Viral Agents Research Articles

P478 HEART TRANSPLANT IN SARS–COV2 POSITIVE RECIPIENT: MANAGEMENT PROTOCOL OF WORLD‘S FIRST CASE

Abstract During SARS–CoV2 pandemic, transplant programs had to devise strategies to deal with the possibility of COVID–19–positive donors and recipients. In March 2022, a 60–year–old man with dilated cardiomyopathy on the transplant waitlist was admitted to our Unit as a possible donation was presented. On arrival, he tested positive for SARS–CoV2. The patient had no clinical evidence of COVID–19; he had completed the vaccination cycle; chest X–rays did not show interstitial pneumonia. Aware of the increased risk, we proceeded with the transplant. Sotrovimab, a novel anti–viral agent specific for COVID–19, was administered. Prophylactic antibiotics were started. He received anti–thymocyte immunoglobulins 125 mg for 2 days and methylprednisolone 1 g after aortic declamping and then 125 mg TID for 2 days for induction immunosuppression. Maintaining therapy included corticosteroids and tacrolimus. On the 7th day the patient tested negative at SARS–CoV2 swab. As kidney function worsened, hemodialysis was started. On the 17th day signs of cellulitis of the left thigh appeared, and inflammation indices (CRP, PCT) rose. A hemoculture positive for A. baumannii (MDR–AB) was obtained; hence the patient was treated with Cefiderocol and Colistine. A Cytosorb filter was added to the hemodialysis and Pentaglobin was started. After 3 weeks, hemodynamics started to improve, inotrope support was suspended, with reduction of inflammation indices, negative hemocultures, recovering kidney function. After two weeks, the patient abruptly presented fever, marked hypotension and dyspnea. He underwent intubation, inotrope therapy, broad–spectrum antibiotic therapy, intravenous Immunoglobulins and a cycle of Polymyxin B Hemoperfusion. Nevertheless, hemodynamics decidedly failed. Chest X–rays showed bilateral pneumonia. Hemocultures were positive for MDR–AB. Leukopenia developed (WBC 0,10). Three days after the first signs of a new infective episode, the patient had died. Notwithstanding the difficulties of SARS–CoV2 pandemic, tempestive diagnosis and treatment allow transplant programs to proceed unhindered.

Immunotropic effects of including a combination of hepatoprotectors in the complex therapy of chronic pancreatitis combined with chronic viral hepatitis C

Among significant etiological factors contributing to chronic pancreatitis (CP), the infectious factor plays a role in 56.88% of patients and the hepatobiliary factor in 44.50%, which has drawn attention to the particular importance of these factors. Hepatitis C virus (HCV) is the most common and important viral agent that causes or worsens CP. HCV is not only a disease of the liver but also a systemic (generalized) infection that involves other organs, in particular the pancreas and the immune system.
 The aim is to study the state of the cellular and humoral immune systems of patients with CP against the background of treated chronic HCV (CHCV) under the influence of the proposed complex treatment with the additional inclusion of hepatotrophic drugs heparizine (HZ) and metadoxine (MD).
 Materials and methods. We examined 80 patients with a combined course of CP and CHCV. According to the methods of treatment, the patients were divided into 3 groups: group 1 (20 patients with CP and CHCV) received the generally accepted complex of protocol treatment (PT) for three months; group 2 (25 patients with CP and CHCV) received PT with the additional inclusion of the hepatotrophic agent Heparizine PLC 1 capsule 3 times a day after meals for 3 months; and group 3 (35 patients with CP and CVHC with CAGE ≥2.0) received PT with the additional inclusion of the hepatotrophic agent Heparizine PLC (one capsule) 3 times a day after meals for 3 months with the addition of MD (Liveria IS) 500 mg (one tablet) 2 times a day 15–30 min before meals for 3 months.
 Results and discussion. With the additional administration of HZ, a higher dynamics of cellular immunity indices was reached in relation to those in the PT group. When using a combination of HZ and MD, even better results were obtained in the dynamics of the following indices: an increase in the total population of T-lymphocytes by 5.2%, 22.9%, and 57.7% in groups 1–3, respectively; NK cells — by 13.1%, 23.0%, and 39.4%; T-helpers — by 10.7%, 22.8%, and 36.3%; T-suppressors — by 26.0%, 38.9%, and 45.3%; a decrease in the number of B-lymphocytes — by 10.4%, 18.9%, and 35.6%. An increase in the immunoregulatory index (CD4/CD8) was also achieved — by 11.5%, 17.7%, and 45.7%. The decrease in the levels of B-lymphocytes under the influence of treatment in all three groups was accompanied by a decrease in the activation of humoral factors in groups 1–3, respectively: a decrease in the content of IgG in blood serum by 8.7%, 15.5%, and 19.2%; IgA — by 21.8%, 70.2%, and 88.5%; and IgM — by 24.0%, 55.5%, and 84.9%; as well as a significant decrease in the levels of circulating immune complexes by 38.6%, 1.9 times and 2.9 times (p<0.001).
 Conclusion. A positive immunocorrective effect of all three programs of complex treatment was proven, with a significantly higher level of those with the additional inclusion of HZ and especially the combination of HZ and MD in the complex therapy of patients with CP against the background of CHCV treated causally. Based on the results of correcting cellular and humoral immunity as an integral part of nutritional trophological status, it seems reasonable to include the proposed programs to eliminate nutritional and other disorders in people with CP and CHCV.

Preventing mycelial spread of Heterobasidion annosum in young Scots pine stands using fungal and viral biocontrol agents

Heterobasidion annosum is one of the most important causal agents of root rot of pines in Europe. The timing of cuttings to wintertime or stump treatment by control agents in summertime are used to prevent the spread of the fungus to new forest sites via aerial spores. However, there are no efficient control treatments for an already established infection except for changing the tree species to a resistant one, which often is not possible. In this study, we tested whether treating stumps around Heterobasidion disease centres by the biocontrol fungus Phlebiopsis gigantea could reduce the spread of the pathogen. In addition, we tested whether the infection of H. annosum by a debilitating mycovirus, HetPV13-an1, would affect the control efficacy. The results showed that the enlargement of disease centres was reduced by P. gigantea, and that this biocontrol effect was enhanced by the virus application. Furthermore, the results showed that the growth rate of P. gigantea varies not only between root systems, but also among different roots of a single stump.

Glycine efficacy in clinical practice. Review article

Glycine plays an essential role in human metabolism and nutrition; it is an integral component of many organismal elements, which is an opportunity for the widespread use of this amino acid in various pathologies. The purpose of the review is to combine the available data on the efficacy of glycine therapy in various pathologies. Materials and methods. We identified potentially relevant studies by searching the electronic databases MEDLINE, SCOPUS, PubMed, Google Scholar, and the Cochrane Database of Sys tematic Reviews over the last decade up to November 2022 using the terms: glycine, aminoacetic acid, therapy, stroke, stress, chronic stress, oxidative stress, cerebrovascular accidents, alcoholism. Further, ac cording to the inclusion and exclusion criteria, as well as by means of independent selection, all the authors of this article selected sources that met the criteria and compiled this review. Results. To date, there are quite a few studies on the use of glycine in various pathologies, however, the available data allow making a conclusion about prospective viability of using glycine in chronic stress, various cognitive impairments, ADHD therapy, chronic alcoholism, post-COVID syndrome, and diseases associated with viral agents.

Basic therapy for viral diseases of the upper respiratory tract

The high prevalence of inflammatory diseases of the upper respiratory tract brings this pathology to the forefront, occupying up to 90% of cases of contacting specialists among all infectious diseases. The main etiological factor in the occurrence of acute inflammatory diseases of the upper respiratory tract, such as rhinitis, rhinosinusitis, pharyngitis, is the defeat of a viral agent. At the same time, the damaging viral agents are extremely diverse. In turn, an incorrectly selected initial therapy can lead to a weakening of local nonspecific immunity, which in turn forms a starting point for the attachment of a bacterial infection and the development of acute bacterial rhinosinusitis. Due to the high prevalence of infections of the upper respiratory tract and unreasonable systemic antibiotic therapy, it is the main factor contributing to the growth of antibacterial resistance, and taking into account the wide range of infectious microbiota that contributes to the development of chronic pathology, the selection of adequate drugs for the treatment of inflammatory diseases of the upper respiratory tract remains relevant. If it is inappropriate to use antibacterial therapy, homeopathic preparations can be used both as monotherapy for uncomplicated forms of a viral disease, and in combination in cases where the safety of prescribed drugs is important to the patient. This is especially true in childhood, when the doctor is limited in the use of medicines. The purpose of this work is to familiarize physicians with the epidemiology, symptoms and modern principles of treatment of inflammatory diseases of the upper respiratory tract with an emphasis on risk factors. The analysis of Russian-language and English-language publications was carried out using the databases: eLibrary, PubMed, Russian Science Citation Index, Springer, Scopus, Scientific Research, Crossref.

Menejit Ön tanısıyla Başvuran Hastalarda Beyin Omirilik Sıvı Sonuçlarının Değerlendirilmesi

Aim: It was aimed to determine the microorganisms and antibiotic susceptibilities obtained from cerebrospinal fluid samples (CSF).
 Material and Methods: CSF samples of 138 patients who admitted with a prediagnosis of meningitis to Ondokuz Mayıs University Pediatric Emergency Department between 01/01/2021-01/01/2022 was included. CSF cultures, identification of bacteria and their antibiotic susceptibilities were evaluated by VITEK 2 (bioMeriux, France) automated identification system. If the growth was detected by blood culture system, the specimen was cultivated onto the 5% blood agar, Eosin Methylene Blue agar and chocolate agar. Also, CSF samples were studied for both viral and bacterial agents with the Smart Cycler (Cepheid, USA) device working with Real-Time PCR method. In this system, Streptococcus pneumoniae, Neisseria meningitidis, Haemophilus influenzae, Cytomegalovirus, Herpes simplex type-1, Herpes simplex type-2, Human herpes virus type-6 (HHV-6), Varicella zoster virus and Epstein Barr virus agents were detected. 
 Results: Of the 138 CSF samples, 50,88% were male and 49,12% were female. The mean age of the patients was 36 ± 55 months. Bacterial agents were detected in 18 (13,8%) of the CSF samples and viral agents in 12 (9,2%) samples. Staphylococcus epidermidis (64.6%), Staphylococcus aureus (7.7%) and Streptococcus pneumonia (6.9%) took the first three places in bacterial agents. Among the viral agents, HHV-6 was the most common followed by Enteroviruses.
 Conclusion: It has been observed that the profiles and resistance status of microorganisms frequently seen in CSF have changed over the years.

Landscape of alcohol-related hepatocellular carcinoma in the last 15 years highlights the need to expand surveillance programs

Alcohol abuse and metabolic disorders are leading causes of hepatocellular carcinoma (HCC) worldwide. Alcohol-related aetiology is associated with a worse prognosis compared with viral agents, because of the lower percentage of patients diagnosed with HCC under routine surveillance and a higher burden of comorbidity in alcohol abusers. This study aimed to describe the evolving clinical scenario of alcohol-related HCC over 15 years (2006-2020) in Italy. Data from the Italian Liver Cancer (ITA.LI.CA) registry were used: 1,391 patients were allocated to three groups based on the year of HCC diagnosis (2006-2010; 2011-2015; 2016-2020). Patient characteristics, HCC treatment, and overall survival were compared among groups. Survival predictors were also investigated. Approximately 80% of alcohol-related HCCs were classified as cases of metabolic dysfunction-associated fatty liver disease. Throughout the quinquennia, <50% of HCCs were detected by surveillance programmes. The tumour burden at diagnosis was slightly reduced but not enough to change the distribution of the ITA.LI.CA cancer stages. Intra-arterial and targeted systemic therapies increased across quinquennia. A modest improvement in survival was observed in the last quinquennia, particularly after 12 months of patient observation. Cancer stage, HCC treatment, and presence of oesophageal varices were independent predictors of survival. In the past 15 years, modest improvements have been obtained in outcomes of alcohol-related HCC, attributed mainly to underuse of surveillance programmes and the consequent low amenability to curative treatments. Metabolic dysfunction-associated fatty liver disease is a widespread condition in alcohol abusers, but its presence did not show a pivotal prognostic role once HCC had developed. Instead, the presence of oesophageal varices, an independent poor prognosticator, should be considered in patient management and refining of prognostic systems. Alcohol abuse is a leading and growing cause of hepatocellular carcinoma (HCC) worldwide and is associated with a worse prognosis compared with other aetiologies. We assessed the evolutionary landscape of alcohol-related HCC over 15 years in Italy. A high cumulative prevalence (78%) of metabolic dysfunction-associated fatty liver disease, with signs of metabolic dysfunction, was observed in HCC patients with unhealthy excessive alcohol consumption. The alcohol+ metabolic dysfunction-associated fatty liver disease condition tended to progressively increase over time. A modest improvement in survival occurred over the study period, likely because of the persistent underuse of surveillance programmes and, consequently, the lack of improvement in the cancer stage at diagnosis and the patients' eligibility for curative treatments. Alongside the known prognostic factors for HCC (cancer stage and treatment), the presence of oesophageal varices was an independent predictor of poor survival, suggesting that this clinical feature should be carefully considered in patient management and should be included in prognostic systems/scores for HCC to improve their performance.

Is Kawasaki Disease Caused by a Respiratory Virus?

Kawasaki disease is characterized by high fever, rash, cervical lymphadenopathy, conjunctival injection, oral mucous membrane changes and swelling of the extremities followed by skin sloughing. Despite >50 years of study, no bacterial, viral or other infectious agent has been consistently associated with the illness. The lockdown and social distancing for COVID-19 in March 2020 led to a marked decrease in respiratory virus circulation. This provided an "experiment of nature" to determine whether Kawasaki disease would decline in parallel. Discharge ICD-10 diagnosis codes were obtained from the Vizient Clinical Data Base for Kawasaki disease and respiratory viruses, and analyzed for the age group < 5 years. Weekly respiratory virus positivity data were also obtained from BioFire Diagnostics. Common enveloped respiratory viruses declined precipitously from April 2020 through March 2021 to levels at or below historical seasonal minimum levels. Kawasaki Disease declined about 40% compared with 2018-2019, which is distinctly different from the pattern seen for the enveloped respiratory viruses. Strong seasonality was seen for Kawasaki disease as far back as 2010, and correlated most closely with respiratory syncytial virus, human metapneumovirus and less so with influenza virus suggesting there is a baseline level of Kawasaki disease activity that is heightened during yearly respiratory virus activity but that remains at a certain level even in the near total absence of respiratory viruses. The striking decrease in enveloped respiratory viruses after lockdown and social distancing was not paralleled by a comparable decrease in Kawasaki disease incidence, suggesting a different epidemiology.

In silico design and validation of a novel multi-epitope vaccine candidate against structural proteins of Chikungunya virus using comprehensive immunoinformatics analyses.

Chikungunya virus (CHIKV) is an emerging viral infectious agent with the potential of causing pandemic. There is neither a protective vaccine nor an approved drug against the virus. The aim of this study was design of a novel multi-epitope vaccine (MEV) candidate against the CHIKV structural proteins using comprehensive immunoinformatics and immune simulation analyses. In this study, using comprehensive immunoinformatics approaches, we developed a novel MEV candidate using the CHIKV structural proteins (E1, E2, 6 K, and E3). The polyprotein sequence was obtained from the UniProt Knowledgebase and saved in FASTA format. The helper and cytotoxic T lymphocytes (HTLs and CTLs respectively) and B cell epitopes were predicted. The toll-like receptor 4 (TLR4) agonist RS09 and PADRE epitope were employed as promising immunostimulatory adjuvant proteins. All vaccine components were fused using proper linkers. The MEV construct was checked in terms of antigenicity, allergenicity, immunogenicity, and physicochemical features. The docking of the MEV construct and the TLR4 and molecular dynamics (MD) simulation were also performed to assess the binding stability. The designed construct was non-allergen and was immunogen which efficiently stimulated immune responses using the proper synthetic adjuvant. The MEV candidate exhibited acceptable physicochemical features. Immune provocation included prediction of HTL, B cell, and CTL epitopes. The docking and MD simulation confirmed the stability of the docked TLR4-MEV complex. The high-level protein expression in the Escherichia coli (E. coli) host was observed through in silico cloning. The in vitro, in vivo, and clinical trial investigations are required to verify the findings of the current study.

The effectiveness of a polyvalent antigenic complex including bacterial lysates in the treatment and prevention of rhinosinusitis against the background of acute respiratory viral infections and COVID-19 (clinical description)

One of the urgent tasks of the Ministry of Health of the Russian Federation, noted in the State report on the state of sanitary and epidemiological welfare of the population, is the improvement and implementation of diagnostic and treatment and prevention technologies. First of all, this concerns the continued growth of respiratory viral infections, seasonal influenza epidemics, where SARS-CoV-2 coronavirus infection occupies a special place, which often cause various otorhinolaryngological complications – acute and exacerbations of chronic tonsillopharyngitis, rhinosinusitis, tubotitis, purulent otitis media. In the treatment of bacterial sinusitis, in accordance with clinical recommendations, intranasal corticosteroids, elimination therapy, herbal remedies, and antibacterial drugs are used. Due to the period of the SARS-CoV-2 pandemic, a significant proportion of patients took large doses of antibacterial drugs, which caused an increase in the resistance of microorganisms to them. In this regard, it is possible to use immunostimulating drugs that stimulate cellular and humoral immunity, promote the development of a specific immune response and activate nonspecific defense factors such as lysozyme, mucin, lactoferrin and normalize mucociliary clearance. As a rule, the identification of a viral agent is carried out in case of a severe clinical course of the disease or complications from the ORL and other organs, and the use of immunostimulating agents in complex therapy is necessary at the earliest possible time of the disease. In this context, the use of immunostimulants containing polyvalent antigenic complexes, including bacterial lysates, the most common pathogens of respiratory infections, is justified. It is preferable in these cases to use lysates of bacteria obtained by mechanical destruction of bacterial cells, since they have a more pronounced non-specific immunostimulatory and specific vaccinating effect.

Molecular Epidemiology of Classic, MLB, and VA Astroviruses in Children with Acute Gastroenteritis, 2014-2021: Emergence of MLB3 Strain in Japan.

Human astroviruses (HAstVs) are important causative pathogens of acute gastroenteritis (AGE) in children worldwide. MLB and VA HAstVs, which are genetically distinct from the previously known classic HAstVs, have been detected since 2008. To investigate the role of HAstVs in AGE, we conducted molecular detection and characterization of HAstVs circulating in children with AGE in Japan from 2014 to 2021. Out of 2,841 stool samples, HAstVs were detected in 130 (4.6%). MLB1 was the predominant genotype detected (45.4%), followed by HAstV1 (39.2%), MLB2 (7.4%), VA2 (3.1%), HAstV3 (2.3%), HAstV4, HAstV5, and MLB3 (0.8% each). The results demonstrated that HAstV infection in pediatric patients in Japan was dominated by the two major genotypes MLB1 and HAstV1, with a small proportion of other genotypes. The overall infection rates of MLB and VA HAstVs were higher than those of classic HAstVs. The HAstV1 strains detected in this study belonged solely to lineage 1a. The rare MLB3 genotype was detected for the first time in Japan. All three HAstV3 strains belonged to lineage 3c based on the ORF2 nucleotide sequence and were shown to be recombinant strains. IMPORTANCE HAstVs are one of the pathogens of viral AGE and are considered the third most common viral agents of AGE after rotavirus and norovirus. HAstVs are also suspected to be the causative agents of encephalitis or meningitis in immunocompromised patients and elderly persons. However, little is known about the epidemiology of HAstVs in Japan, especially that of MLBs and VA HAstVs. This study demonstrated epidemiological features and molecular characterization of human astroviruses encompassing a 7-year study period in Japan. This study highlights the genetic diversity of HAstV circulating in pediatric patients with acute AGE in Japan.

Virus-like Particle Vaccines and Platforms for Vaccine Development.

Virus-like particles (VLPs) have gained a lot of interest within the past two decades. The use of VLP-based vaccines to protect against three infectious agents-hepatitis B virus, human papillomavirus, and hepatitis E virus-has been approved; they are very efficacious and offer long-lasting immune responses. Besides these, VLPs from other viral infectious agents (that infect humans, animals, plants, and bacteria) are under development. These VLPs, especially those from human and animal viruses, serve as stand-alone vaccines to protect against viruses from which the VLPs were derived. Additionally, VLPs, including those derived from plant and bacterial viruses, serve as platforms upon which to display foreign peptide antigens from other infectious agents or metabolic diseases such as cancer, i.e., they can be used to develop chimeric VLPs. The goal of chimeric VLPs is to enhance the immunogenicity of foreign peptides displayed on VLPs and not necessarily the platforms. This review provides a summary of VLP vaccines for human and veterinary use that have been approved and those that are under development. Furthermore, this review summarizes chimeric VLP vaccines that have been developed and tested in pre-clinical studies. Finally, the review concludes with a snapshot of the advantages of VLP-based vaccines such as hybrid/mosaic VLPs over conventional vaccine approaches such as live-attenuated and inactivated vaccines.

In-silico molecular modelling studies of some camphor imine based compounds as anti-influenza A (H1N1) pdm09 virus agents

The advent of influenza A (H1N1) drug-resistant strains led to the search quest for more potent inhibitors of the influenza A virus, especially in this devastating COVID-19 pandemic era. Hence, the present research utilized some molecular modelling strategies to unveil new camphor imine-based compounds as anti-influenza A (H1N1) pdm09 agents. The 2D-QSAR results revealed GFA-MLR (R2 train = 0.9158, Q2=0.8475) and GFA-ANN (R2 train = 0.9264, Q2=0.9238) models for the anti-influenza A (H1N1) pdm09 activity prediction which have passed the QSAR model acceptability thresholds. The results from the 3D-QSAR studies also revealed CoMFA (R2 train =0.977, Q2=0.509) and CoMSIA_S (R2 train =0.976, Q2=0.527) models for activity predictions. Based on the notable information derived from the 2D-QSAR, 3D-QSAR, and docking analysis, ten (10) new camphor imine-based compounds (22a-22j) were designed using the most active compound 22 as the template. Furthermore, the high predicted activity and binding scores of compound 22j were further justified by the high reactive sites shown in the electrostatic potential maps and other quantum chemical calculations. The MD simulation of 22j in the active site of the influenza hemagglutinin (HA) receptor confirmed the dynamic stability of the complex. Moreover, the appraisals of drug-likeness and ADMET properties of the proposed compounds showed zero violation of Lipinski’s criteria with good pharmacokinetic profiles. Hence, the outcomes in this work recommend further in-depth in vivo and in-vitro investigations to validate these theoretical findings. Communicated by Ramaswamy H. Sarma

First report of Tomato yellow mottle-associated virus infecting pepper (Capsicum annuum L.) in China.

Tomato yellow mottle-associated virus (TYMaV), is a member of the genus Cytorhabdovirus in the family Rhabdoviridae, which has been reported to infect tomato (Lycopersicon esculentum) (Xu et al. 2017), Solanum nigrum (Li et al., 2022) and Nicotiana benthamiana (Zhou et al. 2019). In July 2021, virus-like symptoms of chlorosis, mosaic, and ring spots were observed in pepper, tomato, and eggplant during a survey of viral symptoms in Huzhou City, Zhejiang Province, China. To identify viral agents potentially associated with these diseases, an Oxford Nanopore cDNA library from the mixed samples was generated and sequenced. Briefly, total RNA from 10 leaf tissue samples (3 pepper plants, 4 tomato plants, and 3 eggplant plants) was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and pooled in equal amounts (100 ng/l each). The library was constructed using a PCR-cDNA sequencing kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK) in accordance with the manufacturer's instructions. Approximately 8.6 million reads were obtained from the Oxford MinION platform. After removing adapters and low-quality reads using iVar v1.3.1 (Grubaugh et al., 2019), the clean reads were subjected to BLASTn search in the GenBank database. We identified sequences derived from potato virus X (PVX), potato virus Y (PVY), cucumber mosaic virus (CMV), pepper mottle virus (PepMoV), and TYMaV. Of these reads, 339 with lengths ranging from 375 to 8651 nt were mapped to the genome of TYMaV (GeneBank Accession No. KY075646.1) at a 98.2% query coverage. To identify TYMaV-infected plants in the pooled samples, all 10 samples were analyzed by two-step RT-PCR using AMV reverse transcriptase (Takara, Tokyo, Japan) combined with random primers N6 (Takara, Dalian, China) and high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan) with primer pairs: N-F 5'- CAGGGAGAGAATGTACAAGTTGATC'/N-R 5'- GACCTTGCTCATCTGATGCAAC -3', amplifying 420 bp of the 3'end of nucleoprotein (N) gene. A pepper sample showing chlorosis symptom was positive for the TYMaV infection, but negative for PVX, PVY, CMV or PepMoV infection when tested using the primers listed in table S1. To confirm the genome sequence of TYMaV Zhejiang isolate (TYMaV-ZJ), we carried out two-step RT-PCR with seven primer pairs (Table S1) designed based on the reference TYMaV genome (GeneBank accession number KY075646.1). PCR products were cloned into pLB vector (Tiangen, Beijing, China) and Sanger sequenced in both directions. At least five independent clones of each fragment were sequenced to avoid possible mutations introduced by PCT. The sequences were assembled into a nearlyfull-length genome of TYMaV -ZJ which was composed of 13344nt (GeneBank accession number OP296980). Pairwise sequence comparison revealed that TYMaV -ZJ genome shared 91.50% and 85.59% nt sequence identity with that of the TYMaV tomato isolate (KY075646.1) and the Solanum nigrum isolate (MW527091.1), which is higher than the species demarcation threshold of 75% for the genus Cytorhabdovirus (Walker et al., 2022). To the best of our knowledge, this is the first report of TYMaV infecting pepper.

How do university students perceive the educational transition in the COVID-19 era: A cross-sectional study from 15 Arab countries.

The viral agent of the novel coronavirus disease 2019 (COVID-19) continues to spread worldwide, leading to a global pandemic. this may negatively affect students' mental health who have to maintain their learning efforts. Therefore, we aimed to assess students' perceptions of the online learning programs designed for university students in Arab countries during the COVID-19 pandemic. This cross-sectional study was conducted on university students using a self-administered online questionnaire in 15 Arab countries, including 6779 participants. The actual sample size was calculated using the EpiInfo program calculator. The validated, piloted questionnaire assessed the effectiveness of internet-based distance learning applications used in these countries during the pandemic. The SPSS version 22 was used. Among the 6779 participants, 26.2% believed that their teachers diversify learning methods, 22.0% thought that their teachers were able to treat the weakness the students have, and 30.7% agreed that their teachers efficiently communicate with them through COVID-19 internet-based learning process. Around 33% of students participated in lectures effectively, 47.4% submitted their homework within accepted deadlines, and 28.6% thought that their colleagues did not cheat during exams and homework. Around 31.3% of students believed that online-based learning had a role in directing them towards research, and 29.9% and 28.9%, respectively, believed that online learning had a role in developing analytical thinking and synthesis skills. Participants reported many suggestions to enhance the process of internet-based distance learning in the future. Our study suggests that online-based distance learning in Arab countries still needs more improvement as students still are more inclined toward face-to-face teaching. However, exploring the factors that influence students' perceptions of e-learning is vital for improving the quality of online-based distance learning. We recommend exploring the perceptions of educators regarding their experience towards online-based distance learning during COVID-19 lockdown.

Severe bronchiolitis profiling as the first step towards prevention of asthma.

Bronchiolitis is the most common respiratory infection leading to hospitalization and constitutes a significant healthcare burden. The two main viral agents causing bronchiolitis, respiratory syncytial virus (RSV) and rhinovirus (RV), have distinct cytopathic, immune response, and clinical characteristics. Different approaches have been suggested for subtyping bronchiolitis based on viral etiology, atopic status, transcriptome profiles in blood, airway metabolome, lipidomic data, and airway microbiota. The highest risk of asthma at school age has been in a subgroup of bronchiolitis characterized by older age, high prevalence of RV infection, previous breathing problems, and/or eczema. Regarding solely viral etiology, RV-bronchiolitis in infancy has been linked to a nearly three times higher risk of developing asthma than RSV-bronchiolitis. Although treatment with betamimetics and systemic corticosteroids has been found ineffective in bronchiolitis overall, it can be beneficial for infants with severe RV bronchiolitis. Thus, there is a need to develop a more individualized therapeutic approach for bronchiolitis and follow-up strategies for infants at higher risk of asthma in the future perspective.

Occurrence of Tomato leaf curl New Delhi virus in tomato (Lycopersicon esculentum) in China.

Tomato leaf curl New Delhi virus (ToLCNDV), a member of the genus Begomovirus in the family Geminiviridae is naturally transmitted by the whitefly Bemisia tabaci (order Hemiptera, family Aleyrodidae) in a circulative and persistent manner (Moriones et al. 2017). ToLCNDV has occurred in Bangladesh, India, Indonesia, Iran, Italy, Malaysia, Pakistan, Sri Lanka, Spain, Thailand and Tunisia (Moriones et al. 2017). To date, The primary cultivated host of ToLCNDV has been identified as tomato (Lycopersicon esculentum), but the virus is also known to infect 43 other plant species from a range of families including Cucurbitaceae, Euphorbiaceae, Solanaceae, Malvaceae and Fabaceae (Zaidi et al. 2017). In August 2021, virus-like symptoms including leaf deformation and curing were observed on tomato (Lycopersicon esculentum) in a greenhouse of about 0.5 hectares in Zhejiang Province, China. To identify viral agents potentially associated with this disease, an Oxford Nanopore cDNA library from a symptomatic sample was generated and sequenced. Total RNA was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan). Libraries were constructed using Oxford Nanopore PCR-cDNA Sequencing Kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK), as recommended. Approximately 8.7 million reads were obtained from the Oxford MinION platform. After removing the adapters and low-quality reads, the clean reads were subjected to BLASTn analysis against the nt database. Approximately 797 and 168 reads produced high nt identities to the genome of ToLCNDV DNA-A (GeneBank Accession No. U15015.2) and ToLCNDV DNA-B (GeneBank Accession No. U15017.2) respectively. We designed 6 primer pairs (Table S1) to obtain the sequence of ToLCNDV Zhejiang (ToLCNDV-ZJ) isolate DNA-A and DNA-B. Briefly, total DNA from ToLCNDV-infected tomato was extracted using standard cetyl trimethylammonium bromide method. Segments of ToLCNDV DNA-A and DNA-B were amplified using high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan). PCR products were cloned into the pLB vector (Tiangen, Beijing, China) and Sanger sequenced. The obtained sequences were assembled into complete sequences of ToLCNDV-ZJ DNA-A (2,739 nt, GeneBank Accession No. OP356207) and DNA-B (2,693 nt, GeneBank Accession No. OP356208). Pairwise sequence comparison revealed that the ToLCNDV -ZJ shared the highest nt sequence identities of 98.7% and 98.4% with the genome segments of New Delhi isolate (genome A: HM159454) and India:Delhi:Cucumis:2012 isolate (genome B: KC545813) respectively. Furthermore, we performed PCR detection on 10 collected samples using the primer pair P1F and P1R. All eight symptomatic plants showing upward leaf curling and leaf distortion tested positive for ToLCNDV infection, whereas two asymptomatic plants were ToLCNDV free. To our knowledge, this is the first report of ToLCNDV infecting tomato in China, and with the widespread presence of B. tabaci in green houses, ToLCNDV may be a potential threat to the cultivation of tomato in China. In addition, ToLCNDV is an exceptional Old World bipartite begomovirus. In China, monopartite DNA satellite-associated begomoviruses with mostly narrow geographical ranges predominate, and are widespread (Li et al., 2022). The occurrence of ToLCNDV in China, which indicates that the success of this virus would become an emerging threat to vegetable and fiber crops.

A comprehensive review on multiple sclerosis: It’s etiology, symptoms, epidemiology and current therapeutic approaches

Multiple sclerosis is a chronic autoimmune, inflammatory neurological disease affecting the nervous system. It targets the myelin sheath of the axons and inflicts axonal degeneration. High susceptibility is seen in people of age group 20-40 years. The incidence rate is three times more in females compared to males. There are 4 types of multiple sclerosis, namely relapsing/remitting multiple sclerosis, secondary progressive multiple sclerosis, primary progressive multiple sclerosis, progressive relapsing multiple sclerosis with relapsing-remitting being the predominant type and makes up 85% of the cases. The pathogenesis of multiple sclerosis includes destruction of myelin sheath followed by formation of lesions and inflammation. Environmental factors and genetic variables play major role in development of the disease. Exposure to viral and bacterial agents can also lead to multiple sclerosis. Disease-modifying therapies (DMTs) are the most commonly employed management strategies for treating patients with multiple sclerosis. Conventional drugs like IFN-β-1a and glatiramer acetate are now being replaced by highly effective DMTs and autologous hematopoietic stem cell transplantation. Recently, there has been drastic developments in the management of multiple sclerosis, owing to the discovery of more tailored and individualized treatment protocols catering specifically to patient needs.

Repurposing of Doramectin as a New Anti-Zika Virus Agent.

Zika virus (ZIKV), belonging to the Flavivirus family and mainly transmitted by mosquitoes, causes a variety of adverse outcomes, including Guillain-Barré syndrome, microcephaly, and meningoencephalitis. However, there are no approved vaccines or drugs available for ZIKV. The discovery and research on drugs for ZIKV are still essential. In this study, we identified doramectin, an approved veterinary antiparasitic drug, as a novel anti-ZIKV agent (EC50 value from 0.85 μM to 3.00 μM) with low cytotoxicity (CC50 > 50 μM) in multiple cellular models. The expression of ZIKV proteins also decreased significantly under the treatment of doramectin. Further study showed that doramectin directly interacted with the key enzyme for ZIKV genome replication, RNA-dependent RNA polymerase (RdRp), with a stronger affinity (Kd = 16.9 μM), which may be related to the effect on ZIKV replication. These results suggested that doramectin might serve as a promising drug candidate for anti-ZIKV.

Viral etiology of lower respiratory tract infections in adults in the pre-COVID-19 pandemic era: A cross-sectional study in a single center experience from Cameroon.

Respiratory viruses are responsible for the majority of lower respiratory tract infections (LRTIs) worldwide. However, there is a gap on the epidemiology of viral LRTIs in adults in sub-Saharan African countries. In Cameroon, like in other countries, the role of viral respiratory pathogens in the etiology of LRTIs in adults is helpful for clinical management. This study aimed to determine the viral aetiologies of LRTIs among hospitalized adults in a reference center for respiratory diseases in the town of Yaounde in Cameroon and its surroundings. A cross-sectional study was conducted from January 2017 to January 2018 at Jamot Hospital in Yaounde (Cameroon). Clinical and demographic information; BAL and sputa were collected from hospitalized patients meeting LRTI case definitions. The clinical samples were investigated for respiratory pathogens with a commercial Reverse Transcriptase Real-Time Polymerase Chain Reaction (RT-PCR) targeting 21 viruses, cultures for bacterial and fungal infections. The 77 included adult patients with LRTIs had an appropriate clinical sample for microbial investigations. A viral agent was detected in 22.1% (17/77) samples. The main viruses detected included rhinovirus (10/77), coronavirus (hCoV-OC43 and hCoV-229E), and influenza A virus (3/77 each). A concomitant viral and bacterial co-infection occurred in 7.8% of patients (6/77) while viral co-infection occurred in one patient (1.3%). No Severe acute respiratory syndrome coronavirus 2 (SARS‑CoV‑2) was detected in clinical samples. Most patients were under antimicrobials before getting diagnosed. Respiratory viruses account for 22.1% of LRTIs in hospitalized patients in this study. Despite prior antimicrobial therapy and delay, rhinovirus, coronavirus and influenza A virus were the most detected in patients in the pre-COVID-19 pandemic era in a single center experience from Cameroon.