Viral Counts Research Articles

Evaluating fomite risk of brown paper bags storing personal protective equipment exposed to SARS-CoV-2: A quasi-experimental study.

Literature is lacking on the safety of storing contaminated PPE in paper bags for reuse, potentially increasing exposure to frontline healthcare workers (HCW) and patients. The aim of this study is to evaluate the effectiveness of paper bags as a barrier for fomite transmission of SARS-CoV-2 by storing face masks, respirators, and face shields. This quasi-experimental study evaluated the presence of SARS-CoV-2 on the interior and exterior surfaces of paper bags containing PPE that had aerosolized exposures in clinical and simulated settings. Between May and October 2020, 30 unique PPE items were collected from COVID-19 units at two urban hospitals. Exposed PPE, worn by either an infected patient or HCW during a SARS-CoV-2 aerosolizing event, were placed into an unused paper bag. Samples were tested at 30-minute and 12-hour intervals. A total of 177 swabs were processed from 30 PPE samples. We found a 6.8% positivity rate among all samples across both collection sites. Highest positivity rates were associated with ventilator disconnection and exposure to respiratory droplets from coughing. Positivity rates differed between hospital units. Total positivity rates were similar between 30-minute (6.7%) and 12-hour (6.9%) sample testing time intervals. Control samples exposed to inactivated SARS-CoV-2 droplets had higher total viral counts than samples exposed to nebulized aerosols. Data suggests paper bags are not a significant fomite risk for SARS-CoV-2 transmission. However, controls demonstrated a risk with droplet exposure. Data can inform guidelines for storing and re-using PPE in situations of limited supplies during future pandemics.

CMV and EBV Co-Infection in HIV-Infected Children: Infection Rates and Analysis of Differential Expression of Cytokines in HIV Mono- and HIV-CMV-EBV Co-Infected Groups.

(1) Background: CMV and EBV co-infections can affect the HIV disease progression by modulating the immune system. The disease dynamics can differ in HIV-positive adults and children. In Pakistan, HIV is rapidly expanding, especially in children; however, the prevalence of CMV and EBV co-infection and the effect on immune modulation in HIV-positive children are not known. This study aimed to bridge this gap by estimating the rate of active CMV and EBV co-infection in HIV-positive children, followed by the analysis of differential expression of cytokines in HIV mono- and HIV/CMV/EBV co-infected children. (2) Methods: DNA samples from 319 HIV-positive children, previously recruited as part of a study to investigate the HIV outbreak in Larkana, Pakistan, in 2019, were screened for CMV and EBV through qPCR. Subsequently, differences in HIV viral loads and CD4 counts were analyzed between the HIV mono- and HIV/CMV/EBV co-infected groups. The RNA samples were used to determine the differential expression of both pro- and anti-inflammatory cytokines in the mono- and co-infected groups using RT-qPCR, while unpaired T-test and Pearson correlation test were applied to, respectively, analyze the differential cytokine expression and correlation between cytokine in the two groups. (3) Results: Of 319 samples, the rate of active EBV and CMV co-infection in HIV-positive children was observed in 79.9% and 38.9%, respectively. A significant difference was observed in HIV viral load between HIV mono- and co-infected groups. IFN-γ expression was found to be lower in the HIV mono-infected group, while higher in all other three co-infected groups. Meanwhile, mRNA expression of TGF-β1 was found to be lower in HIV mono- and HIV–CMV–EBV co-infected groups, while higher in HIV–CMV and HIV–EBV co-infected groups. IFN-γ and IL-2 exhibited a significant positive correlation in all except HIV–CMV co-infected group. (4) Conclusions: The study suggests that the presence of EBV/CMV co-infection can affect the HIV viral loads and expression of certain cytokines (IFN-γ and TGF-β1), which may affect the HIV disease dynamics in infected children.

Using Network Analysis to Assess the Effects of Trauma, Psychosocial, and Socioeconomic Factors on Health Outcomes Among Black Women Living with HIV.

Black women living with HIV (BWLWH) face intersectional adversities impacting their wellbeing. This study utilized network analysis to assess the associations among adversities linked to racism, sexism, HIV stigma, and socioeconomic status (income, housing, education) and determine which adversities predict mental health outcomes, HIV viral load, and medication adherence more consistently among BWLWH. 119 BWLWH aged 18years or older completed self-report measures on sociodemographics, adversity factors, and mental health outcomes. Viral load count was obtained through blood draws, and medication adherence was measured via Wisepill adherence monitoring device. Multiple regression analysis was used to assess if the more central factors in the network also predicted health outcomes more consistently than the less central factors. The four most central factors in the network were income, housing, gendered racial microaggression (GRM) frequency, and GRM appraisal. Multiple regression analysis revealed that GRM frequency, GRM appraisal, and the number of traumas contributed uniquely and were positively associated with both depressive symptoms and posttraumatic stress disorder symptoms. HIV-related discrimination contributed uniquely and was positively associated with HIV viral load.

Immuno-virological status and its associated factors among HIV-positive patients receiving highly active antiretroviral therapy at delgi primary hospital, northwest Ethiopia, 2020/2021: A cross-sectional study

BackgroundHighly active antiretroviral therapy (HAART) improves clinical outcomes by suppressing viral replication and allowing immune reconstitution. It also reduces HIV-related complications including morbidity, mortality, and extended hospitalizations for HIV-positive individuals. Regular assessment for antiretroviral treatment response is fundamentally important to address the factors associated with the poor clinical outcome including immunologic failures among HIV-positive patients on HAART. Therefore, this study aimed to investigate the immuno-virological status and describe its determinants among HIV-positive patients receiving HAART at Delgi primary hospital, Northwest Ethiopia. MethodsA hospital-based cross-sectional study was conducted at Delgi primary hospital from October 25th through June 19th 2021 among a total of 442 study participants. A systematic random sampling technique was employed to enrol participants in the study. Socio-demographic and clinically related data were collected using a semi-structured questionnaire. About 3–5 ml of venous blood was collected aseptically for CD4+ T cell count and viral load test. SPSS version 20 software was used for statistical analysis. Bivariate and multivariate logistic regression analyses were conducted to determine the factors associated with immuno-virologic status among HIV-positive patients on HAART. The odds ratio with 95% CI was computed to determine the strength of association. Then, a p-value < 0.05 was considered a statistically significant association. For this study, the results were presented by using frequency summary tables, and texts. ResultsAmong the total study participants, 283 (64%) were males and the mean age of the study participants was 37 ± 11.5. The overall immunological and virological failure among highly active antiretroviral therapy (HAART) receiving participants was found to be 9.5% (42/442, 95%CI:3.23–15.09) and 12.2% (54/442, 95% CI: 2.81–23.04) respectively. In the multivariate analysis, study participants with age ≥50 years old [AOR = 1.97, p = 0.01, 95%CI (0.02–4.03)], participants having current viral load count greater ≥1000 copies/ml [AOR = 3.97, p = 0.03, 95%CI (1.09–5.01)] and having TB-co-infection [AOR = 2.51, p = 0.05, 95%CI (1.02–7.51)] were statistically associated with increased risk of immunological failure. Similarly, TB-coinfected participants were 1.88 (95%CI = 0.89–10.02) times at greater risk for virological failure. ConclusionIn this study, the magnitude of immuno-virological failure is alarming. This may be shown the need for integrated and substantial commitment to enhancing patient antiretroviral treatment adherence in the study area. Also, regular assessment for antiretroviral treatment response is fundamentally important to address the determinants associated with virological and immunologic failures among HIV-positive patients taking HAART. Furthermore, early initiation of HAART may be imperative to achieve favourable virological suppression and immunological reconstitution.

Theaflavin 3-gallate inhibits the main protease (Mpro) of SARS-CoV-2 and reduces its count in vitro

The main protease (Mpro) of SARS-CoV-2 has been recognized as an attractive drug target because of its central role in viral replication. Our previous preliminary molecular docking studies showed that theaflavin 3-gallate (a natural bioactive molecule derived from theaflavin and found in high abundance in black tea) exhibited better docking scores than repurposed drugs (Atazanavir, Darunavir, Lopinavir). In this study, conventional and steered MD-simulations analyses revealed stronger interactions of theaflavin 3-gallate with the active site residues of Mpro than theaflavin and a standard molecule GC373 (a known inhibitor of Mpro and novel broad-spectrum anti-viral agent). Theaflavin 3-gallate inhibited Mpro protein of SARS-CoV-2 with an IC50 value of 18.48 ± 1.29 μM. Treatment of SARS-CoV-2 (Indian/a3i clade/2020 isolate) with 200 μM of theaflavin 3-gallate in vitro using Vero cells and quantifying viral transcripts demonstrated reduction of viral count by 75% (viral particles reduced from Log106.7 to Log106.1). Overall, our findings suggest that theaflavin 3-gallate effectively targets the Mpro thus limiting the replication of the SARS-CoV-2 virus in vitro.

72 weeks post-partum follow-up of dolutegravir versus efavirenz initiated in late pregnancy (DolPHIN-2): an open-label, randomised controlled study

Late initiation of antiretrovirals in pregnancy is associated with increased risk of perinatal transmission and higher infant mortality. We report the final 72-week postpartum results for efficacy and safety of dolutegravir-based compared with efavirenz-based regimens in mothers and infants. DolPHIN-2 was a randomised, open-label trial. Pregnant women in South Africa and Uganda aged at least 18 years, with untreated but confirmed HIV infection and an estimated gestation of at least 28 weeks, initiating antiretroviral therapy in third trimester were eligible for inclusion. Eligible women were randomly assigned (1:1) to receive either dolutegravir-based (50 mg dolutegravir, 300 mg tenofovir disoproxil fumarate, and either 200 mg emtricitabine in South Africa or 300 mg lamivudine in Uganda) or efavirenz-based (fixed dose combination 600 mg tenofovir disoproxil fumarate plus either emtricitabine in South Africa or lamivudine in Uganda) therapy. The primary efficacy outcome was the time to a viral load of less than 50 copies per mL measured at 6, 12, 24, 48, and 72 weeks postpartum with a Cox model adjusting for viral load and CD4 cell count. Safety endpoints were summarised by the number of women and infants with events. This trial is registered with ClinicalTrials.gov, NCT03249181. Between Jan 23 and Aug 15, 2018, 280 women were screened for inclusion, of whom 268 (96%) women were randomly assigned: 133 (50%) to the efavirenz group and 135 (50%) to the dolutegravir group. 250 (93%; 125 [50%] in the efavirenz group and 125 [50%] in the dolutegravir group) women were included in the intention-to-treat analysis of efficacy. Median time to viral load of less than 50 copies per mL was 4·1 weeks (IQR 4·0-5·1) in the dolutegravir group compared with 12·1 weeks (10·7-13·3) in the efavirenz group (adjusted hazard ratio [HR] 1·93 [95% CI 1·5-2·5]). At 72 weeks postpartum, 116 (93%) mothers in the dolutegravir group and 114 (91%) in the efavirenz group had a viral load of less than 50 copies per mL. Of 57 (21%) mothers with a severe adverse event, three (2%) in the dolutegravir group and five (4%) in the efavirenz group were related to the drug (dolutegravir drug-related events were one woman each with suicidal ideation, suicide attempt, herpes zoster meningitis; efavirenz drug-related events were one woman each with suicide attempt and liver cirrhosis, and three people with drug-induced liver injury). Of 136 (56%) infants in whom severe adverse events were recorded, none were related to the study drugs. In addition to the three infant HIV infections detected at birth in the dolutegravir group that have been previously reported, an additional transmission in the efavirenz group occurred during breastfeeding despite optimal maternal viral suppression and serial negative infant tests in the first year of life. Dolutegravir was safe and well tolerated, supporting updated WHO treatment recommendations in pregnant and breastfeeding women. Infant HIV transmissions can occur during breastfeeding despite persistently undetectable maternal viral load highlighting the need for continued infant testing. Unitaid.

HIV and AIDS in Older Adults: Neuropsychiatric Changes.

Patients diagnosed with HIV can now survive well into their old age. Aging with HIV is not only associated with comorbid medical illnesses but also with neuropsychiatric conditions that can range from cognitive changes to severe behavioral manifestations. This paper reviews mood, anxiety, and cognitive changes in older patients with HIV, as well as some of the treatment challenges in this population. Most recent findings show that untreated HIV illness over a long period of time may further worsen both preexisting neuropsychiatric illness and may cause new onset behavioral and cognitive symptoms. HIV induces immune phenotypic changes that have been compared to accelerated aging Low CD 4 counts and high viral counts are indicative of poor prognosis. Evaluation for potential HIV infections may be overlooked in older adults and require screening. Older adults experience accelerated CD4 cell loss. Older adults endorsing new onset mood or cognitive changes must be screened for HIV infection. New onset neurobehavioral symptoms should be carefully screened for and treated simultaneously in patients with HIV infection.

HIV‐1 Subtype Shift in the Philippines is Associated With High Transmitted Drug Resistance, High Viral Loads, and Fast Immunologic Decline

ObjectivesThe Philippines has one of the fastest growing HIV epidemics in the world. A subtype shift from B to CRF01_AE may have contributed to the increase in cases. We undertook a genotyping and transmitted drug resistance (TDR) study to determine if the dominant subtype has any advantages in resistance and transmission. MethodsFilipinos who were treatment-naive who were living with HIV were recruited from two large government treatment hubs from March 2016 to August 2018. HIV-1 viral load, CD4 count, genotyping, and TDR testing were performed. Demographic and clinical data were collected and compared across subtypes. ResultsA total of 298 Filipinos living with HIV were recruited. Median CD4 count was 143 cells/µl and HIV viral load was 2,345,431 copies/ml. Sanger-based sequencing showed 230/298 (77.2%) had subtype CRF01_AE, 41 (13.8%) subtype B, and the rest had other subtypes or recombinants. Overall TDR was 11.7%. TDR was associated with lower viral loads and no previous HIV testing. CRF01_AE had a higher likelihood of a viral load >100,000 copies/ml and having a baseline CD4 count <50 cells/mm3. ConclusionTDR in the Philippines is high at 11.7%. CRF01_AE was observed to have a higher baseline viral load and lower CD4 counts compared with other cocirculating subtypes. Further research needs to confirm this observation because it suggests that CRF01_AE may have a survival advantage that led to replacement of subtype B as the dominant subtype. Drug resistance testing is recommended in the Philippines when initiating NNRTI-based antiretroviral therapy but may not be necessary for INSTI-based regimens.

Mitochondrial DNA Profiling in A Cohort of Antiretroviral Treated HIV Patients in Lagos, Nigeria: Assessment of Long-Term Effects of cART on Life Quality of PLWH

The use of combined antiretroviral therapy (cART) has turned HIV infection to a manageable condition, significantly reducing HIV-related morbidity and mortality globally. Risk of transmission has been substantially reduced in Africa where 67% of global infection is domiciled. However, long-term impact of cART on life quality of HIV patients elicits concern due to possible oxidative stress stimulus and accumulated toxicity. Mitochondrion, responsible for molecular metabolism in eukaryotes has been proposed as a marker for cellular dysfunction and ageing. Metabolic dysfunction due to accumulated oxidative stress may lead to mitochondrial DNA (mtDNA) mutation, protein alteration, and premature apoptosis leading to ageing. A cohort study comprising of 302 HIV infected persons receiving cART (Tenofovir, Lamivudine, Dolutegravir; TLD) at NIMR HIV reference clinic, and 113 healthy controls. Venous blood was collected in vacutainer tubes and plasma isolated. DNA extraction was done using NIMR-Biotech DNA Extraction kit, and mtDNA levels measured using SYBRGreen dye-based quantitative real-time PCR assay on Quant Studio 5. Primer sequences from human 12S ribosomal RNA with CCACGGGAAACAGCAGTGAT and CTATTGACTTGGGTTAATCGTGTGA as forward and reverse sequences respectively were used to amplify mtDNA locus. Melting curve was performed for every run to confirm successful amplification of targeted region. Total DNA from an immortalized Hela cell line, diluted in 10-fold serial dilutions, was used as standard curve. Plasma mtDNA levels were evaluated and data analyzed using IBM SPSS software (version 24). Among HIV infected individuals, 185 (88.1%) were female and mean age was 32±0.43 years while 36 (32%) and 27±0.57 years were female and mean age among controls, respectively. Mean CD4 count among HIV subjects was 427±29 cells/µl while 62.4% had less than 50 viral copies/ml. Majority of subjects (74.9%) were on first line cART while mean exposure to ART regimens was 4±0.3 years. No significant difference was observed between mtDNA concentration of HIV subjects (mean = 256±38 copies/µl) and healthy controls (mean: 247±72 copies/µl), neither among only HIV subjects, when stratified based on viral load or CD4 count. No association was observed between cell free (cf)-mtDNA and cART exposure among HIV patients. Lack of baseline information on initial cf-mtDNA among Africans was challenging in establishing that new ART regimens had enhanced recovery from mitochondrial-DAMP. There is need to continuously assess prolonged effect of cART to ensure good quality of life and healthy ageing for people living with HIV (PLWH).

Abstract 1591: Convergence of antigenic diversity and Tex-cell stability fatally constrains immune surveillance in non-small cell lung cancer (TRACERx) and HIV-1 infection (Protocol C)

Abstract T cells recognize cognate antigen and elicit effector function to eliminate target cells. In chronic infection and cancer, exhausted T cells with impaired effector function and narrow TCR repertoires must respond to vast and diverse antigenic landscapes, favoring immune escape. Here we test whether T cell exhaustion and antigenic diversity converge to drive fatal immune failure in chronic infection and cancer. We leveraged over 600 primary longitudinal samples from the Protocol C (IAVI) and TRACERx (CRUK) studies to track the natural course of HIV-1 infection and non-small cell lung cancer (NSCLC), respectively, using high parameter flow cytometry, genome sequencing and TCRseq, complemented with focused scRNAseq and antigen specific profiling. In both diseases systemic Tcf1-Tox+Eomes+PD1+ T (Tex) cells track antigen burden and predict adverse outcome, independent of host clinical status. In HIV-1 infection, Tex cells are clonally restricted and rapid Gag RNA sequence divergence accompanies higher viral loads and lower CD4 counts. Similarly, in lung cancer peripheral Tex cells harbor hyper-expanded TCRs, contract after resection and reconstitute at recurrence with strikingly preserved clonal hierarchies, creating a ‘specificity gap’ that could be exploited by subclonal evolution. Commensurate with this model, we discover that a high level of systemic Tex cells coupled with either elevated Gag diversity in HIV-1 infection, or higher mutational or copy number heterogeneity in lung cancer defines patients with the poorest clinical outcome. We propose a unifying model of immune failure in chronic infection and cancer where genomic diversity and T cell exhaustion co-ordinately diminish human immune protection. Citation Format: James L. Reading, Rachel Rosenthal, Oriol Pich, Samuel Gamble, Seng Anakin Ung, Teerapon Sahwangarrom, Betty Gration, Yien Ning Sophia Wong, Lucas Black, Benny Chain, Jonathan Hare, Sergio A. Quezada, Charles Swanton. Convergence of antigenic diversity and Tex-cell stability fatally constrains immune surveillance in non-small cell lung cancer (TRACERx) and HIV-1 infection (Protocol C) [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 1591.

Understanding the mutational frequency in SARS-CoV-2 proteome using structural features

The prolonged transmission of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) virus in the human population has led to demographic divergence and the emergence of several location-specific clusters of viral strains. Although the effect of mutation(s) on severity and survival of the virus is still unclear, it is evident that certain sites in the viral proteome are more/less prone to mutations. In fact, millions of SARS-CoV-2 sequences collected all over the world have provided us a unique opportunity to understand viral protein mutations and develop novel computational approaches to predict mutational patterns. In this study, we have classified the mutation sites into low and high mutability classes based on viral isolates count containing mutations. The physicochemical features and structural analysis of the SARS-CoV-2 proteins showed that features including residue type, surface accessibility, residue bulkiness, stability and sequence conservation at the mutation site were able to classify the low and high mutability sites. We further developed machine learning models using above-mentioned features, to predict low and high mutability sites at different selection thresholds (ranging 5–30% of topmost and bottommost mutated sites) and observed the improvement in performance as the selection threshold is reduced (prediction accuracy ranging from 65 to 77%). The analysis will be useful for early detection of variants of concern for the SARS-CoV-2, which can also be applied to other existing and emerging viruses for another pandemic prevention.

Super high-resolution single-molecule sequence-based typing of HLA class I alleles in HIV-1 infected individuals in Ghana.

Polymorphisms in human leukocyte antigen (HLA) class I loci are known to have a great impact on disease progression in HIV-1 infection. Prevailing HIV-1 subtypes and HLA genotype distribution are different all over the world, and the HIV-1 and host HLA interaction could be specific to individual areas. Data on the HIV-1 and HLA interaction have been accumulated in HIV-1 subtype B- and C-predominant populations but not fully obtained in West Africa where HIV-1 subtype CRF02_AG is predominant. In the present study, to obtain accurate HLA typing data for analysis of HLA association with disease progression in HIV-1 infection in West African populations, HLA class I (HLA-A, -B, and -C) four-digit allele typing was performed in treatment-naïve HIV-1 infected individuals in Ghana (n = 324) by a super high-resolution single-molecule sequence-based typing (SS-SBT) using next-generation sequencing. Comparison of the SS-SBT-based data with those obtained by a conventional sequencing-based typing (SBT) revealed incorrect assignment of several alleles by SBT. Indeed, HLA-A*23:17, HLA-B*07:06, HLA-C*07:18, and HLA-C*18:02 whose allele frequencies were 2.5%, 0.9%, 4.3%, and 3.7%, respectively, were not determined by SBT. Several HLA alleles were associated with clinical markers, viral load and CD4+ T-cell count. Of note, the impact of HLA-B*57:03 and HLA-B*58:01, known as protective alleles against HIV-1 subtype B and C infection, on clinical markers was not observed in our cohort. This study for the first time presents SS-SBT-based four-digit typing data on HLA-A, -B, and -C alleles in Ghana, describing impact of HLA on viral load and CD4 count in HIV-1 infection. Accumulation of these data would facilitate high-resolution HLA genotyping, contributing to our understanding of the HIV-1 and host HLA interaction in Ghana, West Africa.

The Effect of Hydrogen Peroxide and Povidone-Iodine on the Shear Bond Strength of Orthodontic Brackets: An In Vitro Study

BACKGROUND: Chlorhexidine, which is the gold-standard antimicrobial mouthwash, cannot effectively decrease the count of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), which is the causative agent for coronavirus disease-2019 (COVID-19). Since SARS-CoV-2 is susceptible to oxidation, mouthwashes containing oxidizing agents such as hydrogen peroxide (H2O2) or Povidone-iodine (PVP-I) are recommended to decrease the viral count. AIM: This study aimed to assess the effects of H2O2 and PVP-I mouthwashes on the shear bond strength (SBS) of metal orthodontic brackets to the enamel. MATERIALS AND METHODS: This in vitro experimental study evaluated 45 freshly extracted maxillary premolars. The teeth were cleaned and randomized into three groups (n = 15) for rinsing with distilled water (control group), 1% PVP-I (betadine), and 1.5% H2O2 for 60 s. All teeth were etched with 37% phosphoric acid gel, and metal orthodontic brackets were bonded to the teeth using the Transbond XT bonding system. The teeth were mounted in auto-polymerized acrylic resin and incubated in water at 37°C for 72 h. The teeth were then thermocycled for 48 h, and their SBS was measured in a universal testing machine. The adhesive remnant index (ARI) score was also calculated. The groups were compared by ANOVA and Chi-square Monte Carlo test. RESULTS: No significant difference was noted among the three groups in SBS (p = 0.938) or the ARI score (p = 0.780). CONCLUSION: Use of H2O2 and PVP-I mouthwashes has no adverse effect on SBS or mode of failure of metal orthodontic brackets bonded to enamel.

Rapid high-throughput compatible label-free virus particle quantification method based on time-resolved luminescence

Viruses play a major role in modern society and create risks from global pandemics and bioterrorism to challenges in agriculture. Virus infectivity assays and genome copy number determination methods are often used to obtain information on virus preparations used in diagnostics and vaccine development. However, these methods do not provide information on virus particle count. Current methods to measure the number of viral particles are often cumbersome and require highly purified virus preparations and expensive instrumentation. To tackle these problems, we developed a simple and cost-effective time-resolved luminescence-based method for virus particle quantification. This mix-and-measure technique is based on the recognition of the virus particles by an external Eu3+-peptide probe, providing results on virus count in minutes. The method enables the detection of non-enveloped and enveloped viruses, having over tenfold higher detectability for enveloped, dynamic range from 5E6 to 3E10 vp/mL, than non-enveloped viruses. Multiple non-enveloped and enveloped viruses were used to demonstrate the functionality and robustness of the Protein-Probe method. Graphical abstract

Fit-Tested N95 Masks Combined With Portable High-Efficiency Particulate Air Filtration Can Protect Against High Aerosolized Viral Loads Over Prolonged Periods at Close Range.

BackgroundHealthcare workers (HCWs) are at risk from aerosol transmission of severe acute respiratory syndrome coronavirus 2. The aims of this study were to (1) quantify the protection provided by masks (surgical, fit-testFAILED N95, fit-testPASSED N95) and personal protective equipment (PPE), and (2) determine if a portable high-efficiency particulate air (HEPA) filter can enhance the benefit of PPE.MethodsVirus aerosol exposure experiments using bacteriophage PhiX174 were performed. An HCW wearing PPE (mask, gloves, gown, face shield) was exposed to nebulized viruses (108 copies/mL) for 40 minutes in a sealed clinical room. Virus exposure was quantified via skin swabs applied to the face, nostrils, forearms, neck, and forehead. Experiments were repeated with a HEPA filter (13.4 volume-filtrations/hour).ResultsSignificant virus counts were detected on the face while the participants were wearing either surgical or N95 masks. Only the fit-testPASSED N95 resulted in lower virus counts compared to control (P = .007). Nasal swabs demonstrated high virus exposure, which was not mitigated by the surgical/fit-testFAILED N95 masks, although there was a trend for the fit-testPASSED N95 mask to reduce virus counts (P = .058). HEPA filtration reduced virus to near-zero levels when combined with fit-testPASSED N95 mask, gloves, gown, and face shield.ConclusionsN95 masks that have passed a quantitative fit-test combined with HEPA filtration protects against high virus aerosol loads at close range and for prolonged periods of time.

Trough plasma nevirapine levels, immunologic and virologic responses in composite CYP2B6*6/*18 HIV-infected adult Nigerian patients.

The influence of composite CYP2B6*6/*18 genotype on trough plasma nevirapine levels, HIV RNA levels (virologic response) and CD4+ T lymphocyte and absolute lymphocyte counts (immunologic response) of HIV-infected patients were evaluated. Patients with records of trough plasma nevirapine levels, CD4+ T lymphocyte, absolute lymphocyte and viral load counts at baseline and months 6 and 12 after initiation of nevirapine-based antiretroviral therapy combinations were retrospectively analysed. Participants were from a cohort of 150 patients previously genotyped and with measured plasma nevirapine levels. Relationship between genotype and nevirapine levels, absolute lymphocyte and CD4+ T lymphocyte counts and viral load were explored. Composite CYP2B6*6/*18 genotype was significantly associated with trough plasma nevirapine levels (geometric mean [standard deviation]: 4482 ng/ml [1349] of normal metabolizers vs. 4632 ng/ml [1793] of intermediate metabolizers vs. 6229 ng/ml [2549] of poor metabolizers; P < 0.001), but not the plasma HIV RNA levels, absolute lymphocyte and CD4+ T lymphocyte counts. Overall, immunologic response showed improvement with approximately 61.3% and 70.4% of patients with CD4+ T lymphocyte count >350 cells/mm3 at months 6 and 12 therapy duration respectively compared to 23.1% at baseline. Composite CYP2B6*6/*18 genotype correlated with plasma nevirapine levels but not immunologic and virologic responses.

Clinical Findings of Specular Microscopy Images in Cytomegalovirus Corneal Endotheliitis.

The aim of this study is to evaluate the usefulness of specular microscopy as an alternative diagnostic tool for cytomegalovirus (CMV) corneal endotheliitis. A retrospective study. One hundred and four patients with clinical manifestations of infectious corneal endotheliitis, iridocyclitis, and retinitis were included in this study. The presence of CMV deoxyribonucleic acid (DNA) was confirmed by multiplex polymerase chain reaction (PCR). Viral load was measured using real-time PCR. Corneal endothelium was observed by specular microscopy. The medical records and clinical manifestations of the patients were retrospectively reviewed and linked with the PCR results. Seventeen of 104 cases were CMV endotheliitis and/or iridocyclitis and had no history of intraocular surgery or corneal transplantation. There was a negative correlation between viral load and corneal endothelial cell counts. In 14 of 17 cases, owl's eye cells were observed by specular microscopy. The corneal endothelial cell counts were significantly reduced in the cases in which owl's eye cells were observed. In CMV endotheliitis, owl's eye cells were observed by specular microscopy with high probability (82%). Corneal endothelial cells significantly decreased when owl's eye cells were observed by specular microscopy. Specular microscopy represents a useful noninvasive auxiliary tool for diagnosing and monitoring CMV corneal endotheliitis.

CD4+ CD151+ T cells may serve as preferential reservoir cells of latent HIV infection events.

Abstract We have demonstrated that the tetraspanin CD151 marks a hyperactivated, pro-inflammatory human CD4+ T cell population. Expansion of this population in HIV patients on ART may explain the associated risk of inflammation-related co-morbidities. However, CD151+ CD4 T cells can also proliferate independent of cognate antigen recognition, driven by just IL-2, a feature that is reminiscent of latently infected T cells which have been reported to maintain the latent reservoir size by homeostatic proliferation mechanisms. The objective of this study was to test our hypothesis that the CD4+CD151+ T cell population is more likely to host latent HIV infection events. First, we noted that all latently HIV-1 infected T cell clones we investigated had upregulated CD151 expression. Using samples from PLWH on ART (n=5) with undetectable viral loads and CD4 count &amp;gt;500 cells/mm3 we enriched CD4+CD151+ and CD4+CD151− T cell populations. Using a nested ALU/GAG qPCR assay to determine the level of proviral HIV-1 integration events, we found a 3.6-fold increase in integration events in the enriched CD4+CD151+ T cell population. Given the demonstrated correlation of proviral DNA frequencies and latent reservoir size, this would suggest that CD151+ T cells disproportionately harbor latent HIV infection, and that CD151+ T cells could be used as a surrogate population to study pertinent features of latently HIV-1 infected T cells. We here begin to address the conundrum of how T cells with a hyperactivated phenotype can host latent HIV-1 infection events and dissect the influence of CD151 expression on latency establishment and reactivation. Characterization of this T cell compartment may reveal new molecular targets to efficiently trigger HIV-1 reactivation. Supported by grants from NIH: NIH R01-AI122842 NIH R33-AI116188 NIH R33-AI133679

Inactivation of Airborne Viruses using Newly Designed Emitron

The objective of the current research is to validate the microbiological quality of Emitron against MS2 phage, Corona virus, bacteria, yeast, and molds. Unimech healthcare designed PMEE based Emitron which is mostly used to reduce the microbial count and virus count in an area. To perform microbiological testing of the Emitron, environmental monitoring was performed for MS2 phage, Corona virus, bacteria, yeast, and molds before and after treatment by settle plate method. Petri plates of sterilized Phage agar, SCDA and PDA media were prepared and exposed for environment monitoring before and after treatment by settle plate method. The phage agar and SCDA plates were incubated at 37°C for 72 hours and PDA plates incubated at 25°C for 5 days. Total of 99% reduction was reported in microbiology lab with respect to the microorganisms after installing Emitron. We can conclude that the Unimech healthcare’s Emitron is virus attenuation device so one can use it to purify the air and kill the viruses, bacteria, fungi, and other microbes.

Inactivation of Airborne Viruses using Newly Designed Emitron

The objective of the current research is to validate the microbiological quality of Emitron against MS2 phage, Corona virus, bacteria, yeast, and molds. Unimech healthcare designed PMEE based Emitron which is mostly used to reduce the microbial count and virus count in an area. To perform microbiological testing of the Emitron, environmental monitoring was performed for MS2 phage, Corona virus, bacteria, yeast, and molds before and after treatment by settle plate method. Petri plates of sterilized Phage agar, SCDA and PDA media were prepared and exposed for environment monitoring before and after treatment by settle plate method. The phage agar and SCDA plates were incubated at 37°C for 72 hours and PDA plates incubated at 25°C for 5 days. Total of 99% reduction was reported in microbiology lab with respect to the microorganisms after installing Emitron. We can conclude that the Unimech healthcare’s Emitron is virus attenuation device so one can use it to purify the air and kill the viruses, bacteria, fungi, and other microbes.