Virus Source Plants Research Articles

Enhanced Age-Related Resistance to Tomato Yellow Leaf Curl Virus in Tomato Is Associated With Higher Basal Resistance.

Tomato yellow leaf curl virus (TYLCV) is one of the most notorious plant pathogens affecting the production of tomato worldwide. While the occurrence of age-related resistance (ARR) against TYLCV has been reported, the factors impacting its development remain unknown. We conducted a series of experiments with three tomato cultivars that vary in basal resistance to TYLCV to explore factors involved in the development of ARR. Our data indicate that ARR is more pronounced in tomato cultivars with higher basal resistance. Additionally, increased plant biomass in older plants does not contribute to ARR. Virus source plants with a younger age at initial inoculation facilitates virus acquisition by whiteflies. Finally, an analysis on plant hormones suggests that salicylic acid (SA) may play a major role in the development of ARR in tomato against TYLCV. These findings provide new insights into the developmental resistance in tomato against TYLCV as well as clues for the deployment of ARR in the management of diseases caused by TYLCV.

Comparison of transmission efficiency of various isolates of Potato virus Y among three aphid vectors

AbstractPotato virus Y (PVY) strains are transmitted by different aphid species in a non‐persistent, non‐circulative manner. Green peach aphid (GPA), Myzus persicae Sulzer, is the most efficient vector in laboratory studies, but potato aphid (PA), Macrosiphum euphorbiae Thomas (both Hemiptera: Aphididae, Macrosiphini), and bird cherry‐oat aphid (BCOA), Rhopalosiphum padi L. (Hemiptera: Aphididae, Aphidini), also contribute to PVY transmission. Studies were conducted with GPA, PA, and BCOA to assess PVY transmission efficiency for various isolates of the same strain. Treatments included three PVY strains (PVYO, PVYN:O, PVYNTN) and two isolates of each strain (Oz and NY090031 for PVYO; Alt and NY090004 for PVYN:O; N4 and NY090029 for PVYNTN), using each of three aphid species as well as a sham inoculation. Virus‐free tissue‐cultured plantlets of potato cv. Russet Burbank were used as virus source and recipient plants. Five weeks post inoculation, recipient plants were tested with quantitative DAS‐ELISA to assess infection percentage and virus titer. ELISA‐positive recipient plants were assayed with RT‐PCR to confirm presence of the expected strains. Transmission efficiency (percentage infection of plants) was highest for GPA, intermediate for BCOA, and lowest for PA. For all aphid species, transmission efficiency did not differ significantly between isolates within each strain. No correlations were found among source plant titer, infection percentage, and recipient plant titer. For both GPA and BCOA, isolates of PVYNTN were transmitted with greatest efficiency followed by isolates of PVYO and PVYN:O, which might help explain the increasing prevalence of necrotic strains in potato‐growing regions. Bird cherry‐oat aphid transmitted PVY with higher efficiency than previously reported, suggesting that this species is more important to PVY epidemiology than has been considered.

Aphid Transmission of the Ontario Isolate of Plum Pox Virus.

Utilization of timed virus acquisition access probes in studies of plum pox virus (PPV) transmission by aphids demonstrated that endemic species transmitted the virus readily from plum, Prunus domestica (L.) Batsch; peach, P. persica (L.); or dwarf flowering almond, P. glandulosa Thunberg., to peach seedlings. The green peach aphid, Myzus persicae (Sulzer), was shown to be the most efficient vector. Acquisition of virus by green peach aphids from infected peach leaves resulted in 18-28% infected peach seedlings, while aphids previously fed on infected leaves of plum transferred virus to 36% of peach seedlings. Although the spirea aphid, Aphis spiraecola (Patch), was a less efficient vector than M. persicae it is perhaps more important for the spread of PPV due to its greater abundance and occurrence earlier in the season when peach trees are thought to be more susceptible to infection. Virus transmission rates varied depending on the virus source and healthy test plant species. In contrast to many previous studies, aphid inoculation of the experimental host Nicotiana benthamiana Domin occurred at a low rate, never exceeding 4%. Acquisition of PPV by M. persicae from infected peach fruit was greatly reduced compared with acquisition from leaves. The results of this research indicate that the Ontario isolate of PPV-D is readily transmissible by aphids to peach and natural spread of the virus needs to be considered in future management or eradication programs.

Effect of Host Plant Tissue on the Vector Transmission of Grapevine Leafroll-Associated Virus 3

Many biotic and abiotic factors affect the transmission efficiency of vector-borne plant pathogens. Insect vector within-plant distribution and host tissue preference are known to affect pathogen acquisition and inoculation rates. In this study, we first investigated whether feeding tissue affects the transmission of Grapevine leafroll-associated virus 3 by Planococcus ficus (Signoret) (Hemiptera: Pseudococcidae) and the effect of mealybug within-plant distribution on virus transmission under greenhouse conditions. Results showed no significant effect on transmission efficiency after insect confinement on leaf blades, petioles or stems of virus source or healthy test plants for either acquisition or inoculation trials. Transmission efficiency of a single mealybug varied from 4 to 25% in those trials. Second, we tested whether leaf position affected transmission efficiency due to potentially variable virus populations within acquisition plant tissues. No significant differences of transmission rate among acquisition leaf position were observed, probably because there were no differences in the virus population within source tissues. Finally, we examined the seasonality of the virus in field-collected samples and found that GLRaV-3 prevalence varied along a growing season, such that GLRaV-3 translocated along expanding shoots to leaves. Similarly, mealybug populations are known to increase in spring, and then mealybugs spread to cordons and leaves. This coordination of spatial and temporal dynamics of the virus and its vector may increase the risk of GLRaV-3 transmission during late spring and early summer. Further integration of information about pathogen populations in plants, vector feeding behavior and vector population seasonality could lead to more effective management practices.

First Report of Tobacco ringspot virus in Joe-Pye Weed (Eupatorium purpureum) in Mississippi.

Eupatorium purpureum L. (joe-pye weed, sweet joe-pye weed, and sweetscented joe-pye weed) is a wildflower perennial plant native to the eastern United States. In May 2006, virus-like symptoms including systemic chlorosis, mottling, and downward rolling of leaf blades were observed in a joe-pye weed plant located on the Mississippi State University campus. Young symptomatic leaves were ground in 0.1 M phosphate buffer, pH 7.2, and the slurry was inoculated on leaves of several herbaceous hosts grown in a greenhouse. Systemic symptoms were observed 1 to 2 weeks postinoculation in Cucumis sativus (chlorotic spots followed by systemic ringspot and leaf deformation), Chenopodium quinoa (necrotic lesions/leaf deformation), Nicotiana benthamiana (mosaic/line patterns), and N. rustica (necrotic ring spots). Electron microscopy of partially purified preparations from infected joe-pye weed and cucumber plants revealed the presence of intact and empty isometric viral particles of approximately 30 nm in diameter resembling nepoviruses or comoviruses. The original joe-pye weed plant and artificially infected herbaceous plants were tested by ELISA (Agdia Inc., Elkhart, IN) for several nepoviruses/comoviruses and found to be positive for Tobacco ringspot virus (TRSV; genus Nepovirus, family Comoviridae). Total RNA extracted from the original virus source plant was reverse transcribed using oligodT primer and submitted to PCR with the primer set TRS-F (5'TATCCCTATGTGCTTGAGAG3') and TRS-R (5'CATAGACCACCAGAGTCACA3') designed from the published sequences in GenBank of the RNA 1 of Tobacco ringspot virus. A specific 766-bp PCR product was cloned and sequenced. Sequence analysis showed that the virus from the joe-pye weed shared 94% nucleotide identity (98% at amino acid level) with a "bud blight" isolate of TRSV (Accession No U50869) (2) in the sequenced genome portion and slightly lower (90 to 92%) with other sequenced isolates of the same virus, thus further confirming the identity of the virus. In 2008 and 2009, TRSV was detected in an additional 16 symptomatic specimens of the same host collected from six distinct locations in Mississippi. Our results show that E. purpureum is a new host for TRSV. Considering that the related plant species E. capillifolium (small dogfennel) was already reported as a host of TRSV in North Carolina (1), this suggests that these two common plants may represent additional reservoirs of this virus in the region.

First Report of Tomato leaf curl New Delhi virus Infecting Tomato in Bangladesh

Tomato is an important cash crop for resource-poor farmers and accounts for 20% of the 2 million t of vegetables grown annually in Bangladesh. Tomato cultivation is affected by Tomato leaf curl virus (ToLCV), which can cause as much as 100% yield loss. Plants exhibiting typical ToLCV disease symptoms of yellowing, severe leaf curling, and stunting were collected at Jessore, Bangladesh during September 2003. The putative virus was transmitted from tomato to tomato by the whitefly Bemisia tabaci. In two separate experiments, 100% transmission was achieved by using 10 viruliferous B. tabaci adults for each of the 20 test plants that was confirmed by comparing the symptoms on test and virus source plants. Total DNAs were extracted from the symptomatic leaves, and the putative viral genomes were amplified by polymerase chain reaction by using the Deng A and B primers (1). Sequences generated from these primers were used to design virus-specific primers that were used to obtain complete viral sequences. Full-length DNA-A (2,740 nt; GenBank Accession No. AJ875157) and DNA-B (2,688 nt; GenBank Accession No. AJ875158) sequences of a bipartite Tomato leaf curl New Delhi virus from Jessore (ToLCNDV-[Jes]) were obtained, which were most similar to the corresponding sequences of ToLCNDV-(Lucknow) (GenBank Accession No. Y16421) at 95.7% and Tomato leaf curl Gujarat virus-(Varanasi) (Gen-Bank Accession No. AY190291) at 90.6% nt identities, respectively. DNA-A sequences had only 73.2% nt identity with the previously reported monopartite Tomato leaf curl Bangladesh virus (GenBank Accession No. AF188481) (2), confirming the occurrence of mono- and bipartite bego-moviruses in Bangladesh. The virus diversity poses a challenge for ToLCVD management in Bangladesh.

Evaluation of Hairy Nightshade as an Inoculum Source for Aphid-Mediated Transmission of Potato Leafroll Virus

Potato leafroll virus (PLRV) causes one of the most serious aphid-transmitted diseases affecting yield and quality of potatoes, Solanum tuberosum (L.), grown in the United States. The green peach aphid, Myzus persicae (Sulzer), is considered to be by far the most efficient vector of this virus. Even the most strict aphid control strategy may not prevent the spread of PLRV unless measures also are taken to keep virus source plants within and outside the crop at a minimum. Hairy nightshade, Solanum sarrachoides (Sendtner), is one of the preferred weed hosts for green peach aphid. The potential of this weed as an aphid reservoir and virus source and its spread or perpetuation were investigated. With the use of double antibody sandwich enzyme-linked immunosorbent assay, it was confirmed that green peach aphid can transmit PLRV to hairy nightshade and that aphids can become viruliferous after feeding on infected hairy nightshade plants. Transmission from hairy nightshade to potato is 4 times the rate of potato to potato or potato to hairy nightshade. The green peach aphid preferred hairy nightshade over potato plants and reproduced at a higher rate on hairy nightshade than on potato. Therefore, a low level of PLRV-hairy nightshade infection could enhance the disease spread in the field.

Insecticidal reduction of Potato leafroll virus transmission by Myzus persicae

Summary Esfenvalerate, imidacloprid, methamidophos, oxamyl, pymetrozine and thiamethoxam were tested for their potential to reduce the transmission of Potato leafroll virus (PLRV) by Myzus persicae. In acquisition experiments exposing virus-free aphids to insecticide residues on virus source plants during a 2-day acquisition access period, subsequent transmission of PLRV to untreated indicator plants declined significantly with increasing dosage for all insecticides. At the highest dosages, PLRV transmission was reduced by 28%, 100%, 31%, 10%, 87%, and 99.8% for the six insecticides, respectively. In inoculation experiments exposing viruliferous aphids to insecticide residues on treated indicator plants during a 5-day inoculation access period, PLRV transmission again declined with increasing dosage. At the highest dosages, transmission was reduced by 71%, 56%, 16%, 40%, 94%, and 38%, respectively. Methamidophos and oxamyl were very good aphicides, but were relatively ineffective in reducing virus transmission. Reduction of PLRV transmission by imidacloprid and thiamethoxam appeared to be largely related to their toxic effects, but it is likely that antifeedant properties also played a role, especially in the inoculation experiments. Pymetrozine reduced PLRV transmission in both types of experiments, but especially so in the inoculation experiment, possibly reflecting its antifeedant properties.

First Report of Twenty-two New Hosts of Potato leafroll virus.

The known host range of Potato leafroll virus (PLRV, genus Polerovirus, family Luteoviridae) is narrow, consisting of 21 species in 5 families: 3 Amaranthaceae, 2 Cruciferae, 1 Nolanaceae, 1 Portulacaceae, and 14 Solanaceae. Over a period of years, we identified 22 additional host species of PLRV in 5 new families and 1 previously identified family: 1 Chenopodiaceae, 2 Compositae, 1 Cucurbitaceae, 1 Labiatae, 2 Malvaceae, and 15 Solanaceae. The 22 additional host species are Cucurbita pepo L., Datura fastuosa L., Hibiscus golfrosens L., H. moscheutos L., Hypercymus niger L., Lactuca sativa L., Lycopersicon pimpinefolium (Jusl.) Mill., L. peruvianun L., Nicotiana accuminata Grah., N. agustifolia Comes, N. rustica L., N. tabacum L., N. glutinosa L., Ocimum basilicum L., Physalis ixocarpa Brot., P. lanceifolia Michx., P. peruvianum L., Solanum rostratum Dund., S. sarrachoides Sendtner, S. demissum L. (P.I. 230579), Spinacia oleraceae L., and Zinnia elegans Jaeq. In light of these new hosts, reevaluation of the epidemiology of PLRV may be advisable in regions where new virus hosts also host aphid vectors and where a virus host may ensure perennial survival of PLRV. Two new hosts were found naturally infected in the Columbia Basin of the Pacific Northwest. The potential impact of one of these, S. sarrachoides, a predominant and widespread weed in potatoes and an excellent host of the major PLRV vector, Myzus persicae Sulzer, may be very important. The second naturally infected host, Z. elegans, is of doubtful importance since it is largely confined to cultivated gardens, is a summer annual, and rarely is colonized by M. persicae. The new hosts were initially discovered in various experiments over a period of years. In confirmatory tests, the hosts were inoculated with six different isolates of PLRV collected from different regions of the United States. A portion of leaflet from the virus source plant, P. floridana Rydb., containing approximately 25 M. persicae, was placed on each test plant. Virus infection was assessed based on visual symptoms and double-antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA) and confirmed by aphid transmission from inoculated test plants to a diagnostic host (P. floridana). Infection of the diagnostic host was confirmed based on symptoms and enzyme-linked immunosorbent assay (ELISA). Symptom severity varied markedly among symptomatic host species. Asymptomatic hosts included C. pepo, N. rustica, S. demissum, and Z. elegans. Field collections of two nonhosts, Malva neglecta Wallr. and Cardaria draba, often produced false-positive ELISA assays, but PLRV could not be isolated from these plants by aphid transmission nor detected using a polymerase chain reaction (PCR) assay. Species infected by some virus isolates but not others included C. pepo, H. golfrosens, H. moscheutos, N. rustica, N. tabacum, Lactuca sativa, O. basilicum, S. demissum, S. oleraceae, and Z. elegans. The variability in symptoms and host range indicates a considerable degree of variability in PLRV and may provide a much needed basis for PLRV strain separation and characterization. This work more than doubles the known host range of PLRV.

Spread of zucchini yellow mosaic potyvirus in squash in Hungary

The temporal and spatial distribution of zucchini yellow mosaic potyvirus (ZYMV) was studied in a 3000‐m2 zucchini squash field. The first infected plants were found 4 weeks after the field was exposed to virus source plants. The infection increased to nearly 74% by the end of the study. Alate aphids were active from the beginning of the study and 43 species were trapped in the field. Flights of vector species Acyrthosiphon pisum and Myzus persicae peaked during the fourth week which resulted in high virus incidence 4 weeks later. There was a significant correlation between the number of vectors caught in yellow pan traps and the number of infected plants in the field. In laboratory studies evaluating 11 aphid species, Aphis pomi de Geer was identified as a new vector species of ZYMV. Although this aphid was not caught in our field studies, it may be an important contributor in other areas where cucurbits are grown in close proximity to apple or other hosts of this aphid.

Measuring and modelling the effects of inoculation date and aphid flights on the secondary spread of Beet mosaic virus in sugar beet

The effect of the inoculation date on the spread of Beet mosaic virus (BtMV) in sugar beet field plots was studied. Two plants in the centre of each plot were inoculated with BtMV using Myzus persicae. The spread of the infection around these sources was monitored by inspecting the plants on two diagonal transects through the centre of the plot. Early inoculations resulted in a greater spread than late inoculations, but any inoculation before the onset of the aphid migration resulted in a similar-sized spread. The spread was concentrated in patches around the inoculated plants, and its rate was explained by vector pressure, as shown by regression analysis and a mechanistic simulation model. This vector pressure was quantified using data obtained by catching aphids in a green water trap in the crop, catching aphids in a 12 m high suction trap at a distant location, and infection of bait plants from adjacent virus source plants. The daily total aphid catches obtained by a suction trap provided the best statistical explanation for the spread of this virus. The parameter r, describing the relationship between vector pressure and the rate of disease progress, was remarkably robust. This parameter varied less than 10␋etween treatments (infection date) within a single experiment, and less than a factor two between four experiments performed at different sites in two years. The robustness of this parameter suggests that the spread of a potyvirus may be predicted on the basis of the initial infection date and vector abundance

Behavioral Response and Virus Vector Ability of Myzus persicae (Homoptera: Aphididae) Probing on Pepper Plants Treated with Aphicides

Behavioral response of the green peach aphid, Myzus persicae (Sulzer), to 3 different insecticides (cypermethrin, pirimicarb, and imidacloprid) was assessed on pepper plants, Capsicum annuum L., using electrical monitoring of aphid probing behavior. This technique enabled us to assess stylet penetration pathways as well as cell membrane punctures (potential drops). The effect of these insecticide treatments on potato virus Y (PVY) transmission by M. persicae also was tested. Pirimicarb and imidacloprid did not significantly affect probing behavior or PVY transmission efficiency when aphids were allowed a 10-min acquisition access period on infected insecticide-treated plants. Conversely, cypermethrin affected aphid behavior as well as PVY transmission efficiency. Aphids probing on cypermethrin-treated plants produced fewer (1.7 versus 3.3) and shorter (41 versus 152 s) penetrations than those probing on untreated plants. They also produced a lower number of potential drops (1.3 versus 4.2). Moreover, cypermethrin caused a paralysis of aphids within 2.5 min of exposure to the treated plants. Aphids were not able to subsequently inoculate healthy plants. However, when the acquisition access period was shorter than 2.5 min, aphids were able to efficiently transmit PVY despite the cypermethrin treatment of the virus source plant. The possible existence of an additional deterrent effect caused by cypermethrin on M. persicae and its implications in PVY epidemiology is discussed.

CONTROL REVIEW OF AIR-BORNE TULIP BREAKING VIRUS AND LILY SYMPTOMLESS VIRUS IN LILIUM IN THE NETHERLANDS.

In this study on the air-borne viruses in Lilium, mainly lily symptomless virus (LSV) and tulip breaking virus (TBV), various factors involved in the efficiency of control are dealt with. The incidence of LSV was reduced very substantially from the old 100␛ate. TBV occurs at fairly low rates. Lily virus X (LVX) and cucumber mosaic virus (CMV) occurred at low level in the last decade. The symptoms of TBV to induce the roguing of diseased plants became less important, if the ELISA-testing of bulbs before bulk propagation by the scaling of bulbs and by tissue culture procedures was effectively applied. The reduction in bulb yield and the relative reduced quality of cut flowers indicate the need for virus control. The virus spread as affected by the elimination of virus source plants strongly became dependent on the ELISA-testing. The speed of spread was generally experienced to be differentially rapid over the season, while a range of c. 25 aphid species were able to transmit LSV and TBV. The chemical control of spread is efficiently done by the routine spraying of mineral oil plus pyrethroid. Terpenoids were not effective. Some effect was observed from a pheromone, plant oil, and -pinene polymer emulsion. Deltamethrin and zetamethrin sprays were most effective. The non-chemical control by the polymer web coverage of crops proved impractical under field conditions. The factors in the chain of control which have a weak impact, e.g., delayed elimination of TBV-diseased plants in the field if the ELISA-bulb testing prior to planting is routinely unapplicable in varieties of L. longiflorium and Oriental hybrids, or strong impact, e.g., testing of bulbs by ELISA of a large part of the assortiment of cultivars, chemical control of virus spread, and rapid propagation procedures, on the efficiency to improve the health situation in the lily culture were indicated.

Properties of an unusual isolate of raspberry ringspot virus from grapevine in Germany and evidence for its possible transmission by Paralongidorus maximus

SummaryAn isolate of raspberry ringspot nepovirus (RRV‐P) commonly found infecting grapevine in localised areas of the German Palatinate, was serologically closely related to, but distinguishable from, the English type strain of this virus (RRV‐E) which is transmitted by Longidorus macrosoma. However, unlike RRV‐E, RRV‐P had a restricted herbaceous host range and produced symptoms reliably in only two hosts, Chenopodium quinoa and Nicotiana occidentalis‐accession 37B: these symptoms were a faint systemic vein clearing which, on most occasions in C. quinoa, was transient. In in vitro studies with herbaceous plant sap, RRV‐P infectivity was lost after diluting 1/100‐1/500, after storage at 20oC for 1–3 days and at 4oC for 45 days: for similar studies with RRV‐E, the values were 1/125 000, and more than 15 days at 20oC and 4oC, respectively. RRV‐P was difficult to purify in quantity and in most preparations seemed to sediment as a single component corresponding to ‘bottom’ component of RRV‐E. Purified particles of RRV‐P, like those of RRV‐E, contained a major polypeptide and two RNA species of Mx 54 000, 2.6 × 106 and 1.6 × 106 respectively. There was no evidence from RNA preparations from purified virus particles or, from analysis of dsRNA from infected plants, that RRV‐P contained a satellite RNA. The incidence of RRV‐P in vineyards was not associated with the presence in soils of Longidorus nematodes, but was associated with the distribution in the Palatinate of Paralongidorus maximus. Furthermore, results from an experiment in Germany in a vineyard planted with healthy grapevines in soil fumigated to destroy nematodes, showed spread of RRV‐P into these plants from an adjoining source of infected grapevines and soil infested with P. maximus. In laboratory studies, RRV‐P was transmitted by P. maximus at a very low level between grapevines (used as the virus source and test plants) but not to, or between, herbaceous hosts.

Properties of an unusual isolate of raspberry ringspot virus from grapevine in Germany and evidence for its possible transmission by Paralongidorus maximus

SummaryAn isolate of raspberry ringspot nepovirus (RRV‐P) commonly found infecting grapevine in localised areas of the German Palatinate, was serologically closely related to, but distinguishable from, the English type strain of this virus (RRV‐E) which is transmitted by Longidorus macrosoma. However, unlike RRV‐E, RRV‐P had a restricted herbaceous host range and produced symptoms reliably in only two hosts, Chenopodium quinoa and Nicotiana occidentalis‐accession 37B: these symptoms were a faint systemic vein clearing which, on most occasions in C. quinoa, was transient. In in vitro studies with herbaceous plant sap, RRV‐P infectivity was lost after diluting 1/100 ‐1/500, after storage at 20oC for 1–3 days and at 4oC for 45 days: for similar studies with RRV‐E, the values were 1/125 000, and more than 15 days at 20oC and 4oC, respectively. RRV‐P was difficult to purify in quantity and in most preparations seemed to sediment as a single component corresponding to ‘bottom’ component of RRV‐E. Purified particles of RRV‐P, like those of RRV‐E, contained a major polypeptide and two RNA species of Mr 54 000, 2.6 times 106and 1.6 times 106respectively. There was no evidence from RNA preparations from purified virus particles or, from analysis of dsRNA from infected plants, that RRV‐P contained a satellite RNA. The incidence of RRV‐P in vineyards was not associated with the presence in soils of Longidorus nematodes, but was associated with the distribution in the Palatinate of Paralongidorus maximus. Furthermore, results from an experiment in Germany in a vineyard planted with healthy grapevines in soil fumigated to destroy nematodes, showed spread of RRV‐P into these plants from an adjoining source of infected grapevines and soil infested with P. maximus. In laboratory studies, RRV‐P was transmitted by P. maximus at a very low level between grapevines (used as the virus source and test plants) but not to, or between, herbaceous hosts.

Characterization of Two Viruses Isolated from Patchouli in Japan

Two sap-transmissible viruses were isolated from patchouli (Pogostemon patchouli) in Japan. The virus source plants showed faint mosaic, mottling, or no symptoms. In electron microscopic examinations, however, elongated (760 nm in length) or spherical (27 nm in diameter) viruslike particles were found. The spherical virus, designated patchouli mild mosaic virus (PaMMV), infected plants in seven families and was found to be serologically related to, but different from, broad bean wilt virus. The elongated virus, named patchouli mottle virus (PaMoV), had a narrower host range and was identified as a member of the Potyviridae on the basis of particle morphology, formation of cytoplasmic inclusions, and a distant serological relationship with turnip mosaic potyvirus

The influence of primary infection date and establishment of vector populations on the spread of yellowing viruses in sugar beet

SummaryIn three field experiments in 1985 and 1986, we studied the effect of the date of primary infection on the spread of beet yellows closterovirus (BYV) and beet mild yellowing luteovirus (BMW) from artificially inoculated sugar beet plants. Laboratory‐reared vector aphids, Myzus persicae, were placed on these sources of virus. There was no substantial natural immigration of vectors or viruses. In two experiments, one with BMYV in 1985 and the other in BYV in 1986, populations of vector aphids remained low and there was little virus spread, i.e. c. 50 infected plants from one primarily infected source. The cause of this small amount of spread was the low number of vector aphids. In the third experiment, with BYV in 1986, large populations of M. persicae developed and there was substantial virus spread: c. 2000 infected plants in the plots which were inoculated before canopy closure. In later‐inoculated plots in the same experiment, there was much less spread: c. 100 infected plants per virus source plant. Differences between fields in predator impact are implicated as the most probable factor causing differences in vector establishment and virus spread between these three experiments. Virus spread decreased with later inoculation in all three experiments.A mathematical model of virus spread incorporating results from our work has been used to calculate how the initial proportion of infected plants in a crop affects the final virus incidence. This model takes into account the effect of predation on the development of the aphid populations. The processes underlying the spread and its timing are discussed.

Characterization of a Zucchini Yellow Mosaic Virus Isolate with a Deficient Helper Component

Two isolates of zucchini yellow mosaic virus (ZYMV) were found to be either highly (HAT) or poorly (PAT) aphid-transmissible. The inefficient transmission of ZYMV-PAT was independent of the virus source plant or aphid species used. The ZYMV-PAT and ZYMV-HAT, from which the former was derived, did not differ in their host range or serological properties. Purified virions of either ZYMV-HAT or ZYMV-PAT were readily transmitted by aphids when crude or concentrated helper component (HC) from ZYMV-HAT was provided, but were not transmitted when mixed with crude or concentrated HC from ZYMV-PAT (...)

イネ縞葉枯抵抗性品種に対するイネウイルスの感染性

Rice varieties “Musashi-kogane”, “Tamaminori” and “Tamahonami” which have St2igene for resistance to rice stripe virus (RSV), showed resistance to RSV infection, but no resistance to virus multiplication. Furthermore, the vector Laodelphax striatellus acquired the virus readily on infected “Musashi-kogane” plants as did on susceptible “Nipponbare” plants. Sharp decline in the percentage of viruliferous insects in the overwintering population with the increase in the percentage areas planted with RSV-resistant varieties can be explained by the decrease of virus source plants for the secondary infection. The three RSV-resistant varieties did not show resistance to infection and multiplication of rice black-streaked dwarf virus (RBSDV) and rice dwarf virus (RDV). “Musashi-kogane” as well as “Nipponbare” served as the source of the three viruses for the transmission by their vectors.

Use of enzyme-linked immunosorbent assay to detect potato leafroll virus in field grown potato, cv. Russet Burbank

Use of enzyme-linked immunosorbent assay (ELISA) in detecting potato leafroll infections in field grown potato, cv. Russet Burbank, was studied from 1986 to 1988 at Rosemount, Minnesota. The objective was to determine relative reliability of current season foliage ELISA, tuber tissue ELISA, and tuber progeny foliage ELISA. Serological tests were most accurate when foliage of tuber progenies was tested. ELISA underestimated total leafroll infection when current season foliage from the inoculated plant was used, in those plants inoculated during late tuber bulking stage. Current season foliage ELISA tests using newly expanded terminal leaflets were more reliable than were tests using older leaflets. Leafroll infection was detected in the current season foliage and tuber progenies (tuber tissue as well as tuber progeny foliage) of some plants seven days after inoculation. Most current season foliage infections were detected by day 14–28 depending on year. Differences among years were most likely caused by variation in quality of virus source plants and numbers of vectors used in inoculation. ELISA tests on tuber tissue were almost as effective as ELISA tests on tuber progeny foliage in detecting potato leafroll 20 days after inoculation, but ELISA on tuber tissue substantially underestimated infection if plants were sampled earlier. Maximum percent tuber infection occurred 20 days or more after inoculation. Movement of the virus from the inoculated stem to other stems decreased with increased plant age at inoculation. Percent infected tubers declined with increased plant age at inoculation. Action thresholds developed for aphids in managing potato leafroll virus should take into account the temporal change in percent infected tubers.