Vascular Endothelial Growth Factor Expression In Cells Research Articles

Macrophage Migration Inhibitory Factor Elicits an Angiogenic Phenotype in Human Ectopic Endometrial Cells and Triggers the Production of Major Angiogenic Factors via CD44, CD74, and MAPK Signaling Pathways

An active angiogenesis is required for ectopic endometrial tissue growth. Our previous studies led to the identification of macrophage migration inhibitory factor (MIF), which is markedly elevated in active, vascularized, and early-stage endometriotic lesions, as a potent mitogenic factor for endothelial cells. Our objective was to study the mechanisms by which MIF may stimulate angiogenesis in ectopic endometrial implantation sites. Primary cultures of ectopic endometrial cells were exposed to MIF, and the release of major angiogenic factors with targeted disruption of MIF signaling pathways was assessed. Patients were women found to have endometriosis during laparoscopy. The study was conducted at a hospital and reproduction research laboratory. Biopsies were removed from endometriotic lesions. Vascular endothelial cell growth factor (VEGF), IL-8, and monocyte chemotactic protein-1 (MCP-1) mRNA and protein levels and expression and small interfering RNA silencing of MIF CD74/CD44 receptor complex and phosphorylation of ERK and p38 MAPKs were evaluated. MIF markedly up-regulated VEGF, IL-8, and MCP-1 expression in endometriotic cells. Such an effect was abolished by (S,R)-3-(4-hydroxyphenyl)-4,5-dihydro-5-isoxazole acetic acid methyl ester (ISO-1), a specific inhibitor of MIF, and significantly down-regulated after specific small interfering RNA silencing of CD44 or CD74. MIF treatment strongly activated ERK and p38 MAPKs, and specific inhibitors of both pathways completely blocked basal and MIF-induced VEGF, IL-8, and MCP-1 synthesis. These results show for the first time that MIF exerts a potent indirect angiogenic effect by interacting with ectopic endometrial cells and inducing the secretion of major angiogenic factors via CD44, CD74, and MAPK signaling pathways and provide evidence for a possible new mechanism underlying endometriosis development and pathophysiology.

Cell transplantation for myocardial injury: a preliminary comparative study

Cell transplantation may restore viable muscle after myocardial infarction. Because many studies have focused on one cell type, we compared the characteristics of skeletal myoblasts (SKM), bone marrow stromal/stem cells (BMSC) and smooth muscle cells (SMC) and their effects on cardiac function after myocardial injury. In vitro cell characteristics, including proliferation, hypoxic survival and vascular endothelial cell growth factor (VEGF) expression, of SKM, BMSC and SMC were compared. An in vivo left anterior descending artery ligation rat model was used, and cells were implanted into the infarct (n = 16 per cell type). Cell survival was determined by PKH26 staining and real-time polymerase chain reaction (PCR). Cardiac function, tissue VEGF and stem cell factor (SCF) expression and vasculogenesis were evaluated. Although cell morphologies were distinct, in vitro proliferation was similar. In vitro studies showed that SKM had the highest hypoxic survival, whereas BMSC had the lowest hypoxic survival but the highest VEGF expression. After implantation, SKM showed the highest overall survival and in vivo SCF expression, and both SMC and SKM expressed the highest VEGF levels. Vasculogenesis was significantly (P < 0.001) improved after transplantation of each cell type. Overall, BMSC and SKM promoted the greatest improvement in cardiac function. SKM, BMSC and SMC expressed VEGF and SCF and promoted vasculogenesis. Although BMSC showed the greatest regenerative potential relative to cell survival and growth factor expression, the greatest improvement in cardiac function was observed with BMSC and SKM.

Receptor Activator of NF-κB Ligand Enhances Breast Cancer–Induced Osteolytic Lesions through Upregulation of Extracellular Matrix Metalloproteinase Inducer/CD147

Breast cancer shows a strong predilection to metastasize to bone. Cell surface glycoprotein extracellular matrix metalloproteinase inducer (EMMPRIN)/CD147 induces metalloproteinases (MMP) and vascular endothelial growth factor (VEGF), which may support osteoclastic activity and increased incidence of breast cancer bone metastases. In support of this hypothesis, we observed that MDA-MB-231 human breast tumor cells engineered to overexpress EMMPRIN strongly induced osteolytic lesions in immunodeficient mice, which was blunted by in vivo treatment with an EMMPRIN blocking antibody. Similarly, these cells exhibited increased expression of MMP-9 and VEGF relative to control cells. Treatment of MDA-MB-231 cells with the osteoclastogenic cytokine receptor activator of NF-kappaB ligand (RANKL) upregulated EMMPRIN expression with a parallel increase of MMP-9 and VEGF. Conditioned medium from osteoblasts similarly increased EMMPRIN, MMP-9, and VEGF expression in cells. Osteoblast treatment with the RANKL decoy receptor osteoprotegerin abolished this effect. EMMPRIN overexpression stimulated MDA-MB-231 cell invasion but not proliferation. Conversely, small interfering RNA-mediated knockdown of EMMPRIN downregulated MMP-9 and VEGF basal expression and RANKL-stimulated expression, and reduced cell invasion. Our results argue that EMMPRIN drives breast cancer-induced osteolytic lesions and that activation of the RANKL pathway increases EMMPRIN in osteotropic tumor cells, in turn enhancing tumor-induced bone resorption.

Experimental studies of rAd-p53 injection by interventional approach for the treatment of rabbit VX2 liver cancer

To evaluate the efficacy of recombinant human adenovirus p53 gene therapy (rAd-p53) in the rabbit VX2 liver cancer model using different interventional therapy approach. Thirty New Zealand rabbits implanted with VX2 tumor in the liver were randomized into five groups with six of each. The tumor volumes (V1) were measured by MRI and CT scan 11 days after tumors implanted. The interventional therapy scheme performed as below: intraarterial 0.9% saline solution perfusion in group A, transcatheter arterial embolization with 0.5 ml ultrafluid lipiodol in group B, intraarterial rAd-p53 gene perfusion in group C (1 x 10(6)/VP); intraarterial rAd-p53 gene perfusion (1 x 10(6)/VP) in combination with transcatheter arterial embolization (ultrofluid lipiodol, 0.5 ml) in group D and intratumoral rAd-p53 gene (1 x 10(6)/VP) injection in group E. The tumor volumes (V2) were measured by MRI and CT scan, and the tumor growth ratios were calculated 14 days after interventional procedures. Then all animals were sacrificed. The tumor tissues were explanted for immunohistochemistry to observe the expressions of vascular endothelial cell growth factor (VEGF) and factor VIII. Microvessel density (MVD) of the tumor tissues was assessed by factor VIII immunohistochemical analysis. In addition, apoptotic index was assessed by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining. The tumor volumes before therapy were (79.4+/-8.2), (75.3+/-7.8), (74.6+/-6.6), (78.7+/-9.1), (75.8+/-8.4) mm(3) respectively, without differences found among them (F = 12.248, P = 0.0636). But the tumor volumes after therapy were (564.7+/-96.7), (176.5+/-83.2), (239.6+/-42.8), (159.8+/-58.6), (334.7+/-32.6) mm(3) respectively (F = 24.537, P = 0.0218). The tumor growth ratios were 6.9, 2.6, 3.1, 1.6 and 4.1 respectively. The mean apoptosis index were 12.0%+/-1.1%, 14.5%+/-2.1%, 17.6%+/-2.3%, 18.6%+/-2.3% and 19.6%+/-2.5% respectively. with significant differences in group E in comparison with the other four groups. Mean positive ratio of VEGF was 50.0%, 83.3%, 83.3%, 50.0% and 50.0% respectively, with significant differences observed in group B and group C compared with the other three groups (F = 7.84, P = 0.019). The differences of VIII factor positive expression ratio among each group were significant (F = 0.854, P = 0.018). Statistical analysis showed a positive correlation between the expression of VEGF and MVD (r = 2.400, P = 0.0233). The rAd-p53 has effective treatment outcomes in VX2 rabbit liver cancer, and intra-arterial rAd-p53 gene perfusion in combination with transcatheter arterial embolization is the best approach in comparison with intra-arterial rAd-p53 gene perfusion, transcatheter arterial embolization and intratumoral rAd-p53 gene injection alone.

Treatment of ischemic limbs by transplantation of G-CSF stimulated bone marrow cells in diabetic rabbits

To evaluate the efficacy of autologous transplantation of granulocyte colony-stimulating factor (G-CSF) stimulated bone marrow mononuclear cells in the treatment of diabetic lower limb ischemic disease in a rabbit model. The diabetic model was produced by intravenous injection of 5% alloxan into New Zealand white rabbits. The lower limb ischemia model was created by femoral artery ligation in diabetic rabbits (n=50) 14 days after alloxan injection. Animals were then randomized into five groups (10 rabbits per group): group 1, transplanted with G-CSF immobilized peripheral blood mononuclear cells (PBMNC); group 2, transplanted with G-CSF stimulated bone marrow mononuclear cells (BMMNC); group 3, animals were transplanted with non-stimulated BMMNCs; group 4, G-CSF group injected with G-CSF alone without transplantation; and group 5, PBS group treated with PBS alone. Necrosis of foot or toes and blood flow recovery in ischemic limbs was assessed. Expression of von Willebrand factor (vWF) and vascular endothelial cell growth factor (VEGF) were measured in ischemic muscles by immunohistochemistry analysis. Blood flow in ischemic limbs was significantly improved in the G-BMMNC group (ratio of blood flows: 0.82+/-0.06) in comparison with the G-PBMNC (0.61+/-0.09) and BMMNC (0.62+/-0.08) groups (P < 0.001). In the G-BMMNC group, the capillary density, a measure of vWF expression, was significantly higher than in either the G-PBMNC or BMMNC groups (47.9+/-2.51 vs. 36.8+/-4.16 and 39.6+/-2.72, respectively, P < 0.05). The expression of VEGF in G-BMMNC animals was significantly increased in comparison with the G-PBMNC and BMMNC groups (16.93+/-0.70 vs. 11.83+/-0.98 and 12.32+/-0.96, respectively, P < 0.05). A combination of G-CSF stimulation and autologous transplantation of bone marrow stem cells synergistically improved neovascularization and angiogenesis in ischemic limb tissues in diabetic rabbits.

Analysis of expression profiles of some tumor growth-related genes after silencing of pleiotrophin in human small cell lung cancer H446 cells

To investigate the changes in expression profiles of angiomotin (Amot), schlafen5 (Slfn5), metalloproteinase-9 (MMP-9) and vascular endothelial cell growth factor (VEGF), which are genes associated with angiogenesis, tumor growth and invasion, after gene silencing of pleiotrophin (PTN) in human small cell lung cancer H446 cells. PTN expression in H446 cells was determined by RT-PCR and Western blot. After constructing a lentiviral vector interfering PTN expression, it was packaged into virus in 293T cells. Then the virus was used to infect human small cell lung cancer H446 cells. The expressions of Amot, Slfn5, MMP-9 and VEGF were detected by RT-PCR in normal non-interference group, negative control group, PTN-interference group and group combining PTN interference and chemotherapy. The results of RT-PCR and Western blot test showed that PTN expression in H446 cells was high. The interference efficiency of constructed ShRNA sequences (GCAGCTGTGGATACTGCTGAA) targeting PTN was as high as 72.1% and 59.2% at the mRNA and protein levels, respectively, in H446 cells. Compared with the negative control group, the expressions of Slfn5 and MMP-9 in H446 cells were increased by 165.1% and 47.3%, while the ones of Amot and VEGF were down-regulated by 33.1% and 26.6%, respectively, after gene silencing of PTN. The changes of gene expression profile became more evident when chemotherapy was superimposed on PTN interference. Gene silencing of PTN using siRNA lentiviral expressing vector can influence the expression of proliferation and metastasis-related genes in human small cell lung cancer H446 cells.

The effect of astragalus polysaccharide on the expression of VEGF in Müller cell cultured in high level of glucose

ObjectiveTo investigate the molecular mechanism of diabetes mellitus retinal injury and the protective role of astragalus polysaccharide ( APS ) on it.MethodsSeparated the retinal tissue from 5 days Wistar rat using trypsinase digest methods and cultured in 1640 with 20% FBS, at 37°C in humidified air with 5% CO2. The cells were identified by glial fibrillary acid protein (GFAP) using immuocytochemistry methods. The second generation, GFAP positive Müller cells were divided into 4 groups: 1) control group: cultured in the normal culture medium; 2) APS group: cultured in the normal culture medium with 400ug/ml APS; 3) high glucose group: cultured in the normal culture medium with 20mmol/L glucose; 4) high glucose APS group: cultured in the normal culture medium with 400ug/ml APS and 20mmol/L glucose. Three days later, the expression of vascular endothelial cell growth factor (VEGF) in Müller cells were detected by immunohistochemistry and reverse transcription‐polymerase chain reaction (RT‐PCR) methods respectively.ResultsThe expression of VEGF in Müller cells of high glucose APS group was significantly decreased comparing with that of high glucose group. There is no significantly difference between other groups.ConclusionAPS may prevent and treat diabetic retinopathy by reduced the expression of VEGF in Müller cells.

Melatonin suppresses tumor angiogenesis by inhibiting HIF-1α stabilization under hypoxia

Angiogenesis is an important mediator of tumor progression. As tumors expand, diffusion distances from the existing vascular supply increases, resulting in hypoxia in the cancer cells. Sustained expansion of a tumor mass requires new blood vessel formation to provide rapidly proliferating tumor cells with an adequate supply of oxygen and nutrients. The key regulator of hypoxia-induced angiogenesis is the transcription factor known as hypoxia-inducible factor (HIF)-1. HIF-1alpha is stabilized by hypoxia-induced reactive oxygen species (ROS) and enhances the expression of several types of hypoxic genes, including that of the angiogenic activator known as vascular endothelial cell growth factor (VEGF). In this study, we found that melatonin, a small lipophilic molecule secreted primarily by the pineal gland, destabilizes hypoxia-induced HIF-1alpha protein levels in the HCT116 human colon cancer cell line. This destabilization of HIF-1alpha resulted from the antioxidant activity of melatonin against ROS induced by hypoxia. Moreover, under hypoxia, melatonin suppressed HIF-1 transcriptional activity, leading to a decrease in VEGF expression. Melatonin also blocked in vitro tube formation and invasion and migration of human umbilical vein endothelial cells induced by hypoxia-stimulated conditioned media of HCT116 cells. These findings suggest that melatonin could play a pivotal role in tumor suppression via inhibition of HIF-1-mediated angiogenesis.

Blocking effects of siRNA on VEGF expression in human colorectal cancer cells

To investigate the expression of vascular endothelial cell growth factor (VEGF) and its receptors Fms-like tyrosine kinase 1 (FLT-1) and fetal liver kinase 1 (FLK-1) in colorectal carcinoma (CRC), and the blocking effects of small interfering RNAs (siRNAs) on VEGF expression in human colorectal cancer HCT116 cells. Immunohistochemical staining for VEGF, FLT-1 and FLK-1 proteins was performed in 82 cases of CRC and 14 normal colorectal mucosae. A siRNA targeting VEGF was synthesized and transfected into HCT116 cells using lipofectamine 2000. Immunocytochemical staining and Western blotting analyses were performed to detect the expression of VEGF protein. The suppressive effect of the siRNA on cell proliferation was detected using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltertrazolium bromide (MTT) assay. Cellular apoptosis was detected using flow cytometry (FCM). The expression of VEGF, FLT-1 and FLK-1 in tumor tissues was significantly higher than that in normal tissues (P = 0.008, P = 0.000, P = 0.000). The expression of VEGF was positively correlated with both lymph node metastasis and clinical stage (P = 0.009 and P = 0.025, respectively). Immunocytochemistry showed that the expression of VEGF was weakly positive and Western blotting indicated a significant reduction in VEGF-siRNA cell protein levels. VEGF-siRNA cell growth inhibition was assessed by the MTT assay, and the tumor cell proliferation rate was significantly different at 24, 48, and 72 h after transfection. FCM results showed that the VEGF-siRNA group had an apparent aneuploid peak. VEGF, FLT-1 and FLK-1 are associated with colorectal carcinogenesis. siRNA silencing of the VEGF gene suppresses proliferation, and induces apoptosis in HCT116 cells. The results suggest that VEGF may be a new gene therapy target for colorectal cancer.

Mechanical signals control SOX-9, VEGF, and c-Mycexpression and cell proliferation during inflammation via integrin-linked kinase, B-Raf, and ERK1/2-dependent signaling in articular chondrocytes

IntroductionThe importance of mechanical signals in normal and inflamed cartilage is well established. Chondrocytes respond to changes in the levels of proinflammatory cytokines and mechanical signals during inflammation. Cytokines like interleukin (IL)-1β suppress homeostatic mechanisms and inhibit cartilage repair and cell proliferation. However, matrix synthesis and chondrocyte (AC) proliferation are upregulated by the physiological levels of mechanical forces. In this study, we investigated intracellular mechanisms underlying reparative actions of mechanical signals during inflammation.MethodsACs isolated from articular cartilage were exposed to low/physiologic levels of dynamic strain in the presence of IL-1β. The cell extracts were probed for differential activation/inhibition of the extracellular signal-regulated kinase 1/2 (ERK1/2) signaling cascade. The regulation of gene transcription was examined by real-time polymerase chain reaction.ResultsMechanoactivation, but not IL-1β treatment, of ACs initiated integrin-linked kinase activation. Mechanical signals induced activation and subsequent C-Raf-mediated activation of MAP kinases (MEK1/2). However, IL-1β activated B-Raf kinase activity. Dynamic strain did not induce B-Raf activation but instead inhibited IL-1β-induced B-Raf activation. Both mechanical signals and IL-1β induced ERK1/2 phosphorylation but discrete gene expression. ERK1/2 activation by mechanical forces induced SRY-related protein-9 (SOX-9), vascular endothelial cell growth factor (VEGF), and c-Myc mRNA expression and AC proliferation. However, IL-1β did not induce SOX-9, VEGF, and c-Myc gene expression and inhibited AC cell proliferation. More importantly, SOX-9, VEGF, and Myc gene transcription and AC proliferation induced by mechanical signals were sustained in the presence of IL-1β.ConclusionsThe findings suggest that mechanical signals may sustain their effects in proinflammatory environments by regulating key molecules in the MAP kinase signaling cascade. Furthermore, the findings point to the potential of mechanosignaling in cartilage repair during inflammation.

Tissue microarray를 이용한 사이모신 베타4(Thymosin β4)와 vascular endothelial cell growth factor (VEGF)의 정상 인간 조직 발현 양상 연구

사이모신 베타 4와 VEGF의 발현을 여러 인간 조직에서 tissue microarray를 사용하여 조사하였다. 사이모신 베타 4는 간, 이자, 침샘의 관상피, 심장에서 강한 발현을 보였으며 피부, 폐, 이자, 림프절, 갑상선, 요관, 폐와 부신의 혈관 내피세포 등에서 중간 수준의 발현 양상을 보였다. VEGF의 발현 양상은 대체적으로 사이모신 베타 4와 동일하였으며 이자, 요관, 유선, 간, 식도, 신장, 폐, 부신 등의 혈관 내피세포에서 강하게 발현되었다. 이러한 결과를 통해 사이모신 베타 4는 간, 이자, 침샘의 관상피, 심장에서 중요한 역할을 담당하며 VEGF와 같은 발현 양상을 보여 혈관 신생작용에 관여함을 확인하였다. Thymosin <TEX>${\beta}4$</TEX>, a small protein containing 43 amino acids, has multi-functional roles in cell physiology. It was first identified as a thymic maturation factor and recently has been shown to accelerate wound healing, hair growth, angiogenesis, tumor growth, and metastasis. It was also reported to play a key role in developing organs, including the nervous system and heart. Thymosin <TEX>${\beta}4$</TEX> induces the expression of vascular endothelial cell growth factor (VEGF), laminin-5, and other important biologically active genes. Using tissue microarray analysis, we investigated the expression patterns of thymosin <TEX>${\beta}4$</TEX> and VEGF in various normal human adult tissues. Thymosin <TEX>${\beta}4$</TEX> was highly expressed in the liver, pancreas, ductal epithelium of the salivary gland, and heart, and moderately expressed in the skin, lung, spleen, lymph node, thymus, ureter, and blood endothelial cells in both the lung and adrenal gland. The expression of VEGF generally co-localized with thymosin <TEX>${\beta}4$</TEX> and VEGF was highly expressed in the pancreas, ureter, mammary gland, liver, esophagus, and blood endothelial cells in both the lung and adrenal gland. These results suggest that thymosin <TEX>${\beta}4$</TEX> plays an important role in the function of various organs and since the expression pattern of thymosin <TEX>${\beta}4$</TEX> co-localized with VEGF, part of that function may be to induce or maintain angiogenesis.

Sphingosine 1-phosphate induces vesicular endothelial growth factor expression in endothelial cells

Angiogenesis is essential for tumor growth and vascular endothelial cell growth factor (VEGF) plays a key role in this process. Conversely, sphingosine 1-phosphate (S1P) is a biologically active sphingolipid known to play a key role in cancer progression by regulating endothelial cell proliferation and migration. In this study, the authors found that S1P increases the level of VEGF mRNA in human umbilical vein endothelial cells (HUVECs) and immortalized HUVECs (iHUVECs). Additionally, S1P was found to increase VEGF promoter activity in MS-1 mouse pancreatic islet endothelial cells. Furthermore, a pharmacological inhibitory study revealed that G(alpha i/o)-mediated phospholipase C, Akt, Erk, and p38 MAPK signaling are involved in this S1P-induced expression of VEGF. A component of AP1 transcription factor is important for S1P-induced VEGF expression. Taken together, these findings suggest that S1P enhances endothelial cell proliferation and migration by upregulating the expression of VEGF mRNA.

Expression of vascular endothelial growth factor is coordinately regulated by the activin-like kinase receptors 1 and 5 in endothelial cells

AbstractExpression of vascular endothelial growth factor (VEGF) is tightly regulated to achieve normal angiogenesis. The objective was to examine regulation of VEGF by the activin-like kinase receptors (ALKs) ALK1 and ALK5. Transforming growth factor β1 (TGFβ1) and bone morphogenetic protein-9 (BMP-9) enhanced and suppressed VEGF expression, respectively, in aortic endothelial cells, as determined by real-time polymerase chain reaction, immunoblotting, cell proliferation, and tube formation. The use of small interfering RNA revealed that TGFβ1 stimulated VEGF expression by activating ALK5, TGFβ type II receptor, and SMAD2, whereas BMP-9 suppressed it by activating ALK1, BMP type II receptor, and SMAD1. ALK1 signaling occurred independently of ALK5 activity. Partial ALK1 deficiency in vitro and in vivo resulted in elevated VEGF expression. In vitro, increased BMP-9 levels normalized VEGF expression in cells with partial, but not severe, ALK1 deficiency. Time course experiments revealed that an increase in ALK1 expression induced by BMP-4, an angiogenic stimulus, preceded induction of ALK5 and VEGF in control cells. In ALK1-deficient cells, however, VEGF expression occurred earlier and was abnormally high, even though ALK5 was not induced. Our results suggest that ALK1 and ALK5 are both essential for correct regulation of VEGF, and that disruption of either pathway leads to disease.

Inhibitory effect of ginsenoside Rg3 combined with gemcitabine on angiogenesis and growth of lung cancer in mice

BackgroundGinsenoside Rg3, a saponin extracted from ginseng, inhibits angiogenesis. The combination of low-dose chemotherapy and anti-angiogenic inhibitors suppresses growth of experimental tumors more effectively than conventional therapy or anti-angiogenic agent alone. The present study was designed to evaluate the efficacy of low-dose gemcitabine combined with ginsenoside Rg3 on angiogenesis and growth of established Lewis lung carcinoma in mice.MethodsC57L/6 mice implanted with Lewis lung carcinoma were randomized into the control, ginsenoside Rg3, gemcitabine and combination group. The quality of life and survival of mice were recorded. Tumor volume, inhibitive rate and necrosis rate were estimated. Necrosis of tumor and signals of blood flow as well as dynamic parameters of arterial blood flow in tumors such as peak systolic velocity (PSV) and resistive index (RI) were detected by color Doppler ultrasound. In addition, expression of vascular endothelial cell growth factor (VEGF) and CD31 were observed by immunohistochemstry, and microvessel density (MVD) of the tumor tissues was assessed by CD31 immunohistochemical analysis.ResultsQuality of life of mice in the ginsenoside Rg3 and combination group were better than in the control and gemcitabine group. Combined therapy with ginsenoside Rg3 and gemcitabine not only enhanced efficacy on suppression of tumor growth and prolongation of the survival, but also increased necrosis rate of tumor significantly. In addition, the combination treatment could obviously decrease VEGF expression and MVD as well as signals of blood flow and PSV in tumors.ConclusionGinsenoside Rg3 combined with gemcitabine may significantly inhibit angiogenesis and growth of lung cancer and improve survival and quality of life of tumor-bearing mice. The combination of chemotherapy and anti-angiogenic drugs may be an innovative and promising therapeutic strategy in the experimental treatment of human lung cancer.

Lymphatic metastasis is related to the epithelial-mesenchymal transition and expressions of VEGF, MMP-9, and COX-2 in breast cancer

The invasion and metastasis of breast cancer are supposed to involve several stages in which epithelial-mesenchymal transition (EMT) is regarded as the mechanistic basis for the behavior of cancer cells. A series of factors related to EMT are apparently involved in such process. The current study aimed to investigate the contributions of EMT and related factors in lymph node metastasis of breast cancer. The expressions of E-cadherin (E-Cad), N-cadherin (N-Cad), vascular endothelial cell growth factor (VEGF), matrix metalloproteinase-9 (MMP-9), cyclooxygenase-2 (COX-2), and CD34 were examined in 74 cases of breast cancer, including 39 cases with lymph node metastasis and 35 cases without lymph node metastasis by immunohistochemistry. Multivariable Cox proportional hazards model was used to analyze the patients’ prognosis. The expressions of N-Cad, VEGF, MMP-9, and COX-2 in cases with lymph node metastasis were significantly higher than those without lymph node metastasis (P<0.05), while the E-Cad level was inversely related to status of lymph node metastasis (P<0.05). The metastasis rate of lymph node in the cases with EMT (lower E-Cad expression and higher N-Cad expression) was 78.3%, while that without EMT (higher E-Cad expression and lower N-Cad expression) was 11.1%. There was a statistical difference in the expression of COX-2 protein between histological grade I and grade II or III, respectively (P<0.05). In the cases with higher grade, the expression of E-Cad was decreased, while that of N-Cad was increased. Higher microvascular density (MVD) was also found to be significantly associated with lymphatic metastasis (P<0.05), and the cases with higher MVD had shorter survival time. This study indicates that EMT and expressions of VEGF, MMP-9 and COX-2, and MVD value are strongly correlated with lymph node metastasis in breast cancer.

The expression of HIF-1α and VEGF as well as their correlation with angiogenesis in esophageal squamous cell carcinomas

Objective To investigate the correlations among the expressions of hypoxia-inducible factor-1α (HIF-1α), vascular endothelial cell growth factor (VEGF) and microvessel density (MVD), and their relationships to the clinicopathologic characteristics of esophageal squamous cell carcinomas (ESCC).

Insulin-like growth factor binding protein-7 (IGFBP7) blocks vascular endothelial cell growth factor (VEGF)-induced angiogenesis in human vascular endothelial cells

Insulin-like growth factor binding protein-7 (IGFBP7) and vascular endothelial growth factor (VEGF) are expressed in vascular endothelial cells in several tumor types. In this study, we examined the effect of IGFBP7 on VEGF-induced tube formation in cultured human umbilical vein endothelial cells (HUVECs) and its potential action in the modulation of VEGF signaling in vascular cells. IGFBP7 treatment suppressed VEGF-induced tube formation, proliferation, and the phosphorylation of mitogen-activated protein kinase kinase (MEK) and extracellular signal-regulated kinase (ERK) 1/2 in HUVECs. IGFBP7 attenuated VEGF-enhanced cyclooxygenase (COX)-2 and VEGF mRNA expression, and prostaglandin E 2 secretion. Knocking down endogenous IGFBP7 enhanced COX-2 and VEGF mRNA expression. A significant increase in IGFBP7-induced caspases was not observed in the presence of VEGF. These findings indicate that IGFBP7 can modulate the stimulatory effect of VEGF on angiogenesis by interfering with VEGF expression as well as VEGF signaling and not by inducing apoptosis.

The correlation of tumor vascularity as imaged by near-infrared technology with tissue distribution of angiogenic and growth promoters.

Abstract Abstract #907 Background: Angiogenesis is necessary for solid tumors to grow. Rapidly growing tissues, increased metabolic demands as well as the presence of hypoxia and ischemia promote angiogenesis by stimulation of factors like vascular endothelial cell growth factor (VEGF), a key angiogenic factor. Many studies have found that angiogenesis is an independent prognostic factor in both node positive and node negative breast cancer. We have developed a novel technique, ultrasound guided optical tomography in the near-infrared wavelength (NIR-US), that accurately localizes tumor lesion with ultrasound and then images tumor angiogenesis. We have now collected images and tissue from 12 patients treated with preoperative chemotherapy. These tumors are large and heterogeneous with respect to vascular images. We have begun to correlate the tissue expression of a variety of pro-angiogenic proteins with the extent, distribution and pattern of vascularity demonstrated by our NIR-US. Methods: Using NIR-US images, the quantification of vascular content was performed by measuring the total hemoglobin content X volume of distribution of that hemoglobin content. This measure is termed the Blood Volume Index (BVI). In 12 patients studied, the level of tumor vascularity as measured by the initial BVI did not correlate with tumor grade, mitotic index, or estrogen receptor status or most importantly with response to treatment. We analyzed tissue specimens already collected with known patterns of vascular distribution on NIR-US and with known MVD to understand what might be driving the vascular response. Histologic sections were prepared and stained for; endothelial adhesion marker PECAM/CD31, VEGF, the activated stress response kinase P-AMPK, the cell proliferation marker Ki67, and SMA (smooth muscle actin) a marker of vasculature support cells and glucose transporter-1. Each case was quantified using at least 5 40X fields and pixel-by-pixel summation using Image Pro Plus software (Media cybernetics, Inc.) represented as average +/- SD. Results: The tumor BVI as defined by NIR-US did not correlate with either CD31 or SMA expression and was inversely correlated with VEGF levels. The higher VEGF, the lower the BVI. Of particular interest, the highest CD31 signals correlated with high VEGF levels in two, HER-2 positive patients, but not with BVI. Proliferation rate (Ki67), glucose transporter-1 and P-AMPK expression did not correlate with vascular content as measured by NIR-US.&amp;#x2028; Conclusion: Study of the above growth promoters in tissue imaged by NIR-US did not reveal an association between their expression and the vascular content of the tissue. Of interest, VEGF expression varied greatly within the tumor specimens and showed no correlation to BVI.&amp;#x2028; Financial support provided by a Research Grant from the CT Breast Health Initiative. Citation Information: Cancer Res 2009;69(2 Suppl):Abstract nr 907.

Protective role of ascorbic acid isolated from Cissus quadrangularis on NSAID induced toxicity through immunomodulating response and growth factors expression

The present study investigate the effect of ascorbic acid, the major bioactive component isolated from Cissus quadrangularis extract (CAA) on inflammatory cytokines and growth factors in non-steroidal anti-inflammatory drug (NSAID) induced gastric ulcer. Analysis of serum cytokine profile using enzymelinked immunosorbent assay (ELISA) showed a drastic increase in interleukin (IL)-1β, IL-6, tumour necrosis factor-alpha (TNF)-α, interferon-gamma (IFN-γ) and decrease in IL-10, Il-4 and prostaglandin E2 (PGE2) levels in NSAID (aspirin) treated rats. The reduction of growth factors such as transforming growth factor-alpha (TGF)-α and vascular endothelial cell growth factor (VEGF) by aspirin was determined by immunohistochemistry method. Administration of CAA produced significant protection against aspirin induced gastric toxicity by showing significant increase in PGE2, TGF-α, VEGF expression and accompanied by a significant inhibition of nitric oxide and regulating the levels of cytokines in rats. These findings suggest that CAA prevents gastric ulcer formation due to its immunomodulatory effect, antioxidant activity along with the ability to modulate PG synthesis and up-regulation of the growth factors.

Correlation between hypoxia-inducible factor and vascular endothelial growth factor expression under tumor neovascularization in hepatocellular carcinoma cell-implanted nude mice

Background: In a tumor, hypoxia-inducible factor-1α (HIF-1α) and vascular endothelial cell growth factor (VEGF) are induced to promote angiogenesis for the growth and metastasis of cells. There have been very few studies to examine in vivo relation between HIF-1α and VEGF during tumor progression. Objective: To study the relationship between HIF-1α and VEGF expressions under neovascularization induced by hepatocellular carcinoma cells (HepG2) implanted in nude mice. Methods: Male BALB/c-nude mice 8-10 weeks of age were used. A chamber was prepared on the dorsal skin in which HepG2 was transplanted to induce a tumor. On the day of the experiment, and on days 2, 7, and 14, microcirculation within the chamber was observed using fluorescence videomicroscopy. Based on the recorded video images, capillary vascularity (CV) was measured to examine tumor neovascularization. VEGF expression was measured in blood (serum) withdrawn, using enzyme immunoassay, while HIF-1α expression was measured on samples isolated from tumor tissue, using immunohistochemistry. Results: The measured CV significantly increased on day 7 and 14 compared to the aged-matched controls (p < 0.05). HIF-1α markedly expressed on day 2, and the expression declined on day 7 and 14 post-inoculation. VEGF expression in serum increased more on day 7 and 14 than on day 2. HIF-1α expression decreased with the increase in VEGF expression from 2 to 14 days after HepG2 implantation, showing a reverse correlation. Conclusion: HIF-1α expression existed prior to both VEGF expression and neovascularization in the tumor. An inhibitor of HIF-1α might be a therapeutic agent for reducing neovascularization via adaptation to hypoxia in tumors.