, laboratory and genetic analysis - FTO rs9939609 and visfatin rs9770242 of young Brazilian T1D. This study was approved by the Ethic Committee. Results: From 181 T1D patients (age 23.6±5.5 y, diabetes duration 12.1±7.2 y, A1c 8.9±1.9%), 87 were female - 64.4% normal weight (NW), 26.4% overweight (OW) and 9.2% obese (OB) - and 94 male (77.7% NW, 14.9% OW and 7.4% OB). Male: OB were older (OB: 29.4±3.7 y vs. OW: 23.2±5.8 vs. NW: 22.5±5.3, p=0.01), had higher prevalence of blacks (57.1% vs. 7.1 vs. 7, p=0.01), higher triglycerides levels (180.3±140.2 mg/dL vs. 74.4±34.4 vs. 87±57.1, p=0.03), diastolic BP (85±8.4 mmHg vs. 78.9±9.2 vs. 73.4±9.6, p=0.009) and lower eGDR (5.4±1.9 mg/Kg/min vs. 6.8±1.9 vs. 7.9±1.7, p=0.003). Higher prevalence of AH (100% vs. 57.1 vs. 50.7, p=0.03) and early CV disease (28.6% vs. 7.1 vs. 2.7, p=0.02) in their first-degree relatives (FDR) were also found in OB. A1c, insulin dose (U/kg/day), diabetes duration, physical activity, high molecular weight (HMW) adiponectin, visfatin, FTO and visfatin genes polymorphisms were not different in NW and OW/OB. Female: We found no difference between groups in A1c, insulin dose, diabetes duration, physical activity, HMW adiponectin, visfatin or FTO and visfatin genes polymorphisms. OW and OB had lower eGDR (5.4±2.4 mg/Kg/min vs. 6.1±2.1 vs. 8±2.1, p=0.0002). OB women had FDR with obesity more frequently (62.5% vs. 47.8 vs. 25.5, p=0.03). Conclusion: FDR with obesity is a risk factor to OW/OB in female T1D as well as FDR with early CV disease or AH in male T1D. These specifics familiar background must be considered for early prevention of CV risk factors during natural history of T1D. Disclosure F. Valente: Consultant; Spouse/Partner; Sanofi Genzyme. Speaker’s Bureau; Self; AstraZeneca, Novo Nordisk Inc. T. Valente: None. S.A. Dib: None.

Visfatin and SREBP-1c mRNA Expressions and Serum Levels Among Egyptian Women with Polycystic Ovary Syndrome

Background: Obesity and insulin resistance are common features accompanying polycystic ovary syndrome (PCOS). Aim: To analyze the impact of obesity on the expression of the visfatin and sterol regulatory element-binding protein (SREBP)-1c genes among a group of Egyptian women with PCOS, and to assess their suitability as PCOS biomarkers. Subject and methods: Seventy healthy women (control group) (35 nonobese and 35 obese) and 140 women with PCOS (70 nonobese and 70 obese) were enrolled in this study. The visfatin and SREBP-1c genes' expression analyses were performed via real-time polymerase chain reaction. Serum visfatin and SREBP-1c protein levels were measured with ELISA kits. Results: Among PCOS patients, upregulation of visfatin and SREBP-1c expression was observed. We did not identify significant differences between the obese and nonobese PCOS patients nor between obese and non-obese controls. The mRNA expression levels of both genes were significantly positively correlated with their serum protein levels, as well as with fasting serum insulin levels, homeostatic model assessments of insulin resistance (HOMA-IR), luteinizing hormone (LH) ratios, LH/follicular stimulating hormone ratios, total testosterone, and free androgens. We observed significant negative correlations between visfatin and SREBP-1c expression levels and sex hormone binding globulin levels in all studied groups. Receiver operating characteristic curve analyses revealed that combining the visfatin and SREBP-1c expression data increased the sensitivity (95.92%) and specificity (93.2%) for PCOS diagnoses. Conclusion: Upregulation of visfatin and SREBP-1c was observed among PCOS patients. These genes may play a role in the pathogenesis of PCOS independent of obesity. Combined visfatin and SREBP-1c analyses could be used as a noninvasive biomarker for PCOS.

Association of serum visfatin and its mRNA expression levels with cognitive function and idiopathic intracranial hypertension in obese Egyptian women

BackgroundAn epidemic of obesity has spread across the globe. Obesity has numerous comorbidities, including airway disease, insulin resistance, type 2 diabetes, cardiovascular disease, atherosclerosis, degenerative neurological disease, cognitive dysfunction, and cancer. Inflammatory cytokine is suggested to play a role in obesity and its complications. The current study aimed to estimate the expression and serum visfatin concentrations in obese Egyptian women. Moreover, we aimed to evaluate the possible association of visfatin gene expression and its serum levels with idiopathic intracranial hypertension (IIH) and cognitive dysfunctionParticipants and methodsThis cross-sectional study enrolled 60 obese women and 40 lean healthy women as controls. Obese women were classified according to grades of obesity into three groups. All participants underwent full clinical, neurological, and psychiatric examination. IIH group included patients with intracranial pressure greater than 25 cm H2O (opening pressure measured during lumber puncture in lateral decubitus position). Cognitive function was evaluated by using Montreal Cognitive Assessment scale (MoCA), Arabic version. Estimation of visfatin expression levels was determined by real-time PCR, and serum visfatin concentrations were measured using enzyme-linked immunosorbent assay.ResultsOur results revealed that obese women had higher values of visfatin expression (1.44±0.29) and serum levels (124.1±) compared with lean women (1.01±0.3 and 46.1±33.8, respectively). The visfatin expression and serum levels were significantly positively correlated with obesity indices, metabolic risks, MoCA, cerebrospinal fluid opening pressure, and cognitive dysfunction. Linear regression test showed that BMI, cerebrospinal fluid opening pressure, and MoCA were the main predictors of both serum and expression levels of visfatin in obese women. The receiver operating characteristic curve analysis revealed that the power of serum visfatin levels was higher than visfatin expression in differentiating obese women from lean ones.ConclusionThere was a strong independent association between both higher visfatin expression and serum levels and obesity indices, metabolic risks, IIH, and cognitive dysfunction in obese Egyptian women.

Hormonal regulation of visfatin gene in avian Leghorn male hepatoma (LMH) cells

Visfain has been extensively studied in mammals and has been shown to play an important role in obesity and insulin resistance. However, there is a paucity of information on visfatin regulation in non-mammalian species. After characterization of chicken visfatin gene, we undertook this study to determine its hormonal regulation in avian (non-mammalian) liver cells. Addition of 5 ng/mL TNFα, 100 ng/mL leptin, 1, 3, 10 or 100 ng/mL T3 for 24 h upregulated visfatin gene expression by 1.2, 1.8, 1.95, 1.75, 1.80, and 2.45 folds (P < .05), respectively, compared to untreated LMH cells. Administration of 10 ng/mL of orexin A significantly down regulated visfatin gene expression by 1.35 folds compared to control cells. In contrast, treatment with IL-6 or orexin B for 24 h did not influence visfatin mRNA abundance. These pro-inflammatory cytokines and obesity-related hormones modulate the expression of CRP, INSIG2, and nuclear orphan receptors. Hepatic CRP gene expression was significantly upregulated by IL-6, TNFα, orexin B, and T3 and down regulated by leptin and orexin A. LXR mRNA abundances were increased by orexin A, decreased by orexin B, and T3, and did not affected by IL6, TNFα, or leptin. The expression of FXR gene was induced by IL-6, leptin, and T3, but it was not influenced by TNFα, orexin A or B. CXR gene expression was up regulated by TNFα, leptin, orexin B, and T3, down regulated by 5 ng/mL orexin A, and did not affected by IL-6. INSIG2 mRNA levels were increased by TNFα (5 ng/mL), leptin (100 ng/mL), and T3 (1, 3, 10, and 100 ng/mL), decreased by orexin A, and remained unchanged with IL-6 or orexin B treatment.Together, this is the first report showing hormonal regulation of visfatin in avian hepatocyte cells and suggesting a potential role of CRP, INSIG2, and nuclear orphan receptor LXR, FXR, and CXR in mediating these hormonal effects.

Effect of glucagon-like peptide-1 analogue; Exendin-4, on cognitive functions in type 2 diabetes mellitus; possible modulation of brain derived neurotrophic factor and brain Visfatin

BackgroundBrain derived neurotrophic factor (BDNF) is one of the most essential neurotrophic factors in the brain. BDNF is involved in learning, memory and locomotion suggesting it as a target in type 2 diabetes mellitus (T2DM) associated cognitive changes. Visfatin; an adipokine discovered to be expressed in the brain; was found to have multiple effects including its participation in keeping energy supply to the cell and is consequentially involved in cell survival. Its role in cognitive functions in T2DM was not studied before. Recent studies point to the possible neuro-protective mechanisms of glucagon-like peptide 1 analogue: Exendin-4 (Ex-4) in many cognitive disorders, but whether BDNF or Visfatin are involved or not in its neuro-protective mechanisms; is still unknown. Aimsto study the changes in cognitive functions in T2DM, either not treated or treated with Glucagon-like peptide 1 (GLP-1) analogue: Ex-4, and to identify the possible underlying mechanisms of these changes and whether BDNF and brain Visfatin are involved. MethodsA total of 36 adult male wistar albino rats were divided into 4 groups; Control, Exendin-4 control, Diabetic and Exendin-4 treated groups. At the end of the study, Y-maze and open field tests were done the day before scarification to assess spatial working memory and locomotion, respectively. Fasting glucose and insulin, lipid profile and tumor necrosis factor- alpha (TNF-α) were measured in the serum. Homeostasis model assessment insulin resistance was calculated. In the brain tissue, malondialdehyde (MDA) level, gene expression and protein levels of BDNF and Visfatin, area of degenerated neurons, area of glial cells and area % of synaptophysin immunoexpression were assessed. ResultsCompared with the control, the untreated diabetic rats showed insulin resistance, dyslipidemia and elevation of serum TNF-α. The brain tissue showed down-regulation of BDNF gene expression and reduction of its protein level, up-regulation of Visfatin gene expression and elevation of its protein level, increase in MDA, area of degenerated neurons and area of glial cells and reduction in area % of synaptophysin immunoexpression. These changes were paralleled with significant deterioration in spatial working memory and locomotion. Treatment of diabetic rats with Ex-4 reversed all these changes. ConclusionT2DM has a negative impact on cognitive functions through different pathological and subcellular mechanisms. The current study provides evidence for involvement of BDNF and brain Visfatin in T2DM- associated cognitive dysfunction. BDNF and brain Visfatin were also found to contribute to the neuro-protective effect of Ex-4 via modulation of inflammation, oxidative stress, neuro-degeneration and synaptic function.

Dietary fat intake associated with bone mineral density among visfatin genotype in obese people.

Osteoporosis and adipose tissue are closely related with many contradictions. Visfatin is an adipokine that is related to osteoporosis and adiposity. This nutrigenomics study examined the interaction between visfatin genotypes and dietary fat intake, with regard to bone mineral density (BMD) among an obese population. In this cross-sectional study, 336 subjects were enrolled; the mean age was 38·25 (sd 11·69) years and the mean BMI was 31·79 (sd 4·77) kg/m2. Laboratory measurements were lipid profile, insulin and fasting blood sugar. Bone density measurements were assessed by dual-energy X-ray absorptiometry. Dietary data were collected through a 3-d 24-h dietary recall. Genotyping for visfatin gene SNP (rs2110385) was performed by the PCR-restriction fragment length polymorphism method. The frequency of GG, GT and TT genotypes were 33·92 48·51 and 17·54 %, respectively, and 86·6 % of participants were women. The results showed that subjects with TT genotypes had significantly higher lumbar BMD, T score and z score (P<0·0001). After categorisation by percentage of fat intake (30 % of total energy content as a cut-off point), no interaction was found, but when categorised by fat types, we found an interaction between visfatin genotypes and dietary PUFA intake in terms of the hip T score and z score (P=0·043, B= -0·08; P=0·04, B= -0·078, respectively). There was a significant relationship between high PUFA intake and lower energy and protein intake. When participants were categorised by median PUFA intake (22·8 g), it was concluded that subjects with GG genotype who had high PUFA-intake diets had lower hip z scores and T scores, unlike the other genotypes.

Visfatin gene expression and oxidative stress in pregnancy induced hypertension

Preeclampsia, a hypertensive disorder of pregnancy, was related to hypertension, diabetes, oxidative stress, obesity, in addition to polycystic ovarian diseases. Visfatin, potentially a new adipokine has emerged having high contribution in pathogenesis of preeclampsia. Oxidative stress was increased lipid peroxidation and caused vascular endothelial damage. This study was conducted with the aim of evaluating the level of visfatin gene expression in placenta and measuring some oxidative stress parameters. Eighty Egyptian patients of newly diagnosed pregnant hypertensive disorder were selected for the study which was recruited from Mansoura University Hospital, Department of Obstetrics and Gynecology and also normotensive pregnant women were collected. The pregnant women groups were classified into four groups: gestational hypertension (n = 20), mild preeclampsia (n = 16), severe preeclampsia (n = 25), chronic hypertension with superimposed preeclampsia (n = 19) and compared with normotensive pregnant women (n = 10) as control group. Visfatin gene expression level was decreased in placenta of pregnant hypertensive disorder women groups with mean 1.28 ± 0.42, 1.01 ± 0.24, 0.40 ± 0.14 and 0.32 ± 0.11 respectively when compared to normotensive pregnant women with mean 1.56 ± 0.69. Additionally, catalase activity, total antioxidant capacity and reduced glutathione levels were decreased in hypertensive pregnant women groups compared with normotensive ones. On the other hand malondialdhyde level was increased in preeclampsia groups when compared with normalized pregnant women. Decreased visfatin level has an important pathophysiology of preeclampsia and suggests the complication in pregnancy. Also the imbalance between oxidant and antioxidant has an important causative factor in the pathogenesis of preeclampsia.

Identification and expression patterns of adipokine genes during adipocyte differentiation in the Tibetan goat (Capra hircus)

Adipokines are secreted by adipose tissue and play an important role in the regulation of lipid metabolism. However, the information regarding adipokines in goats is limited. PPARγ is a key gene in adipocyte differentiation and activates adipokine genes. Rosiglitazone is a PPARγ agonist and can promote the expression of PPARγ to increase the expression of lipogenesis-related genes. Therefore, investigation of the relationship between rosiglitazone and adipokines will help us to better understand the function of PPARγ in lipid metabolism in Tibetan goats. In this study, we cloned the resistin (RETN), apelin (APLN), fibroblast growth factor 21 (FGF21), and visfatin (NAMPT) genes from non-pregnant female Tibetan goat adipose tissue. APLN and NAMPT were predominantly expressed in the kidney, and FGF21 was expressed at the highest levels in the liver in vivo. In fat tissues, the highest expression levels of FGF21 and RETN were detected in omental fat, whereas their expression in perirenal and subcutaneous fat was extremely weak. APLN and NAMPT were abundantly expressed in omental and subcutaneous fat in vivo. In addition, the four adipokines had different expression profiles during goat adipocyte differentiation in vitro. Oil red O staining showed that rosiglitazone could promote adipocyte differentiation and lipid droplet formation. In addition, rosiglitazone significantly increased the expression of FGF21 and RETN (p<0.05) but decreased the expression of APLN and NAMPT (p<0.05). These results suggest that the four adipocytokine genes may have different roles during goat adipocyte differentiation. And PPARγ could regulate the expression of the four adipokines, but the detailed regulatory mechanism still needs to be elucidated.

Characterization of the visfatin gene and its expression pattern and effect on 3T3-L1 adipocyte differentiation in chickens

Visfatin is a newly identified adipocytokine that plays an important role in the determination of fat traits. In this study, we investigated the characterization of visfatin and the relationship between gene expression and chicken development to provide a theoretical basis for studying visfatin functions. The main results are summarized as follows: The 1482-bp full coding sequence of the visfatin gene of silky fowl was obtained and found to encode 493 amino acids. This gene contains 26 phosphorylation sites and a conserved domain of the NAPRTase family but no signal peptide sequence. It exhibits six functional motifs, including an amidation site. In chickens, visfatin is a highly conserved protein. The highest expression of visfatin was found in breast muscle and the lowest in bone marrow. There was no difference in expression between visceral fat and subcutaneous fat. However, the expression of visfatin in the bone marrow, liver, kidneys, and subcutaneous and visceral fat of broiler chickens was significantly higher than that in silky fowl (P<0.05). Visfatin mRNA levels in the bone marrow decreased with development (P<0.05) but increased in the liver and leg muscle. Visfatin gene expression in the liver, heart and bone marrow did not differ in silky fowl according to sex. A visfatin fusion protein caused a significant increase in the expression of adipocyte differentiation markers (PPARγ, aP2, C/EBPα, and FAS) compared with the control group and a decrease compared with the insulin group. Taken together, the results of the present study contribute to a better understanding of the expression and role of the visfatin gene in chickens.

In-vitro function of upstream visfatin polymorphisms that are associated with adverse cardiometabolic parameters in obese children.

BackgroundVisfatin is an adipokine associated with glucose and lipid metabolism. We previously reported two visfatin upstream single nucleotide polymorphisms (SNPs), c.-3187G > A (rs11977021) and c.-1537C > T (rs61330082), which were in perfect linkage disequilibrium, in a Singaporean cohort of severely obese children and are associated with visfatin level and adverse cardiometabolic parameters. We aim to functionally characterize the effect of c.-3187G > A and c.-1537C > T SNPs on basal transcriptional activity.MethodsA 1.6 kb and 3.7 kb upstream promoter region of the visfatin gene was amplified by polymerase chain reaction and separately cloned into luciferase reporter vectors. Successful clones were transfected into human embryonic kidney (HEK293T) and human breast carcinoma (MCF7) cells and in-vitro dual-luciferase assay was performed. Electrophoretic mobility shift assay (EMSA) was also conducted to examine the binding affinity between transcription factors and visfatin promoter sequences.ResultsVariant promoter with only c.-1537C > T SNP did not show a change in transcriptional activity as compared to the wild type. However, variant promoter with both c.-3187G > A and c.-1537C > T SNPs showed a statistically significant increase of 1.41 fold (p < 0.01) in transcriptional activity. The longer 3.7kbp visfatin promoter sequence was also shown to have significantly higher transcriptional activity (p < 0.05) as compared to the shorter 1.6kbp visfatin promoter. Both c.-3187G > A and c.-1537C > T variants showed an increased binding with nuclear protein.Discussion and conclusionsWe have demonstrated for the first time that visfatin variant promoter with both c.-3187G > A and c.-1537C > T SNPs result in an increase in transcriptional activity. This supports our previous finding and postulation that these SNPs contribute to elevated visfatin levels which may mediate higher triglyceride levels, severe systolic blood pressure and severe hypertension in obese children. These SNPs may co-operatively affect enhancer or silencer function to regulate transcriptional activity. In conclusion, this study shows that upstream visfatin SNPs could potentially affect phenotypic outcome in obese children through alteration of circulating visfatin level.Electronic supplementary materialThe online version of this article (doi:10.1186/s12864-016-3315-9) contains supplementary material, which is available to authorized users.

Association of leptin, visfatin, apelin, resistin and adiponectin with clear cell renal cell carcinoma.

Although an association between obesity and the occurrence of renal cell carcinoma (RCC) has been identified, the mechanism by which obesity functions to increase this risk of cancer remains unclear. Leptin, visfatin, apelin, resistin and adiponectin are peptide hormones secreted by adipocytes; it is considered that these may affect RCC development by exerting effects on proliferation, cell growth and inflammation. The aim of the present study was to investigate the association between the aforementioned adipokine genes and clear cell RCC (CC-RCC). The GSE6344 dataset was downloaded from the Gene Expression Omnibus database, and the relative expression levels of the adipokine genes were analyzed. To verify the results of the mRNA microarray, 77 paired samples of CC-RCC and corresponding adjacent normal tissue were allocated into two groups. The extraction of total RNA was conducted, and the mRNA expression of adipokine genes was analyzed using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). The data from the GSE6344 dataset indicated that the expression of visfatin and apelin was upregulated (P<0.0001 and P<0.01, respectively), and adiponectin was downregulated (P<0.001) in the CC-RCC tissues compared with the adjacent normal tissues. The data from RT-qPCR demonstrated that visfatin and resistin gene expression was increased (P<0.01 and P<0.05, respectively) in the CC-RCC tissues. Furthermore, the mRNA expression level of leptin and adiponectin in the adjacent normal tissue was higher than those in the cancer tissue (P<0.01). The current study verifies that visfatin and adiponectin are associated with an increased risk of CC-RCC, which presents further insights into the molecular mechanisms of CC-RCC tumorigenesis.

Genetic variant in visfatin gene promoter contributes to reduced risk of hepatocellular carcinoma in a Chinese population.

Knowledge on the role of gene variants in the visfatin promoter region in the hepatitis B virus (HBV)-related liver diseases is limited. In this study, we genotyped two potentially functional single nucleotide polymorphisms (SNPs) in the visfatin promoter region, -1535C>T (rs61330082) and -3187G>A (rs11977021), in 120 HBV-related chronic hepatitis B (CHB) patients, 140 HBV-related liver cirrhosis (HBV-LC) patients, 243 HBV-related hepatocellular carcinoma (HBV-HCC) patients, and 224 asymptomatic HBV carriers. Odds ratios (ORs) with 95% confidence intervals (CIs) were calculated by logistic regression. The results showed subjects with a TT genotype of -1535C>T had a significantly decreased risk of HBV-HCC related to the CC and CC + CT genotypes (adjusted OR = 0.493, 95% CI = 0.313-0.778; OR = 0.535, 95% CI = 0.362-0.791, respectively). A lowered risk also appeared in the comparison between allele T and allele C (OR = 0.734, 95%, CI = 0.581-0.950). However, these associations existed only in people with Zhuang ethnicity, but not in people with Han ethnicity. There were no significant associations between -3187G>A polymorphisms and the risk of HBV-related liver diseases. Our results suggested that visfatin -1535C>T polymorphisms might be associated with decreased risk of HBV-HCC among the ethnic Zhuang population in Guangxi, China.

Cooperation between HMGA1 and HIF-1 Contributes to Hypoxia-Induced VEGF and Visfatin Gene Expression in 3T3-L1 Adipocytes.

The architectural transcription factor high-mobility group AT-hook 1 (HMGA1) is a chromatin regulator with implications in several biological processes, including tumorigenesis, inflammation, and metabolism. Previous studies have indicated a role for this factor in promoting the early stages of adipogenesis, while inhibiting adipocyte terminal differentiation, and decreasing fat mass. It has been demonstrated that hypoxia – through the hypoxia-inducible factor 1 (HIF-1) – plays a major role in triggering changes in the adipose tissue of the obese, leading to inhibition of adipocyte differentiation, adipose cell dysfunction, inflammation, insulin resistance, and type 2 diabetes. To examine the possible cooperation between HMGA1 and HIF-1, herein, we investigated the role of HMGA1 in the regulation of Visfatin and VEGF, two genes normally expressed in adipose cells, which are both responsive to hypoxia. We demonstrated that HMGA1 enhanced Visfatin and VEGF gene expression in human embryonic kidney (HEK) 293 cells in hypoxic conditions, whereas HMGA1 knockdown in differentiated 3T3-L1 adipocytes reduced these effects. Reporter gene analysis showed that Visfatin and VEGF transcriptional activity was increased by the addition of either HMGA1 or HIF-1 and even further by the combination of both factors. As demonstrated by chromatin immunoprecipitation in intact cells, HMGA1 directly interacted with the VEGF gene, and this interaction was enhanced in hypoxic conditions. Furthermore, as indicated by co-immunoprecipitation studies, HMGA1 and HIF-1 physically interacted with each other, supporting the notion that this association may corroborate a functional link between these factors. Therefore, our findings provide evidence for molecular cross-talk between HMGA1 and HIF-1, and this may be important for elucidating protein and gene networks relevant to obesity.

Obesity and Cardiovascular Risk: Variations in Visfatin Gene Can Modify the Obesity Associated Cardiovascular Risk. Results from the Segovia Population Based-Study. Spain.

ObjectivesOur aim was to investigate if genetic variations in the visfatin gene (SNPs rs7789066/ rs11977021/rs4730153) could modify the cardiovascular-risk (CV-risk) despite the metabolic phenotype (obesity and glucose tolerance). In addition, we investigated the relationship between insulin sensitivity and variations in visfatin gene.Material and MethodsA population-based study in rural and urban areas of the Province of Segovia, Spain, was carried out in the period of 2001–2003 years. A total of 587 individuals were included, 25.4% subjects were defined as obese (BMI ≥30 Kg/m2).ResultsPlasma visfatin levels were significantly higher in obese subjects with DM2 than in other categories of glucose tolerance. The genotype AA of the rs4730153 SNP was significantly associated with fasting glucose, fasting insulin and HOMA-IR (Homeostasis model assessment-insulin resistance) after adjustment for gender, age, BMI and waist circumference.The obese individuals carrying the CC genotype of the rs11977021 SNP showed higher circulating levels of fasting proinsulin after adjustment for the same variables.The genotype AA of the rs4730153 SNP seems to be protective from CV-risk either estimated by Framingham or SCORE charts in general population; and in obese and non-obese individuals. No associations with CV-risk were observed for other studied SNPs (rs11977021/rs7789066).ConclusionsIn summary, this is the first study which concludes that the genotype AA of the rs4730153 SNP appear to protect against CV-risk in obese and non–obese individuals, estimated by Framingham and SCORE charts. Our results confirm that the different polymorphisms in the visfatin gene might be influencing the glucose homeostasis in obese individuals.

Chenodeoxycholic acid reduces feed intake and modulates the expression of hypothalamic neuropeptides and hepatic lipogenic genes in broiler chickens

Bile acids have recently become an emerging research hot spot in mammals due to their roles as metabolic regulators and molecular signatures controlling whole-body metabolic homeostasis. Such effects are still unknown in avian (non-mammalian) species. We, therefore, undertook this study to determine the effect of chenodeoxycholic acid (CDCA) on growth performance and on the expression of hypothalamic neuropeptides and hepatic lipogenic genes in broiler chickens. Chickens fed with diet-containing 0.1% or 0.5% CDCA for two weeks exhibited a significant and a dose dependent reduction of feed intake and body weight compared to the control (standard diet). These changes were accompanied with a significant decrease in plasma glucose levels at d10 and d15 post-treatment. At molecular levels, CDCA treatment significantly up-regulated the expression of feeding-related hypothalamic neuropeptides (NPY, AgRP, ORX, CRH, Ghrl, and MC1R) and down-regulated the hypothalamic expression of SOCS3. CDCA treatment also decreased the mRNA levels of key hepatic lipogenic genes (FAS, ACCα, ME, ATPcl, and SCD-1) and their related transcription factors SREBP-1/2 and PPARα. In addition, CDCA reduced the hepatic expression of FXR and the adipokine, visfatin, and adiponectin genes compared to the control. Together, our data provide evidence that CDCA alters growth performances in broilers and modulates the expression of hypothalamic neuropeptides and hepatic lipogenic and adipocytokine genes.

Indels within the bovine visfatin gene affect its mRNA expression in longissimus muscle and subcutaneous fat

Abstract. Visfatin, an adipokine hormone produced primarily by visceral adipose tissue in mammals, has been identified as having a crucial role in growth and development of skeletal muscle and lipids. In this research, the effects of two indel loci (35 bp indel: AC_000161.1: g. 20540–20541 Ins ACTGGAATTCTAGTTTAAAAATTGCTACTAATGAA located in intron 4; 6 bp indel: AC_000161.1: g. 25873–25878 Del: TAAAAA located in intron 5) of the visfatin gene on mRNA expression levels were studied by means of real-time quantitative PCR (qPCR) in longissimus muscle and subcutaneous fat from 95 Qinchuan cattle. Firstly, visfatin expression level in longissimus muscle of fetal cattle was prominently greater than that in calves and adult cattle (P &lt; 0.05). The expression level of visfatin in subcutaneous fat was notably higher than that in longissimus muscle of calves and adult cattle (P &lt; 0.05). Secondly, there were three genotypes (ins/ins, del/del and ins/del) and two genotypes (ins/del and ins/ins) detected in the 35 bp locus and 6 bp locus, respectively. Visfatin showed a minimum expression level in longissimus muscle in the homozygous deletion genotype at the 35 bp indel locus. Especially in calves, expression of visfatin was significantly greater in the heterozygous genotype than that in the homozygous insertion genotpye (P &lt; 0.05). No statistical differences were found among visfatin expression level based on genotypes in the 6 bp indel locus (P &gt; 0.05). Compared to heterozygous genotype, the expression level of homozygous insertion genotype was lower in longissimus muscle but greater in subcutaneous fat. These results imply that the expression levels of bovine visfatin vary with age and its indels might be putative variants mediating the expression of the bovine visfatin gene. This study provides useful information for further functional studies of bovine visfatin.

Correlation between polymorphisms in the visfatin gene and its expression in the serum and coronary artery calcification.

We investigated the association between serum visfatin levels and single nucleotide polymorphisms (SNPs; rs61330082, rs2058539) in the visfatin gene and coronary artery calcification (CAC) in patients from Wenzhou, China. CAC patients (N = 206) were divided into two groups: mild CAC (MCAC) and moderate and severe CAC (MSCAC). Volunteers without CAC (N = 70) were included in the control group. The serum visfatin level was analyzed by enzyme-linked immunosorbent assay. SNPs (rs61330082, rs2058539) in the visfatin gene were analyzed by polymerase chain reaction-restriction fragment length polymorphism. Clinical data, serum visfatin levels, and genotype and allele frequencies of rs61330082 and rs2058539 were compared among the three groups. MSCAC patients expressed significantly higher serum visfatin levels (30.58 ± 6.12 ng/mL) than individuals in the MCAC (29.03 ± 1.87 ng/mL) and control (24.45 ± 5.44 ng/mL) groups (P < 0.05). The genotype distributions and frequencies of rs61330082 differed significantly among the groups (P < 0.05), while those of rs2058539 did not. The serum visfatin level was positively correlated with the body mass index (BMI), high-density lipoprotein cholesterol (HDL-C), and insulin resistance index (IRI), and negatively correlated with the triglyceride (TG) levels (P < 0.05) of patients. Serum visfatin is associated with the development of CAC. The T allele of the rs61330082 SNP in the visfatin gene had a cardioprotective effect on patients with CAC; the SNP at rs2058539 was not significantly associated with CAC. The BMI, HDL-C, IRI, and TG levels influenced the development of CAC.

Genetic associations of the visfatin G-948T polymorphism with obesity-related metabolic traits in an Iranian population.

Background:Obesity is a global public health problem. Visfatin, as an adipocytokine, is coded by a gene known as nicotinamide phosphoribosyltransferase. So far, results were conflicted regarding correlations of visfatin with obesity and metabolic variables. The present study aimed to explore the association between G-948T polymorphism of visfatin gene with obesity and lipid profile in a nationally representative sample of Iranian population.Materials and Methods:In this case–control study, we assessed 129 randomly selected patients with obesity and 182 healthy normal weight controls from participants of Isfahan Healthy Heart Program. Genomic DNA was isolated from peripheral blood cells, and high-resolution melt polymerase chain reaction was performed to explore the presence of G-948T polymorphism.Results:T carriers “GT + TT” were statistically more frequent in the obese patients than the controls (P = 0.013; odds ratio = 1.9, 95% confidence interval = 1.1–3.1). The serum levels of total cholesterol and low-density lipoprotein cholesterol (LDL-C) were significantly different between T carriers and GG homozygote genotype (P = 0.03 and 0.02, respectively).Conclusion:We concluded that visfatin G-948T polymorphism was correlated with obesity, total cholesterol, and LDL-C levels in our population.