Vero Cell Cytotoxicity Assay Research Articles

New insights into Bacillus cytotoxicus sources, screening, toxicity, and persistence in food production facilities

Bacillus cytotoxicus is a thermotolerant member of the Bacillus cereus group. It has been linked to rare, but at times fatal cases of diarrheal disease and might be missed at routine diagnostic screening temperatures commonly used for the B. cereus group. The pathogen is mostly found on dehydrated foods containing potato starch or insects. How it enters the food chain or whether it persists in food producing environments is largely unknown. Increased consumption of insects and convenience foods in Europe and the lack of information on the persistence of B. cytotoxicus in food environments and its virulence demand for further characterization. In this study, we aimed to obtain a better understanding of i) the food sources of B. cytotoxicus, ii) screening temperatures needed for its isolation from food matrices, iii) cytotoxicity of the organism, and iv) its ecological niche and potential epidemiological links. To this end, 112 food samples were collected, with a focus on foods exhibiting low water activity. The samples were screened for B. cytotoxicus at 42 °C and at 50 °C. Presumptive isolates were characterized by cytK-1 toxin gene PCR for differentiation of B. cytotoxicus from other B. cereus group members. Vero cell cytotoxicity assays were performed, and selected isolates were sequenced. Our results show that screening at 42 °C might be insufficient for detecting B. cytotoxicus in foods that harbor other less thermophilic Bacillus species. When screening at 50 °C, B. cytotoxicus was detected in 23% of the food samples (n = 26 isolates). The highest prevalence was detected in mashed potato products (82%) and potato flakes (67%). In contrast, a wide range of products not containing any potato ingredients did not yield B. cytotoxicus isolates. All B. cytotoxicus isolates exhibited either low or no detectable cytotoxicity. WGS analysis revealed that a highly toxic isolate is closely related to the French outbreak strain NVH 391-98. In addition, we could show that two isolates sampled 5 years apart from the same production facility only differed by seven SNPs, making it likely that B. cytotoxicus is able to persist in production facilities over a long time. Interestingly, the reoccurring strain possessed an additional plasmid and did not show cytotoxic potential when re-isolated after 5 years.

The influence of exposure to various concentrations of five antimicrobial agents on intracellular cytotoxin B production in <i>Clostridioides difficile</i>

Background: Clostridioides difficile is an important cause of healthcare-associated diarrhea. Several anti- microbial agents are known to promote C. difficile infection (CDI). The impact of various concentrations of ampicillin (AMP), cefotaxime (CTX), clindamycin (CC), metronidazole (MTZ) and vancomycin (VAN) on intra-cellular cytotoxin B production was investigated in this study.
 Methodology: Six clinical strains of C. difficile were grown at minimum inhibitory concentration (MIC) and sub-MIC concentrations of these antibiotics. Inoculum standardization was performed by Miles and Misra method. Intracellular toxin B production was detected using Vero cell cytotoxicity assay in sonicated cultures on days 1, 2, 3, 4, 5 and 7 days of incubation.
 Results: There was a heterogeneous relationship between antibiotic exposure and the intra-cellular toxin production by the toxigenic strains. Clinical strains of C. difficile when exposed to MIC and sub-inhibitory concentrations of certain antibiotics produced high cytotoxin levels. All toxigenic isolates produced increased levels of cell-bound cytotoxin after exposure to antibiotics but there was no consistent pattern and the response to different doses varied considerably. Metronidazole was the most potent inducer of cell-bound cytotoxin followed by cefotaxime and clindamycin. Vancomycin induced the least amount of cytotoxin activity.
 Conclusion: The effects of sub-inhibitory concentration of antibiotic that predispose to C. difficile infection may partially suppress the normal gut flora, allowing colonization and growth of C. difficile, and may affect the level of toxin produced.

Tauroursodeoxycholic Acid Inhibits Clostridioides difficile Toxin-Induced Apoptosis.

ABSTRACTC. difficile infection (CDI) is a highly inflammatory disease mediated by the production of two large toxins that weaken the intestinal epithelium and cause extensive colonic tissue damage. Antibiotic alternative therapies for CDI are urgently needed as current antibiotic regimens prolong the perturbation of the microbiota and lead to high disease recurrence rates. Inflammation is more closely correlated with CDI severity than bacterial burden, thus therapies that target the host response represent a promising yet unexplored strategy for treating CDI. Intestinal bile acids are key regulators of gut physiology that exert cytoprotective roles in cellular stress, inflammation, and barrier integrity, yet the dynamics between bile acids and host cellular processes during CDI have not been investigated. Here we show that several bile acids are protective against apoptosis caused by C. difficile toxins in Caco-2 cells and that protection is dependent on conjugation of bile acids. Out of 20 tested bile acids, taurine conjugated ursodeoxycholic acid (TUDCA) was the most potent inhibitor, yet unconjugated UDCA did not alter toxin-induced apoptosis. TUDCA treatment decreased expression of genes in lysosome associated and cytokine signaling pathways. TUDCA did not affect C. difficile growth or toxin activity in vitro whereas UDCA significantly reduced toxin activity in a Vero cell cytotoxicity assay and decreased tcdA gene expression. These results demonstrate that bile acid conjugation can have profound effects on C. difficile as well as the host and that conjugated and unconjugated bile acids may exert different therapeutic mechanisms against CDI.

Further Insights into the Toxicity of Bacillus cytotoxicus Based on Toxin Gene Profiling and Vero Cell Cytotoxicity Assays.

Bacillus cytotoxicus belongs to the Bacillus cereus group that also comprises the foodborne pathogen Bacillus cereus sensu stricto, Bacillus anthracis causing anthrax, as well as the biopesticide Bacillus thuringiensis. The first B. cytotoxicus was isolated in the context of a severe food poisoning outbreak leading to fatal cases of diarrheal disease. Subsequent characterization of the outbreak strain led to the conclusion that this Bacillus strain was highly cytotoxic and eventually resulted in the description of a novel species, whose name reflects the observed toxicity: B. cytotoxicus. However, only a few isolates of this species have been characterized with regard to their cytotoxic potential and the role of B. cytotoxicus as a causative agent of food poisoning remains largely unclear. Hence, the aim of this study was to gain further insights into the toxicity of B. cytotoxicus. To this end, 19 isolates were obtained from mashed potato powders and characterized by toxin gene profiling and Vero cell cytotoxicity assays. All isolates harbored the cytK1 (cytotoxin K1) gene and species-specific variants of the nhe (non-hemolytic enterotoxin) gene. The isolates exhibited low or no toxicity towards Vero cells. Thus, this study indicates that the cytotoxic potential of B. cytotoxicus may be potentially lower than initially assumed.

A series of three cases of severe Clostridium difficile infection in Australia associated with a binary toxin producing clade 2 ribotype 251 strain

Three patients with severe Clostridium difficile infection (CDI) caused by an unusual strain of C. difficile, PCR ribotype (RT) 251, were identified in New South Wales, Australia. All cases presented with severe diarrhoea, two had multiple recurrences and one died following a colectomy. C. difficile RT251 strains were isolated by toxigenic culture. Genetic characterisation was performed using techniques including toxin gene profiling, PCR ribotyping, whole genome sequencing (WGS), in-silico multi-locus-sequence-typing (MLST) and core-genome single nucleotide variant (SNV) analyses. Antimicrobial susceptibility was determined using an agar incorporation method. In vitro toxin production was confirmed by Vero cell cytotoxicity assay and pathogenicity was assessed in a murine model of CDI. All RT251 isolates contained toxin A (tcdA), toxin B (tcdB) and binary toxin (cdtA and cdtB) genes. Core-genome analyses revealed the RT251 strains were clonal, with 0–5 SNVs between isolates. WGS and MLST clustered RT251 in the same evolutionary clade (clade 2) as RT027. Despite comparatively lower levels of in vitro toxin production, in the murine model RT251 infection resembled RT027 infection. Mice showed marked weight loss, severe disease within 48 h post-infection and death. All isolates were susceptible to metronidazole and vancomycin. Our observations suggest C. difficile RT251 causes severe disease and emphasise the importance of ongoing surveillance for new and emerging strains of C. difficile with enhanced virulence.

Naïve Bayesian Models for Vero Cell Cytotoxicity.

To advance translational research of potential therapeutic small molecules against infectious microbes, the compounds must display a relative lack of mammalian cell cytotoxicity. Vero cell cytotoxicity (CC50) is a common initial assay for this metric. We explored the development of naïve Bayesian models that can enhance the probability of identifying non-cytotoxic compounds. Vero cell cytotoxicity assays were identified in PubChem, reformatted, and curated to create a training set with 8741 unique small molecules. These data were used to develop Bayesian classifiers, which were assessed with internal cross-validation, external tests with a set of 193 compounds from our laboratory, and independent validation with an additional diverse set of 1609 unique compounds from PubChem. Evaluation with independent, external test and validation sets indicated that cytotoxicity Bayesian models constructed with the ECFP_6 descriptor were more accurate than those that used FCFP_6 fingerprints. The best cytotoxicity Bayesian model displayed predictive power in external evaluations, according to conventional and chance-corrected statistics, as well as enrichment factors. The results from external tests demonstrate that our novel cytotoxicity Bayesian model displays sufficient predictive power to help guide translational research. To assist the chemical tool and drug discovery communities, our curated training set is being distributed as part of the Supplementary Material. Graphical Abstract Naive Bayesian models have been trained with publically available data and offer a useful tool for chemical biology and drug discovery to select for small molecules with a high probability of exhibiting acceptably low Vero cell cytotoxicity.

Mechanisms of Ricin Toxin Neutralization Revealed through Engineered Homodimeric and Heterodimeric Camelid Antibodies

Novel antibody constructs consisting of two or more different camelid heavy-chain only antibodies (VHHs) joined via peptide linkers have proven to have potent toxin-neutralizing activity in vivo against Shiga, botulinum, Clostridium difficile, anthrax, and ricin toxins. However, the mechanisms by which these so-called bispecific VHH heterodimers promote toxin neutralization remain poorly understood. In the current study we produced a new collection of ricin-specific VHH heterodimers, as well as VHH homodimers, and characterized them for their ability neutralize ricin in vitro and in vivo. We demonstrate that the VHH heterodimers, but not homodimers were able to completely protect mice against ricin challenge, even though the two classes of antibodies (heterodimers and homodimers) had virtually identical affinities for ricin holotoxin and similar IC50 values in a Vero cell cytotoxicity assay. The VHH heterodimers did differ from the homodimers in their ability to promote toxin aggregation in solution, as revealed through analytical ultracentrifugation. Moreover, the VHH heterodimers that were most effective at promoting ricin aggregation in solution were also the most effective at blocking ricin attachment to cell surfaces. Collectively, these data suggest that heterodimeric VHH-based neutralizing agents may function through the formation of antibody-toxin complexes that are impaired in their ability to access host cell receptors.

Recombinant lipoprotein-based vaccine candidates against C. difficile infections.

BackgroundOpportunistically nosocomial infections in hospitalized patients are often related to Clostridium difficile infections (CDI) due to disruption of the intestinal micro-flora by antibiotic therapies during hospitalization. Clostridial exotoxins A and B (TcdA and TcdB) specifically bind to unknown glycoprotein(s) in the host intestine, disrupt the intestinal barrier leading to acute inflammation and diarrhea. The C-terminal receptor binding domain of TcdA (A-rRBD) has been shown to elicit antibody responses that neutralize TcdA toxicity in Vero cell cytotoxicity assays, but not effectively protect hamsters against a lethal dose challenge of C. difficile spores. To develop an effective recombinant subunit vaccine against CDI, A-rRBD was lipidated (rlipoA-RBD) as a rational design to contain an intrinsic adjuvant, a toll-like receptor 2 agonist and expressed in Escherichia coli.ResultsThe purified rlipoA-RBD was characterized immunologically and found to have the following properties: (a) mice, hamsters and rabbits vaccinated with 3 μg of rlipoA-RBD produced strong antibody responses that neutralized TcdA toxicity in Vero cell cytotoxicity assays; furthermore, the neutralization titer was comparable to those obtained from antisera immunized either with 10 μg of TcdA toxoid or 30 μg of A-rRBD; (b) rlipoA-RBD elicited immune responses and protected mice from TcdA challenge, but offered insignificant protection (10 to 20 %) against C. difficile spores challenge in hamster models; (c) only rlipoA-RBD formulated with B-rRBD consistently confers protection (90 to 100 %) in the hamster challenge model; and (d) rlipoA-RBD was found to be 10-fold more potent than A-rRBD as an adjuvant to enhancing immune responses against a poor antigen such as ovalbumin.ConclusionThese results indicate that rlipoA-RBD formulated with B-rRBD could be an excellent vaccine candidate for preclinical studies and future clinical trials.

Carvacrol and trans-Cinnamaldehyde Reduce Clostridium difficile Toxin Production and Cytotoxicity in Vitro

Clostridium difficile is a nosocomial pathogen that causes a serious toxin-mediated enteric disease in humans. Reducing C. difficile toxin production could significantly minimize its pathogenicity and improve disease outcomes in humans. This study investigated the efficacy of two, food-grade, plant-derived compounds, namely trans-cinnamaldehyde (TC) and carvacrol (CR) in reducing C. difficile toxin production and cytotoxicity in vitro. Three hypervirulent C. difficile isolates were grown with or without the sub-inhibitory concentrations of TC or CR, and the culture supernatant and the bacterial pellet were collected for total toxin quantitation, Vero cell cytotoxicity assay and RT-qPCR analysis of toxin-encoding genes. The effect of CR and TC on a codY mutant and wild type C. difficile was also investigated. Carvacrol and TC substantially reduced C. difficile toxin production and cytotoxicity on Vero cells. The plant compounds also significantly down-regulated toxin production genes. Carvacrol and TC did not inhibit toxin production in the codY mutant of C. difficile, suggesting a potential codY-mediated anti-toxigenic mechanism of the plant compounds. The antitoxigenic concentrations of CR and TC did not inhibit the growth of beneficial gut bacteria. Our results suggest that CR and TC could potentially be used to control C. difficile, and warrant future studies in vivo.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method.

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 μL and 50 μL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.

Evaluation of CHROMagar STEC and STEC O104 Chromogenic Agar Media for Detection of Shiga Toxin-Producing Escherichia coli in Stool Specimens

The performance of CHROMagar STEC and CHROMagar STEC O104 (CHROMagar Microbiology, Paris, France) media for the detection of Shiga toxin-producing Escherichia coli (STEC) was assessed with 329 stool specimens collected over 14 months from patients with suspected STEC infections (June 2011 to August 2012). The CHROMagar STEC medium, after an enrichment broth step, allowed the recovery of the STEC strain from 32 of the 39 (82.1%) Shiga toxin-positive stool specimens, whereas the standard procedure involving Drigalski agar allowed the recovery of only three additional STEC strains. The isolates that grew on CHROMagar STEC medium belonged to 15 serotypes, including the prevalent non-sorbitol-fermenting (NSF) O157:H7, O26:H11, and O104:H4 serotypes. The sensitivity, specificity, and positive and negative predictive values for the CHROMagar STEC medium were between 89.1% and 91.4%, 83.7% and 86.7%, 40% and 51.3%, and 98% and 98.8%, respectively, depending on whether or not stx-negative eae-positive E. coli was considered atypical enteropathogenic E. coli (EPEC) or STEC that had lost Shiga toxin genes during infection. In conclusion, the good performance of CHROMagar STEC agar medium, in particular, the high negative predictive value, and its capacity to identify NSF O157:H7 as well as common non-O157 STEC may be useful for clinical bacteriology, public health, and reference laboratories; it could be used in addition to a method targeting Shiga toxins (detection of stx genes by PCR, immunodetection of Shiga toxins in stool specimens, or Vero cell cytotoxicity assay) as an alternative to O157 culture medium. This combined approach should allow rapid visualization of both putative O157 and non-O157 STEC colonies for subsequent characterization, essential for real-time surveillance of STEC infections and investigations of outbreaks.

Sub-Domains of Ricin’s B Subunit as Targets of Toxin Neutralizing and Non-Neutralizing Monoclonal Antibodies

The B subunit (RTB) of ricin toxin is a galactose (Gal)−/N-acetylgalactosamine (GalNac)-specific lectin that mediates attachment, entry, and intracellular trafficking of ricin in host cells. Structurally, RTB consists of two globular domains with identical folding topologies. Domains 1 and 2 are each comprised of three homologous sub-domains (α, β, γ) that likely arose by gene duplication from a primordial carbohydrate recognition domain (CRD), although only sub-domains 1α and 2γ retain functional lectin activity. As part of our ongoing effort to generate a comprehensive B cell epitope map of ricin, we report the characterization of three new RTB-specific monoclonal antibodies (mAbs). All three mAbs, JB4, B/J F9 and C/M A2, were initially identified based on their abilities to neutralize ricin in a Vero cell cytotoxicty assay and to partially (or completely) block ricin attachment to cell surfaces. However, only JB4 proved capable of neutralizing ricin in a macrophage apoptosis assay and in imparting passive immunity to mice in a model of systemic intoxication. Using a combination of techniques, including competitive ELISAs, pepscan analysis, differential reactivity by Western blot, as well as affinity enrichment of phage displayed peptides, we tentatively localized the epitopes recognized by the non-neutralizing mAbs B/J F9 and C/M A2 to sub-domains 2α and 2β, respectively. Furthermore, we propose that the epitope recognized by JB4 is within sub-domain 2γ, adjacent to RTB’s high affinity Gal/GalNAc CRD. These data suggest that recognition of RTB’s sub-domains 1α and 2γ are critical determinants of antibody neutralizing activity and protective immunity to ricin.

Monoclonal antibodies against the ricin toxin B subunit: Evidence for extracellular and intracellular mechanisms of toxin neutralization. (53.2)

Abstract Antibodies are remarkable in their capacity to inactivate even the most potent protein toxins, including anthrax, botulinum, diphtheria, and ricin. However, the underlying mechanisms by which this occurs are poorly understood. In this study, we have produced and characterized a collection of monoclonal antibodies (mAbs) directed against the B subunit (RTB) of ricin toxin. RTB plays two roles in ricin cytotoxicity; it promotes toxin attachment to host cell surfaces, and it mediates the intracellular trafficking of the toxin from the plasma membrane to the endoplasmic reticulum (ER). We screened ~2,000 RTB-specific murine B cell hybridomas, and identified 4 mAbs with toxin neutralizing activity. Two of these mAbs, SylH3 and 24B11, passively protected mice against a 5xLD50 dose of ricin, but only partially prevented ricin binding to cell surfaces, indicating that they must neutralize ricin by a mechanism other than simply interfering with receptor attachment. Using a modified Vero cell cytotoxicity assay we found that both SylH3 and 24B11 were able to completely neutralize ricin in vitro even after the toxin had bound to cell surfaces. These data reveal that SylH3 and 24B11 neutralize ricin downstream of attachment, perhaps by interfering with the ability of the toxin to traffic to the ER. We are currently using biochemical and microscopic techniques to localize where in the cell these mAbs interfere with ricin toxicity.

Shiga toxin A subunit mutant ofEscherichia coliO157:H7 releases outer membrane vesicles containing the B-pentameric complex

Shiga toxins (STx) are secreted extracellularly through the outer membrane vesicles (OMVs) of Escherichia coli O157:H7. In an attempt to produce STxA-deficient OMVs from E. coli O157:H7, site-specific deletions of the stx1A and stx2A subunit genes were carried out. The STxA-deficient phenotype of the stx1A/stx2A mutant was confirmed by Vero cell cytotoxicity and VTEC-RPLA assay. Western blot analyses showed that the B (STxB) subunits were present without coupling to STxA in the OMVs of the STxA-deficient mutant. Furthermore, STxB was located in its homo-pentameric complexes, as revealed by immunoprecipitation and immunoblotting with anti-STxB antibodies. These results suggest that STxB alone can be oligomerized into the B pentamer in the periplasm, and subsequently entrapped into the OMVs. Determination of the median lethal dose concentration for the OMV preparations suggests that the STxA-deficient OMVs containing STxB complex could be safely used as vaccine delivery vehicles.

Synthesis and antituberculosis activity of some N-pyridyl- N′-thiazolylhydrazine derivatives

In this study, new N-(1-arylethylidene)- N′-(4-arylthiazol-2-yl)hydrazine derivatives were synthesized and evaluated for their antituberculosis activity. The chemical structures of the compounds were elucidated by IR, NMR and FAB +-MS spectral data and Elemental Analyses. The initial screen was conducted against Mycobacterium tuberculosis H37Rv (ATCC 27294) in BACTEC 12B medium using the Microplate Alamar Blue Assay (MABA). The VERO cell cytotoxicity assay was done in parallel with the TB Dose Response assay. Viability was assessed using Promega's Cell Titer-Glo Luminescent Cell Viability Assay. Cytotoxicity was determined from the dose–response curve as the CC50 using a curve-fitting program. One of the compounds showed high activity with low toxicity.

Monoclonal antibody 11E10, which neutralizes shiga toxin type 2 (Stx2), recognizes three regions on the Stx2 A subunit, blocks the enzymatic action of the toxin in vitro, and alters the overall cellular distribution of the toxin.

Monoclonal antibody (MAb) 11E10 recognizes the Shiga toxin type 2 (Stx2) A(1) subunit. The binding of 11E10 to Stx2 neutralizes both the cytotoxic and lethal activities of Stx2, but the MAb does not bind to or neutralize Stx1 despite the 61% identity and 75% similarity in the amino acids of the A(1) fragments. In this study, we sought to identify the segment or segments on Stx2 that constitute the 11E10 epitope and to determine how recognition of that region by 11E10 leads to inactivation of the toxin. Toward those objectives, we generated a set of chimeric Stx1/Stx2 molecules and then evaluated the capacity of 11E10 to recognize those hybrid toxins by Western blot analyses and to neutralize them in Vero cell cytotoxicity assays. We also compared the amino acid sequences and crystal structures of Stx1 and Stx2 for stretches of dissimilarity that might predict a binding epitope on Stx2 for 11E10. Through these assessments, we concluded that the 11E10 epitope is comprised of three noncontiguous regions surrounding the Stx2 active site. To determine how 11E10 neutralizes Stx2, we examined the capacity of 11E10/Stx2 complexes to target ribosomes. We found that the binding of 11E10 to Stx2 prevented the toxin from inhibiting protein synthesis in an in vitro assay but also altered the overall cellular distribution of Stx2 in Vero cells. We propose that the binding of MAb 11E10 to Stx2 neutralizes the effects of the toxin by preventing the toxin from reaching and/or inactivating the ribosomes.

Verotoxigenic Escherichia coli (VTEC) isolated from cow milk

Verotoxigenic Escherichia coli (VTEC) strains are responsible for serious human illnesses. These strains are commonly found in milk. The aim of this study was to determine the occurrence of verotoxigenic E. coli in milk. A total of 351 milk samples, were collected from dairy farms in Bogor, Sukabumi and Cianjur. These samples were analyzed for VTEC using biochemical, serological and vero cell cytotoxicity assays. VTEC O157:H7 isolates were found in milk collected from dairy herds in Bogor and Sukabumi at rates 0.47% of 214 samples, 1.10% of 91 samples respectively, and none in Cianjur. Hemolytic E. coli isolates were found in 0.94% of 214 milk samples from Bogor, 2.2% of 91 milk samples from Sukabumi and none from Cianjur. From E. coli isolates, 53 isolates (67.95%) were verotoxigenic, consisted of: two E. coli O157:H7 isolates and 51 non O157:H7 isolates.Therefore this study showed the occurrence of VTEC in milk samples from dairy farms in Bogor, Sukabumi and Cianjur. Key words : Milk, E . coli (VTEC) O157:H7, Verotoxigenic

Subtype-Specific Suppression of Shiga Toxin 2 Released from Escherichia coli upon Exposure to Protein Synthesis Inhibitors

Shiga toxins (Stx) are important virulence factors in the pathogenesis of severe disease including hemolytic-uremic syndrome, caused by Stx-producing Escherichia coli (STEC). STEC strains increase the release of Stx in vitro following the addition of fluoroquinolones, whereas protein synthesis inhibitors previously have been reported to suppress the release of Stx. The amount of Stx released from wild-type STEC strains incubated with protein synthesis inhibitors was examined by a Vero cell cytotoxicity assay. The amounts released were compared to the Stx type (Stx1 or Stx2) and additionally to the individual subtypes and toxin variants of Stx2. In general, Stx2 release was suppressed significantly upon exposure to protein synthesis inhibitors at MICs, which was not observed in the case of Stx1. Also, the average amount of different Stx2 toxin variants released was suppressed to various levels ranging from 14.0% (Stx2-O157-EDL933) to 94.7% (Stx2d-O8-C466-01B). Clinical studies exploring protein synthesis inhibitors as future candidates for treatment of intestinal infections caused by Stx2-producing STEC should therefore include knowledge of the toxin variant in addition to the subtype.

The Shiga toxin genotype rather than the amount of Shiga toxin or the cytotoxicity of Shiga toxin in vitro correlates with the appearance of the hemolytic uremic syndrome

Shiga toxins (Stx) are believed to play a key role in the pathogenesis of diseases caused by Stx-producing Escherichia coli (STEC), including the potentially life-threatening hemolytic uremic syndrome (HUS). In this study, 201 STEC strains collected from patients and environmental sources were investigated with regard to the stx genotypes and pathogenicity. The stx 2 and stx 2c alleles were associated with high virulence and the ability to cause HUS, whereas stx 2d, stx 2e, stx 1, and stx 1c occurred in milder or asymptomatic infections. Quantification of Stx using an enzyme immunoassay and the Vero cell cytotoxicity assay showed no significant differences between the strains associated with HUS and those causing milder diseases. We hypothesize that the stx genotype and perhaps other yet unknown virulence factors rather than the amount of Stx or the in vitro cytotoxicity correlate with the development of HUS.

Rapid Detection of Shiga Toxin-Producing Escherichia coli by Optical Immunoassay

In a multi-health center study, a new rapid optical immunoassay (OIA) for the detection of Shiga toxin types 1 and 2, the BioStar OIA SHIGATOX kit (Inverness Medical Professional Diagnostics, Inc.), was used to prospectively screen 742 fresh fecal samples for Shiga toxins in parallel with the Premier enterohemorrhagic Escherichia coli (EHEC) kit (Meridian BioScience, Inc.) with and without enrichment of the specimens by incubation in MacConkey broth. Additionally, 85 previously tested frozen fecal samples were assessed as described above. All positive immunoassay results were confirmed by the Vero cell cytotoxicity assay. A further modification of the screening procedure was evaluated on 470 of the prospectively screened specimens. Swabs of growth from conventionally plated stool culture media were subjected to the OIA SHIGATOX, and results were compared with those obtained with the Premier EHEC kit following broth enrichment. Overall, the OIA SHIGATOX kit was significantly more sensitive than the Premier EHEC kit on fresh direct stool specimens (sensitivities, 96.8% and 83.9%, respectively; P < 0.05). The two assays performed equally well with each other on frozen and broth-enriched samples. The colony sweep method used in conjunction with the OIA kit was somewhat more effective at detection of Shiga toxins from growth on agar than the overnight broth enrichment procedure used with the Premier EHEC assay (sensitivities, 100% and 92%, respectively; P < 0.09). Overall, the OIA SHIGATOX kit provided rapid, easy-to-interpret results and was highly effective at detection of Shiga toxin-producing E. coli in fecal samples and overnight cultures.