Virus-positive Women Research Articles

Seroepidemiological patterns and predictors of hepatitis B, C and HIV viruses among pregnant women attending antenatal care clinic of Atat Hospital, Southern Ethiopia.

Introduction:Viral hepatitis is a serious blood-borne and sexually transmitted systemic communicable disease affecting the liver. Commonly, it is caused by hepatitis B and C viruses. HIV infection has been one of the largest public health challenges that can also be transmitted vertically.Objective:To determine seroepidemiological patterns and predictors of hepatitis B, C and HIV viruses among pregnant women attending antenatal care clinic at Atat Hospital, Southern Ethiopia.Methods:Hospital-based cross-sectional study was conducted among 222 pregnant women from May to July, 2017. A structured questionnaire was used to collect socio-demographic characteristics and predicators of hepatitis B, C and HIV infections through face-to-face interview. Venous blood sample of 5 mL was collected from study participants, and serum was tested for HBsAg, anti-HCV and anti-HIV using rapid test kits and further confirmed by enzyme-linked immunosorbent assay. Logistic regression analysis was used to identify predictors of hepatitis and HIV infections. A p-value less than 0.05 was considered statistically significant.Results:The overall seroprevalence of hepatitis B, C and HIV infections were 4.5%, 1.8% and 2.7%, respectively. In multivariate analysis, the prevalence of hepatitis B virus infections was significantly higher among patients having history of poly-sexual practices (adjusted odds ratio = 11.31; 95% confidence interval = 1.24–28.69, p = 0.003), history of abortion (adjusted odds ratio = 8.64; 95% confidence interval = 5.5–30.36, p = 0.034), home delivery by traditional birth attendants (adjusted odds ratio = 9.06; 95% confidence interval = 2.01–13.36, p = 0.005) and blood transfusion (adjusted odds ratio = 18.1; 95% confidence interval = 2.63–114.24, p = 0.001). HIV co-infection was present in 40% and 100% of hepatitis B virus and hepatitis C virus positive pregnant women, respectively. All hepatitis C virus positive women had a history of ear piercing, abortion and home delivery.Conclusion:Hepatitis B, C and HIV were all uncommon infections in this population, with hepatitis B virus the most common. All hepatitis C virus positive pregnant women were co-infected with HIV. Significant association was found between hepatitis B virus infection and predictors. Therefore, continuous screening of pregnant women for hepatitis B and C infections should be performed.

A randomized controlled trial of azithromycin and sulphadoxine–pyrimethamine as prophylaxis against malaria in pregnancy among human immunodeficiency virus–positive women

Malaria and human immunodeficiency virus (HIV) infections in pregnancy are important and major contributing factors to maternal morbidity and mortality in sub-Saharan Africa. Prevention of malaria in HIV-positive pregnant woman will reduce the burden of malaria-HIV comorbidity. The objective of this study was to compare effects and safety of azithromycin (AZ) with sulphadoxine-pyrimethamine (SP) for intermittent preventive therapy for malaria in HIV-positive pregnant women. We performed a randomized, controlled, open-label pregnancy trial of 140 HIV-positive pregnant patients attending antenatal clinics at the University College Hospital and Adeoyo Maternity Teaching Hospital, Ibadan, Nigeria. Participants were enrolled from a gestational age of 16 weeks and randomized to receive AZ or SP. The primary outcome was peripheral parasitaemia at delivery. Secondary outcomes were drug tolerability, foetal outcome and birthweight. The χ2 test (or Fisher's exact test, as appropriate) and Student's t test were used in the per-protocol analysis. The level of statistical significance was p<0.05. A total of 123 participants (87.9%) completed the study: 60 participants received AZ and 63 received SP. The incidence of malaria parasitaemia at delivery in the AZ group was 6 (10.0%), compared with 7 (11.1%) in the SP group (relative risk 0.89 [95% confidence interval 0.28 to 2.82], p=0.84). Placental parasitization was demonstrated in 1 (1.6%) participant in the SP group compared with 3 (5.0%) in the AZ group (p=0.36). The findings suggest that AZ is comparable to SP in malaria prevention and safety in HIV-positive pregnant women.

Differences between bone mineral density, lean and fat mass of HIV-positive and HIV-negative black women

Objectives: To investigate the differences between bone mineral density (BMD), lean and fat mass of human immunodeficiency virus (HIV-) positive and HIV-negative black women and to investigate fact...

The Effects of Antenatal Health Education on Postnatal Care of HIV-positive Women

This study was carried out in Botswana. The purpose of the study was to determine the effects of antenatal health education on postnatal care among human immunodeficiency virus (HIV) positive women in the city of Francistown, Botswana. The study followed a quantitative research paradigm. Data were collected using a questionnaire from 100 eligible women who consented in writing to participate in the study. A quantitative design and a descriptive cohort quantitative design were used. The researcher collected data from two of the busiest clinics in Francistown that have a workload of 100–150 patients a day. Any HIV-positive woman within the child-bearing age group (15–49 years) who visited the clinic 6–8 weeks postnatal was eligible. Forty-five per cent (n = 45) of women living with HIV who visited the clinic with babies for the 6-weeks postnatal care and 55 per cent (n = 55) brought 8-week old babies either for weighing or for immunisation. The majority (40%) of the women received health education from lay counsellors, 31 per cent from midwives, 15 per cent from doctors and 14 per cent from other sources. Qualified healthcare workers beyond lay counsellors should probably be providing antenatal health education given the expertise that is required to cope with the dynamic changes in healthcare delivery for HIV-positive women. Further studies in African settings are essential to identify the magnitude of utilising health workers that are inappropriately prepared for rendering certain healthcare services.Â

PF-3 Is nigerian breast cancer associated with endogenous retrovirus Xq21.33?

Background: Wildschutte et al recently discovered a new HERV K HML-2 (HK2) endogenous retrovirus Xq21.33 (NCBI GenBank accession no. KU054272) to be uncommonly present in Pygmy populations and in Nigerian people in Africa (&lt;4%). It has been estimated that this virus has been inserted in the human genome between ∼0.67–1.3 Mya and possibly earlier. Since this virus is fully intact and is similar to mouse mammary tumor virus, we looked to see if it is associated with breast cancer in Nigerian populations. Methods: Peripheral blood mononuclear cells were obtained with informed consent from Nigerian women with breast cancer (BCa) (237) and matched controls (225) without BCa. Samples from the United States included samples from a BCa study and HIV study carried out earlier. DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen). Samples were tested for the Xq21.33 virus using primer Xq21.33R2 ACGCTGTTTTGTCCCTTTGA and K1011 CGTCGACTTGTCCTCAATGACCACGCT to screen samples, and primers 1584R TTTGCGTTGACTGAGCCATTACCG, 2499R TTG AGC AAC ATC TTG GAG CCT TGC, 3460R ACTTGCCCAATATGCAGCCTTTCCTCC, 6115R TCAACTATGGCCTGTCCTTGC, F Flank TCAGTCTGAAGACAATGACATACT T and 5359F TCGGCTCAAAGAGCAGAGATGGTT to confirm positive samples. Samples were tested using the Long Amp PCR kit (New England Bio Labs) conditions suggested by the manufacturer using a total volume of 25ul. Hetero vs Homozygosity was determined using F Flank and Xq21.33R2 with Platinum taq Hi Fi Thermo Fisher also using conditions suggested by the manufacturer. Samples with adequate DNA were tested using primer K1011 and Xq21.1R2. Positive samples were all confirmed using Xq21.33R2 to 1584R, 2499R, 3460R and 5359F to F Flank. One batch of samples did not yield good quality DNA and some samples had such low yields of DNA that the data on these patients was not included in this study. Results: We detected 28/220 (12.7%) positive samples in women with BCa vs 23/236 (9.7%) in women without BCa. These differences were not statistically significantly different. 5/28 women with BCa (ages 38, 44, 50, 53, 82) vs 2/23 (ages 32, 58) normal women were homozygous for Xq21.33. As shown below women with BCa and virus were more likely to be post-menopausal (46%) than women without BCa and virus (8.7%). Similarly women with BCa and no virus were also more likely to be post-menopausal 35% vs women with no BCa and no virus 19.7%. There was not enough power in this study to determine if the virus is contributing to more cases of post-menopausal breast cancer in positive women. Among women who are older than 47 years, the proportion of virus xq21.33 positives is higher among women with BCa (14.9%) than women without BCa (5.13%), but it is not significant (P-value = 0.15) [see below] Virus xq21.33 in cases and controls in age groups &gt;47 years n = 126. Among women who are 47 years or younger, the proportion of virus xq21.33 is lower among women with BCa (10.07%) than women without BCa (12.21%), but it is not significant (P-value = 0.60). Virus xq21.33 in cases and controls in age groups &lt;47 years n = 321. We also tested for Xq21.33 in the following USA samples: Conclusions: Our sample size does not provide sufficient power to see if Xq21.33 presents an increased risk for breast cancer. However, the trend too increased risk in virus positive women 12.7% vs 9.7% in controls, and the increase in numbers of women &gt;47 year with +BCa +virus (46.4%) vs the +BCa −virus (35.6%), and the striking low numbers of women in −BCa +virus (8.7%) vs (19.7%) in −BCa −virus and greater homozygosity in +Bca +virus women suggests differences which may be caused by carrying this provirus. We suggest designing trials with adequate sample sizes of virus+ and − young women without BCa to assess the future risk of cancer from this provirus. We are now sequencing the env gene to see if women with BCa have a more replicative competent virus. We are gathering pathological data to see if +women have different forms of BCa than –women. This virus may be still present in Nigerian rodent and primate populations and should be searched for in these animals. It may still infect people contributing to BCa without becoming endogenized. It could be detected by deep sequencing DNA from BCa tissue looking for integrated Xq21,33 in other sites than the X chromosome. Molecular clones and more cell lines, like DT22, should be established from BCa+ Virus+ to look for replicative virus with alternative integration sites. Virus should be searched for in HIV+ Nigerians to see if it contributes to other neoplasms. The discovery of a human BCa virus would present a new way of treating or preventing breast cancer using antiretrovirals.

J-107 Interrogating the immunologic and microbial cervical microenvironment in HPV infection

Infection with high-risk human papillomavirus (hrHPV) infection in the oral and anogenital mucosa has been confirmed to be a necessary but insufficient cause of invasive cervical cancer (ICC), which is a leading cause of cancer incidence and mortality worldwide. Over the past 2 decades, our understanding of the natural history of cervical hrHPV infection has evolved, especially with regard to the influence of co-infections and the dynamics of the cervical microenvironment. For example, it is now recognized that at least a proportion of hrHPV infections are immunologically controlled for long periods of time in an undetectable (latent) state, at risk of recurrent detection (reactivation) upon immune suppression.1 This phenomenon is most clearly illustrated when comparing the HPV natural history in HIV-infected and HIV-uninfected individuals, where both incident and persistent detection of HPV is proportionally increased with increasing immune suppression.2 Multiple new type cervical HPV detection increases nearly 4-fold within weeks of acute HIV infection, suggesting a key role for tissue resident T-cell memory in control of latent HPV infection.3 In HIV-uninfected women, we have observed polarization toward T-helper type 2 immune profiles of the lower genital tract immune microenvironment. In an older, well-screened US population, HPV positive women exhibited immune profiles similar to those described in allergic inflammation.4 In the developing world, we have reported an increased prevalence of HPV infection at older ages in Amazonian women with soil-transmitted helminth (STH) infection, who showed evidence of Th2-skewed immunity in lower genital tract secretions compared with STH-uninfected women.5 This epidemiologic evidence, combined with experimental animal models of papillomavirus infection, collectively implicate a key role of host immunity in the control of cervical HPV infection and, by extension, risk of cervical cancer. This presentation will make a case that the time has come to move human HPV natural history studies away from traditional designs with large sample sizes and long interval censored sampling (eg, every 6 months) to designs with smaller sample sizes and more frequent sampling density (eg, every week) to allow interrogation of the dynamic interplay between the shifting microenvironment and HPV detection. Prioritizing a focus on understanding the dynamics and immune mediators involved in healthy control of HPV infection may be an overlooked fundamental system component required to fully understand the causes of dysregulation of HPV infection and persistent detection. This represents a paradigm shift in studying the molecular epidemiology of human viral infections, reflects more fully a systems approach to understanding biological complexity, and may lead to development of less invasive interventions at earlier stages in viral natural history to prevent severe pathological outcomes. REFERENCES 1. Gravitt PE. The known unknowns of HPV natural history. J Clin Invest. 2011;121:4593–4599. 2. Strickler HD, Burk RD, Fazzari M, et al. Natural history and possible reactivation of human papillomavirus in human immunodeficiency virus-positive women. J Natl Cancer Inst. 2005;97:577–586. 3. Nowak RG, Gravitt PE, Morrison CS, et al. Increases in human papillomavirus detection during early HIV infection among women in Zimbabwe. J Infect Dis. 2011;203:1182–1191. 4. Marks MA, Viscidi RP, Chang K, et al. Differences in the concentration and correlation of cervical immune markers among HPV positive and negative perimenopausal women. Cytokine. 2011;56:798–803. 5. Gravitt PE, Marks M, Kosek M, et al. Soil-transmitted helminth infections are associated with an increase in human papillomavirus prevalence and a T-helper type 2 cytokine signature in cervical fluids. J Infect Dis. 2016;213:723–730.

Epstein-Barr Virus, High-Risk Human Papillomavirus and Abnormal Cervical Cytology in a Prospective Cohort of African Female Sex Workers.

High-oncogenic-risk human papillomavirus (hrHPV) is necessary, although insufficient, to promote cervical cancer. Like HPV, Epstein-Barr virus (EBV) is a common pathogen with the capacity to promote epithelial neoplasms. We examined the association between cervical EBV, hrHPV, and cytology in female sex workers in Nairobi, Kenya. Women (n = 332) with known cervical cytology and hrHPV mRNA results were evaluated for cervical EBV DNA by conventional polymerase chain reaction. Prevalence ratios (PRs) were calculated to assess the relationships between EBV, hrHPV, and cervical cytology. Prospective analyses used risk ratios and time-to-event analyses to determine the association of EBV with hrHPV clearance and with abnormal cytology outcomes. Baseline prevalence of hrHPV and EBV was 29% and 19%, respectively. Higher EBV prevalence was found among women with older age, HIV, hrHPV, abnormal cytology, Mycoplasma genitalium infection, smoking habits, younger age at sexual debut, and less frequent condom use. At baseline, women with EBV had a higher prevalence of hrHPV infection than did EBV-negative women (52% vs. 24%; HIV-adjusted PR [95% confidence interval], 1.8 [1.3-2.6]). Epstein-Barr virus-positive women had a higher prevalence than did EBV-negative women of high-grade precancer (15% vs. 2%) and abnormal cytology (37% vs. 15%), although HIV- and hrHPV-adjusted associations were not significant (high-grade precancer: PR, 2.0 [0.7-5.9]; abnormal cytology: PR, 1.4 [0.9-2.2]). In prospective analyses, a marginal association was observed between baseline EBV detection and delayed hrHPV clearance. Our data support a possible role for EBV as a high-risk marker or cofactor for HPV-mediated cervical cancer development.

Factors affecting long acting and permanent contraceptive methods utilization among HIV positive married women attending care at ART clinics in Northwest Ethiopia

BackgroundGlobally, unintended pregnancy has been very high accounting for 27% of maternal deaths. Different studies noted that nearly half of HIV positive women who gave unintended birth were using contraceptive methods prior to their unintended pregnancy. This implies that contraceptive failure contributes to unintended pregnancy. Long-term and permanent contraceptive methods are safe and effective contraceptive options. In women who are using long acting and permanent methods, the unintended pregnancy rate is very low and it is almost the same both in typical and perfect users. However, there is limited information on factors that affect long acting and permanent contraceptive methods utilization among Human Immuno-deficiency Virus (HIV) positive women in Ethiopia. Therefore, the purpose of this study was to assess long acting and permanent contraceptive utilization and its associated factors.MethodsAn institution-based cross-sectional study was conducted among 505 married women attending care at Anti Retroviral Therapy (ART) clinics in Bahir Dar from March 16, 2014 to April 15, 2014. The data were collected using a structured and interviewer administered questionnaire. Both bivariate and multivariate logistic regressions were used to identify associated factors.ResultsA total of 505 married women participated in the study with a response rate of 99.6%. The utilization of long acting and permanent contraceptive methods (LAPMs) was 27.5% [95% CI, 23.8–31.5]. The multivariate analyses showed that women who were getting pre- anti retroviral therapy (Pre-ART) services [Adjusted Odds Ratio = 2.65, 95% confidence interval: 1.44, 4.86], had spousal discussion on family planning sometimes [Adjusted Odds Ratio = 6.03, 95% CI:2.42–15.01] and frequently [Adjusted Odds Ratio = 6.61, 95% confidence interval: 2.49–17.47], had previous experience on long acting contraceptive methods [Adjusted Odds Ratio = 9.06, 95% confidence interval: 5.38–15.26], no exposure to myths about LAPMs [Adjusted Odds Ratio = 2.07, 95% confidence interval: 1.24–3.45], had birth intention after 2 years [Adjusted Odds Ratio = 6.95, 95% confidence interval: 3.35–14.42], and no such intention [Adjusted Odds Ratio = 7.60, 95% confidence interval: 3.77–15.34] were factors significantly associated with utilization of long acting and permanent contraceptive methods.ConclusionThe utilization of long acting and permanent contraceptive methods was relatively high. Discussion with partners on family planning, previous experiences of LAPMs, not hearing myths about LAPMs, women not started ART, and no birth intention were positively associated with LAPMs utilization. It is therefore recommended that health service providers need to make couples counseling on FP, undergo behavioral change communication (BCC) to avoid misconceptions/myths regarding LAPMs. Further research is also recommended to address the gaps mentioned in the limitation section and to explore the reason/s for not using LAPMs (qualitative study).

Burden of tuberculosis in HIV-positive pregnant women in Cape Town, South Africa

The burden of active tuberculosis (TB) in pregnancy compared with preconception and postpartum is unclear, particularly with universal antiretroviral therapy (ART) initiation in pregnancy. We retrospectively compared active TB incidence in the 18 months preconception, during pregnancy and up to 6 months postpartum in human immunodeficiency virus (HIV) positive women attending antenatal care at a primary health care facility in Cape Town from 2013 to 2014. Among 1513 women (4116 person-years [py]), 1489 (98.4%) received lifelong ART in pregnancy, and 79 TB episodes were identified. Unadjusted TB incidence rates (IR) preconception, during pregnancy and postpartum were 2466 (95%CI 1863-3202), 1127 (95% CI 600-1928) and 1447 (95% CI 694-2661) per 100 000 py, respectively. Adjusting for age and CD4 count at first antenatal visit and ART status, TB risk was lower during pregnancy (incidence rate ratio [IRR] 0.17 vs. preconception, 95%CI 0.09-0.31) and increased slightly postpartum (IRR 1.31 vs. pregnancy, 95%CI 0.56-3.07). Among HIV-positive women in South Africa, the TB burden preconception, during pregnancy and postpartum was substantial. The risk of TB during pregnancy was lower than preconception, but increased slightly postpartum; this represents missed opportunities for diagnosis, prevention and control. Improved TB prevention strategies and integrated care for HIV-positive women and their children are needed.

Low uptake of cervical cancer screening among HIV positive women in Gondar University referral hospital, Northwest Ethiopia: cross-sectional study design

BackgroundCervical cancer is one of the leading causes of death in women worldwide. Majority of the cases are found in developing countries. The increasing risk of cervical cancer death and the high prevalence of human papilloma virus (HPV) infection in Human immuno-deficiency virus(HIV) positive women calls for determining the level of premalignant cervical cancer (Ca) screening uptake. So, this study aimed to assess the uptake of cervical cancer screening and its associated factors.MethodsAn institution based cross sectional study was conducted from April to May, 2016, among adult HIV positive women attending care and treatment at Gondar University Referral Hospital. The data were collected using an interviewer administered questionnaire.Bivariate and multivariable logistic regression analyses were used to determine the presence and the degree of association between dependent and independent variables. In the multivariable logistic analysis, a P-value of < 0.05 and odds ratio with a 95% confidence interval were considered to determine independent predictors for the uptake of cervical cancer(Ca) screening.ResultsThe life-time uptake of cervical cancer screening among HIV positive women was 10% (95% Confidence Interval(CI): 7.3–12.8). In multivariable the analysis, women with primary education (Adjusted Odds Ratio(AOR) = 3.92, 95%CI:1.70–8.99), secondary education (AOR = 3.84, 95%CI: 1.50–9.83), and tertiary level education (AOR = 4.16, 95%CI: 1.24–13.98), having a child (AOR = 3.02, 95%CI: 1.23–7.46), diagnosed as HIV positive ten years back or more (AOR = 2.71, 95% CI: 1.06–6.97), and Cell Differentiation 4(CD4) count of less than or equal to 200cell/mm3 (AOR = 5.29, 95% CI: 2.58–10.83) were significantly associated with the uptake of cervical cancer screening.ConclusionIn this study, the uptake of cervical cancer screening was very low. Educational status, parity, length of time after diagnosis as HIV positive, and CD4 count are important predictors of cervical cancer screening. Health care workers and cervical cancer prevention and control program coordinators and implementers need to provide counseling services for all Anti-retroviral Therapy(ART) care attendants. So as to explore the root causes for the low utilization of precancerous stage of cervical Ca screening service, conducting a study on the supply side with a qualitative component is mandatory.

Effect of Gestational Age at Tenofovir-Emtricitabine-Efavirenz Initiation on Adverse Birth Outcomes in Botswana.

Among human immunodeficiency virus-positive women in Botswana on the recommended first-line antiretroviral therapy regimen, tenofovir-emtricitabine-efavirenz, initiated within the first or early second trimester, we found no increased risk of stillbirth, neonatal death, preterm/very preterm delivery, or the infant being born small or very small for gestational age. Treatment with tenofovir-emtricitabine-efavirenz <1 year before conception increased the risk of preterm delivery slightly over late-second-trimester treatment initiation (adjusted risk ratio, 1.33 [95% confidence interval, 1.04-1.70]).

Effectiveness and associated factors of prevention for mother-to-child human immunodeficiency virus transmission in 536 human immunodeficiency virus-positive pregnant women in Hubei Province

Objective To evaluate the effectiveness and associated factors of prevention of mother-to-child human immunodeficiency virus (HIV) transmission in Hubei Province, and to provide a reference for prevention of mother-to-child transmission of HIV. Methods In this prospective cohort study, HIV-positive pregnant women who were in some counties and cities of Hubei Province from January 2004 to December 2016 were enrolled. Prevention of mother-to-child transmission of HIV was conducted for these HIV-positive pregnant women and their infants, and their clinical data were collected. Descriptive analysis and χ2 test were used to analyze the general characteristics of HIV-positive pregnant women and their infants. Logistic regression analysis was adopted to explore the associated factors of mother-to-child HIV transmission. Results In total, 536 HIV-positive pregnant women (628 pregnancies) were found, among which, 334 pregnant women and 345 infants were enrolled in this study. Twenty-four infants were HIV-positive, which was 6.96% in all infants (95%CI: 4.27%-9.64%). The rates of mother-to-child HIV transmission without prevention, formula feeding only, infant medication plus formula feeding, mother and infant medication plus formula feeding were 35.71% (95%CI: 21.61%-51.93%), 8.82% (95%CI: 2.08%-15.57%), 7.41% (95%CI: 0.92%-24.22%), and 0.48% (95%CI: 0.01%-2.64%), respectively. No antiretroviral medications during delivery (OR=14.484, 95%CI: 1.740-120.577, P=0.013), breastfeeding (OR=6.542, 95%CI: 2.416-17.713, P=0.000), and CD4+ T lymphocyte count<200 cells/μL during delivery (OR=3.060, 95%CI: 1.076-8.703, P=0.036) were independent risk factors of mother-to-child HIV transmission. Conclusions The rate of mother-to-child HIV transmission without prevention is high in Hubei Province, which can be significantly reduced by comprehensive interventions (mother and infant medication plus formula feeding). Thus, we should diagnose HIV-positive pregnant women as early as possible, and should give pregnant woman antiretroviral therapy plus infant medication and formula feeding to further reduce the rate of mother-to-child HIV transmission. Key words: HIV; Pregnant women; Prevention of mother to child transmission; Associated factors

Hematological parameters of human immunodeficiency virus positive pregnant women on antiretroviral therapy in Aminu Kano Teaching Hospital Kano, North Western Nigeria.

CONTEXT:Human immunodeficiency virus (HIV) scourge continues to affect young women within the reproductive age group and pregnancy is a recognized indication for the use antiretroviral (ARV) drugs among HIV-positive women.AIMS:The aim is to determine the combined effect of pregnancy, HIV and ARV drugs on the hematological parameters of the pregnant women.SETTINGS AND DESIGN:This was a comparative cross-sectional study conducted among 70 each of HIV-positive and negative pregnant women.SUBJECTS AND METHODS:Bio-demographic and clinical data were extracted from the client folder and 4 ml of blood sample was obtained from each participant. Full blood count was generated using Swelab automatic hematology analyzer while reticulocyte count and erythrocyte sedimentation rate (ESR) were conducted manually.STATISTICAL ANALYSIS USED:Data analysis was performed using SPSS version software 16 while P < 0.05 was considered statistically significant.RESULTS:Pregnant women with HIV had statistically significant lower hematocrit and white blood cell (WBC) and higher ESR than pregnant women without HIV (P < 0.000). There was no statistically significant difference between the two groups in terms of platelet and reticulocyte (P > 0.05). However, among HIV positive pregnant women, those with CD4 count <350/μL had statistically significant lower WBC and lymphocyte count than those with CD4 count ≥350/μL (P < 0.05), whereas, those on zidovudine (AZT)-containing treatment had statistically significant lower hematocrit and higher mean cell volume than those on non-AZT-containing treatment (P < 0.05), but there was no statistically significant difference in any of the hematological parameters (P > 0.050) between women on first- and second-line ARV regimens.CONCLUSIONS:There is a significant difference in terms of hematological parameters between HIV-positive and HIV-negative pregnant women in this environment.

Endocervicoscopy and Biopsy to Detect Cervical Intraepithelial Squamous Neoplasia in Nonvisible Squamocolumnar Junction With Unsatisfactory Colposcopy: A Pilot Study.

The aim of this study was to investigate the practical utility of endocervicoscopy and targeted biopsy in high-risk human papilloma virus–positive women with abnormal squamous cells on cervical cytology and unsatisfactory colposcopy with nonvisible squamocolumnar junction. Seventy-seven high-risk human papilloma virus–positive patients with abnormal cervical cytology for squamous cells bearing type 3 transformation zone were enrolled. Endoscopic examination of the endocervical epithelium, with office-based continuous-flow hysteroscopy after application of acetic acid 5%, followed by targeted biopsies and consequent large loop excision of the transformation zone was carried out. Sensitivity, specificity, positive predictive value and negative predictive value of endocervicoscopy, and orientated biopsy were confronted with the results of large loop excision of the transformation zone (referral test). The sensitivity and specificity of endocervicoscopy and orientated biopsy for low-grade cervical intraepithelial neoplasia were 53% and 81%, respectively, while the sensitivity and specificity for high-grade cervical intraepithelial neoplasia were 64% and 47%, respectively. The positive predictive value for low-grade cervical intraepithelial neoplasia was 64% and for high-grade cervical intraepithelial neoplasia was 88%. The negative predictive value for low-grade cervical intraepithelial neoplasia was 87% and for high-grade cervical intraepithelial neoplasia was 41%. Endocervicoscopy is a safe, office-based technique. It is a reliable method to detect the transformation zone in patients with type 3 transformation zone and unsatisfactory colposcopy. It potentially allows target biopsy of the transformation zone but presents a relatively low specificity/negative predictive value to predict high-grade cervical intraepithelial neoplasia, thus negative biopsy results should be interpreted with caution.

Perinatal management of hepatitis B virus: Clinical implementation of updated Australasian management guidelines.

To evaluate the implementation of the 2013 Royal Australian and New Zealand College of Obstetricians and Gynaecologists 'Management of Hepatitis B in Pregnancy' guideline. Retrospective cohort study of the clinical management and obstetric outcomes among hepatitis B virus-positive women in a single tertiary maternity hospital. Women with viral load >200,000 IU/ml were referred to a specialised clinic for consideration of tenofovir disoproxil fumarate therapy to reduce mother to child transmission. A total of 11,496 women gave birth during the study period, of which 101 (0.9%) women were hepatitis B virus positive. Viral load was measured in 99 (98%) of 101 hepatitis B virus-positive women; 30 (30%) had a viral load >200,000 IU/ml. Twenty-six women accepted tenofovir disoproxil fumarate; of these, 23 had a successful virological response (viral load <200,000 IU/ml before delivery). Adherence to updated management guidelines and patient acceptance of tenofovir disoproxil fumarate in our Australian population were high when provided in the context of a dedicated perinatal service.

Hepatitis C in pregnancy: screening, treatment, and management

In the United States, 1-2.5% of pregnant women are infected with hepatitis C virus, which carries an approximately 5% risk of transmission from mother to infant. Hepatitis C virus can be transmitted to the infant in utero or during the peripartum period, and infection during pregnancy is associated with increased risk of adverse fetal outcomes, including fetal growth restriction and low birthweight. The purpose of this document is to discuss the current evidence regarding hepatitis C virus in pregnancy and to provide recommendations on screening, treatment, and management of this disease during pregnancy. The following are Society for Maternal-Fetal Medicine recommendations: (1) We recommend that obstetric care providers screen women who are at increased risk for hepatitis C infection by testing for anti-hepatitis C virus antibodies at their first prenatal visit. If initial results are negative, hepatitis C screening should be repeated later in pregnancy in women with persistent or new risk factors for hepatitis C infection (eg, new or ongoing use of injected or intranasal illicit drugs) (GRADE 1B). (2) We recommend that obstetric care providers screen hepatitis C virus-positive pregnant women for other sexually transmitted diseases, including HIV, syphilis, gonorrhea, chlamydia, and hepatitis B virus (GRADE 1B). (3) We suggest that patientswith hepatitis C virus, including pregnant women, be counseled to abstain from alcohol (Best Practice). (4) We recommend that direct-acting antiviral regimens only be used in the setting of a clinical trialor that antiviral treatment be deferred to the postpartum period as direct-acting antiviral regimens are not currently approved for use in pregnancy (GRADE 1C). (5) We suggest that if invasive prenatal diagnostic testing is requested, women be counseled that data on the risk of vertical transmission are reassuring but limited; amniocentesis is recommended over chorionic villus sampling given the lackofdata on the latter (GRADE 2C). (6) We recommend against cesarean delivery solely for the indication ofhepatitis C virus (GRADE 1B). (7) We recommend that obstetric care providers avoid internal fetalmonitoring, prolonged rupture of membranes, and episiotomy in managing labor in hepatitis C virus-positive women (GRADE 1B). (8) We recommend that providers not discourage breast-feeding based on a positive hepatitis C virus infection status (GRADE 1A).

Utility of gene methylation analysis, cytological examination, and HPV-16/18 genotyping in triage of high-risk human papilloma virus-positive women.

In 2015, the American Society for Colposcopy and Cervical Pathology and the Society of Gynecologic Oncology issued interim guidance for the use of a human papillomavirus (HPV) test for primary screening, suggesting triage of women positive for high-risk human papillomavirus (hrHPV) by HPV-16/18 genotyping and cytology for women positive for non-16/18 hrHPV. The design of the present study was based on this interim guidance and analysis of the methylation status of specific candidate genes, which has been proposed as a tool to reduce unnecessary referral following primary HPV screening for cervical cancer. We performed a hospital-based case-control study including 312 hrHPV-positive women. hrHPV genotyping was performed by nested multiplex PCR assay with type-specific primers.Residual cervical cells from liquid-based cytology were used for extraction of genomic DNA for assessment of the methylation status of PAX1, ZNF582, SOX1, and NKX6-1 and HPV genotyping. Combined with HPV-16/18 genotyping, both a dual methylation test for PAX1/ZNF582 and testing for ZNF582 methylation demonstrated 100% association of methylation with pathology results, indicating carcinoma in situ or squamous cell carcinoma. The sensitivity and specificity of the dual methylation test for PAX1/ZNF582 as a reflex test for identification of CIN3+ lesions were 78.85% and 73.55% (odds ratio = 10.37, 95% confidence interval = 4.76–22.58), respectively. This strategy could reduce the number of patients referred for colposcopic examination by 31.3% compared with cytology, and thus provide a feasible follow-up solution in regions where colposcopy is not readily available. This strategy could also prevent unnecessary anxiety in women with hrHPV infection.

Effect of antiretroviral therapy on changes in the fertility intentions of human immunodeficiency virus-positive women in Addis Ababa, Ethiopia: a prospective follow-up study.

OBJECTIVESWith access to antiretroviral therapy (ART), people living with human immunodeficiency virus (HIV) are able to consider childbearing to a greater extent than previously. In many cases, ART has transformed their intentions to have children. The present study aimed to assess changes in fertility intentions 12 months after ART initiation among HIV-positive women in Addis Ababa, Ethiopia.METHODSAn institution-based follow-up study was conducted among 360 HIV-positive women in Addis Ababa. A logistic regression model was used to assess the influence of socio-demographic, reproductive health, and clinical characteristics on changes in the fertility intentions of women.RESULTSOverall, 40.8% (147 of 360) of the women reported that they desired to have a child in the future at the baseline visit, while 48.3% (174 of 360) did so at the 12-month follow-up. The proportion of women who reported that they desired to have a child 12 months after ART initiation was higher among ART-initiated women (55.8%, 106 of 190) than ART-naïve women (40.0%, 68 of 170). The adjusted analysis indicated that a change in fertility intentions between baseline and the follow-up visit was significantly associated with ART use (adjusted odds ratio [aOR], 2.47; 95% confidence interval [CI], 1.20 to 5.20) and marital status, with single (aOR, 5.33; 95% CI, 1.10 to 25.92) and married (aOR, 6.35; 95% CI, 1.44 to 27.99) women being more likely to report fertility intentions than divorced/widowed women.CONCLUSIONSART use was a significant predictor of change in fertility intentions between the baseline and follow-up visit, which suggests that additional efforts are necessary to integrate family planning and HIV services to address the safe fertility goals of women in the study area.

Randomized trial of stopping or continuing ART among postpartum women with pre-ART CD4 ≥ 400 cells/mm3.

BackgroundHealth benefits of postpartum antiretroviral therapy (ART) for human immunodeficiency virus (HIV) positive women with high CD4+ T-counts have not been assessed in randomized trials.MethodsAsymptomatic, HIV-positive, non-breastfeeding women with pre-ART CD4+ T-cell counts ≥ 400 cells/mm3 started on ART during pregnancy were randomized up to 42 days after delivery to continue or discontinue ART. Lopinavir/ritonavir plus tenofovir/emtricitabine was the preferred ART regimen. The sample size was selected to provide 88% power to detect a 50% reduction from an annualized primary event rate of 2.07%. A post-hoc analysis evaluated HIV/AIDS-related and World Health Organization (WHO) Stage 2 and 3 events. All analyses were intent to treat.Results1652 women from 52 sites in Argentina, Botswana, Brazil, China, Haiti, Peru, Thailand and the US were enrolled (1/2010-11/2014). Median age was 28 years and major racial categories were Black African (28%), Asian (25%) White (15%). Median entry CD4 count was 696 cells/mm3 (IQR 575–869), median ART exposure prior to delivery was 19 weeks (IQR 13–24) and 94% had entry HIV-1 RNA < 1000 copies/ml. After a median follow-up of 2.3 years, the primary composite endpoint rate was significantly lower than expected, and not significantly different between arms (continue arm 0.21 /100 person years(py); discontinue 0.31/100 py, Hazard ratio (HR) 0.68, 95% CI: 0.19, 2.40). WHO Stage 2 and 3 events were significantly reduced with continued ART (2.08/100 py vs. 4.36/100 py in the discontinue arm; HR 0.48, 95%CI: 0.33, 0.70). Toxicity rates did not differ significantly between arms. Among women randomized to continue ART, 189/827 (23%) had virologic failure; of the 155 with resistance testing, 103 (66%) failed without resistance to their current regimen, suggesting non-adherence.ConclusionsOverall, serious clinical events were rare among young HIV-positive post-partum women with high CD4 cell counts. Continued ART was safe and was associated with a halving of the rate of WHO 2/3 conditions. Virologic failure rates were high, underscoring the urgent need to improve adherence in this population.Trial registrationClinicalTrials.gov NCT00955968

What is the relationship between increased access to HAART, relationship status and fertility decisions amongst HIV-positive women? A literature review and meta-analysis.

To investigate the relationship between fertility decisions, to have already had a child or to desire to have one in the future, and the prognostic factors; access to antiretrovirals, the time since these became widely available (year of the study); and relationship status. There have been significant advances in the treatment of human immunodeficiency virus with the advent of antiretroviral therapy which has been used to successfully reduce the rate of mother to child transmission; leading researchers to hypothesise that human immunodeficiency virus-positive women may desire to have children more so now than in the past. However, this topic is often not discussed in healthcare consultations. A systematic search was conducted on Cumulative Index of Nursing and Allied Health Literature and Medline, using the key terms 'fertility decisions' and 'human immunodeficiency virus positive'. A meta-analysis of proportions and a meta-regression were conducted using a random-effects model and a logit transformation to normalise the data. Heterogeneity was assessed using Q, I2 and R2 values, and p-values were produced for each regressed variable. There was no statistically significant relationship between a desire to have children in the future and any of the prognostic variables. However, there were statistically significant relationships between already having had at least one child; being on antiretroviral therapy; wanting a child in the future; and being in a cohabiting partnership or marriage. There are no reliable prognostic variables which can be used to predict fertility intentions in human immunodeficiency virus-positive women. There is, however, a significant proportion of women who wish to have children or who have already had children and are in need of reproductive counselling from their healthcare providers. A greater knowledge of factors which may influence reproductive decisions amongst human immunodeficiency virus-positive position will allow healthcare professionals to individualise the care they provide.