Variable Loop Region Research Articles

Structural Features in the KshA Terminal Oxygenase Protein That Determine Substrate Preference of 3-Ketosteroid 9 -Hydroxylase Enzymes

Rieske nonheme monooxygenase 3-ketosteroid 9α-hydroxylase (KSH) enzymes play a central role in bacterial steroid catabolism. KSH is a two-component iron-sulfur-containing enzyme, with KshA representing the terminal oxygenase component and KshB the reductase component. We previously reported that the KshA1 and KshA5 homologues of Rhodococcus rhodochrous DSM43269 have clearly different substrate preferences. KshA protein sequence alignments and three-dimensional crystal structure information for KshA(H37Rv) of Mycobacterium tuberculosis H37Rv served to identify a variable region of 58 amino acids organized in a β sheet that is part of the so-called helix-grip fold of the predicted KshA substrate binding pocket. Exchange of the β sheets between KshA1 and KshA5 resulted in active chimeric enzymes with substrate preferences clearly resembling those of the donor enzymes. Exchange of smaller parts of the KshA1 and KshA5 β-sheet regions revealed that a highly variable loop region located at the entrance of the active site strongly contributes to KSH substrate preference. This loop region may be subject to conformational changes, thereby affecting binding of different substrates in the active site. This study provides novel insights into KshA structure-function relationships and shows that KSH monooxygenase enzymes are amenable to protein engineering for the development of biocatalysts with improved substrate specificities.

Hotspot-Centric De Novo Design of Protein Binders

Protein–protein interactions play critical roles in biology, and computational design of interactions could be useful in a range of applications. We describe in detail a general approach to de novo design of protein interactions based on computed, energetically optimized interaction hotspots, which was recently used to produce high-affinity binders of influenza hemagglutinin. We present several alternative approaches to identify and build the key hotspot interactions within both core secondary structural elements and variable loop regions and evaluate the method's performance in natural-interface recapitulation. We show that the method generates binding surfaces that are more conformationally restricted than previous design methods, reducing opportunities for off-target interactions.

Virtual screening using structure-based consensus pharmacophore models and ensemble docking based on MD-generated conformations

The protozoan parasites of the genus Trypanosoma sp. and Leishmania sp. are responsible for neglected diseases like Chagas’ disease, African sleeping sickness or Leishmaniasis. The trypanothione synthetase (TryS) is an attractive new drug target for the development of trypanocidal and antileishmanial drugs [1]. In our virtual screening campaign for targeting the trypanothione synthetase (TryS) we used representative protein conformations derived from a computational analysis using molecular dynamics (MD) simulations of this key component of trypanothione biosynthesis. The publicly available crystal structure lacks a variable loop region that is known to be important for trypanothione biosynthesis. MD simulations turned out to be a good tool to model this loop region and obtain a more complete set of protein conformations for subsequent use in virtual screening [2]. For creating a structure-based consensus pharmacophore model, Superstar [3] was deployed to generate favourable non-bonded interaction maps of different functional groups (probes) for all representative protein conformations. The pharmacophore model was then created for the rigid part of the binding pocket based on high- propensity peaks of these maps. The variable loop region was left out since it can not be depicted by this approach. To include also multiple conformations of the variable loop region, the new ensemble docking feature of Gold was used [4]. After a pharmacophore search within the ZINC database the retrieved molecules were simultaneously docked to the different protein conformations to identify the best combination of ligand pose and protein conformer. Finally, several high-scoring molecules were selected for further testing. We will discuss in detail this combined pharmacophore/ensemble docking approach based on MD simulations and will present the results of the compound selection for testing.

Structures of p63 DNA binding domain in complexes with half-site and with spacer-containing full response elements

Transcription factor p63, a p53 family member, plays a role in epithelial cell development, cell cycle arrest, apoptosis, and tumorigenesis. Point mutations, primarily in the DNA binding domain (p63DBD), lead to malformation syndromes. To gain insight into differences between p63 and p53 and the impact of mutations on the structure, we have determined two crystal structures of p63DBD in complex with A/T-rich response elements. One complex contains a 10-bp DNA half-site response element (5'AAACATGTTT3') and the other contains a 22-bp DNA full response element with a 2-bp spacer between two half-sites (5'AAACATGTTTTAAAACATGTTT3'). In both structures, each half-site binds a p63DBD dimer. The two p63DBD dimers do not interact in the presence of the DNA spacer, whereas they interact with one another in the p63DBD/10-bp complex where the DNA simulates a full response element by packing end-to-end. A unique dimer-dimer interaction involves a variable loop region, which differs in length and sequence from the counterpart loop of p53DBD. The DNA trajectories in both structures assume superhelical conformations. Surface plasmon resonance studies of p63DBD/DNA binding yielded K(d) = 11.7 μM for a continuous full response element, whereas binding was undetectable with the 22-bp DNA, suggesting an important contribution of a p63DBD interdimer interface to binding and establishing that p63DBD affinity to the response element is approximately 1,000-fold lower than that of p53DBD. Analyses of the structural consequences of p63DBD mutations that cause developmental defects show that, although some mutations affect DNA binding directly, the majority affects protein stability.

Comparative Magnitude of Cross-Strain Conservation of HIV Variable Loop Neutralization Epitopes

Although the sequence variable loops of the human immunodeficiency virus' (HIV-1) surface envelope glycoprotein (gp120) can exhibit good immunogenicity, characterizing conserved (invariant) cross-strain neutralization epitopes within these loops has proven difficult. We recently developed a method to derive sensitive and specific signature motifs for the three-dimensional (3D) shapes of the HIV-1 neutralization epitopes in the third variable (V3) loop of gp120 that are recognized by human monoclonal antibodies (mAbs). We used the signature motif method to estimate the conservation of these epitopes across circulating worldwide HIV-1 strains. The epitope targeted by the anti-V3 loop neutralizing mAb 3074 is present in 87% of circulating strains, distributed nearly evenly among all subtypes. The results for other anti-V3 Abs are: 3791, present in 63% of primarily non-B subtypes; 2219, present in 56% of strains across all subtypes; 2557, present in 52% across all subtypes; 447-52D, present in 11% of primarily subtype B strains; 537-10D, present in 9% of primarily subtype B strains; and 268-D, present in 5% of primarily subtype B strains. The estimates correlate with in vitro tests of these mAbs against diverse viral panels. The mAb 3074 thus targets an epitope that is nearly completely conserved among circulating HIV-1 strains, demonstrating the presence of an invariant structure hidden in the dynamic and sequence-variable V3 loop in gp120. Since some variable loop regions are naturally immunogenic, designing immunogens to mimic their conserved epitopes may be a promising vaccine discovery approach. Our results suggest one way to quantify and compare the magnitude of the conservation.

A Dirichlet process mixture of hidden Markov models for protein structure prediction

By providing new insights into the distribution of a protein's torsion angles, recent statistical models for this data have pointed the way to more efficient methods for protein structure prediction. Most current approaches have concentrated on bivariate models at a single sequence position. There is, however, considerable value in simultaneously modeling angle pairs at multiple sequence positions in a protein. One area of application for such models is in structure prediction for the highly variable loop and turn regions. Such modeling is difficult due to the fact that the number of known protein structures available to estimate these torsion angle distributions is typically small. Furthermore, the data is "sparse" in that not all proteins have angle pairs at each sequence position. We propose a new semiparametric model for the joint distributions of angle pairs at multiple sequence positions. Our model accommodates sparse data by leveraging known information about the behavior of protein secondary structure. We demonstrate our technique by predicting the torsion angles in a loop from the globin fold family. Our results show that a template-based approach can now be successfully extended to modeling the notoriously difficult loop and turn regions.

Decreased HIV diversity after allogeneic stem cell transplantation of an HIV-1 infected patient: a case report

The human immunodeficiency virus type 1 (HIV-1) coreceptor use and viral evolution were analyzed in blood samples from an HIV-1 infected patient undergoing allogeneic stem cell transplantation (SCT). Coreceptor use was predicted in silico from sequence data obtained from the third variable loop region of the viral envelope gene with two software tools. Viral diversity and evolution was evaluated on the same samples by Bayesian inference and maximum likelihood methods. In addition, phenotypic analysis was done by comparison of viral growth in peripheral blood mononuclear cells and in a CCR5 (R5)-deficient T-cell line which was controlled by a reporter assay confirming viral tropism. In silico coreceptor predictions did not match experimental determinations that showed a consistent R5 tropism. Anti-HIV directed antibodies could be detected before and after the SCT. These preexisting antibodies did not prevent viral rebound after the interruption of antiretroviral therapy during the SCT. Eventually, transplantation and readministration of anti-retroviral drugs lead to sustained increase in CD4 counts and decreased viral load to undetectable levels. Unexpectedly, viral diversity decreased after successful SCT. Our data evidence that only R5-tropic virus was found in the patient before and after transplantation. Therefore, blocking CCR5 receptor during stem cell transplantation might have had beneficial effects and this might apply to more patients undergoing allogeneic stem cell transplantation. Furthermore, we revealed a scenario of HIV-1 dynamic different from the commonly described ones. Analysis of viral evolution shows the decrease of viral diversity even during episodes with bursts in viral load.

Structure of Rhamnose-binding Lectin CSL3: Unique Pseudo-tetrameric Architecture of a Pattern Recognition Protein

The crystal structure of the l-rhamnose-binding lectin CSL3 was determined to 1.8 Å resolution. This protein is a component of the germline-encoded pattern recognition proteins in innate immunity. CSL3 is a homodimer of two 20 kDa subunits with a dumbbell-like shape overall, in which the N- and C-terminal domains of different subunits form lobe structures connected with flexible linker peptides. The complex structures of the protein with specific carbohydrates demonstrated the importance of the most variable loop region among homologues for the specificity toward oligosaccharides. CSL3 and Shiga-like toxin both use Gb 3 as a cellular receptor to evoke apoptosis. They have very different overall architecture but share the separation distance between carbohydrate-binding sites. An inspection of the structure database suggested that the pseudo-tetrameric structure of CSL3 was unique among the known lectins. This architecture implies this protein might provide a unique tool for further investigations into the relationships between architecture and function of pattern recognition proteins.

MOLECULAR RECOGNITION OF THE DISORDERED DIHYDROPYRIDINE RECEPTOR II–III LOOP BY A CONSERVED SPRY DOMAIN OF THE TYPE 1 RYANODINE RECEPTOR

1. The dihydropyridine receptor (DHPR) II-III loop is an intrinsically unstructured region made up of alpha-helical and beta-turn secondary structure elements with the N and C termini in close spatial proximity. 2. The DHPR II-III loop interacts in vitro with a ryanodine receptor (RyR) 1 SPRY domain through alpha-helical segments located in the A and B regions. Mutations within the A and B regions in the DHPR II-III loop alter the binding affinity to the SPRY2 domain. 3. The A and C peptides derived from DHPR II-III loop show negative cooperativity in binding to the SPRY2 domain. 4. The SPRY2 domain of the RyR1 (1085-1208) forms a beta-sheet sandwich structure flanked by variable loop regions. An acidic loop region of SPRY2 (1107-1121) forms part of a negatively charged cleft that is implicated in the binding of the DHPR II-III loop. 5. The mutant E1108A located in the negatively charged loop of SPRY2 reduces the binding affinity to the DHPR II-III loop.

The Medium‐Chain Dehydrogenase/Reductase Engineering Database: A systematic analysis of a diverse protein family to understand sequence–structure–function relationship

The Medium-Chain Dehydrogenase/Reductase Engineering Database (MDRED, http://www.mdred.uni-stuttgart.de) has been established to serve as an analysis tool for a systematic investigation of sequence-structure-function relationships. It includes sequence and structure information of 2684 and 42 medium-chain dehydrogenases/reductases (MDRs), respectively. Although MDRs are very diverse in sequence, they have a conserved tertiary structure. MDRs are assigned to 199 homologous families and 29 superfamilies. For each family, annotated multiple sequence alignments are provided, and functionally relevant residues are annotated. Twenty-five superfamilies were classified as zinc-containing MDRs, four as non-zinc-containing MDRs. For the zinc-containing MDRs, three subclasses were identified by systematic analysis of a variable loop region, the quaternary structure determining loop (QSDL): the class of short, medium, and long QSDL, which include 11, 3, and 5 superfamilies, respectively. The length of the QSDL is predictive for tetramer (short QSDL) and dimer (long QSDL) formation. The class of medium QSDL includes both tetrameric and dimeric MDRs. The shape of the substrate-binding site is highly conserved in all zinc-containing MDRs with the exception of two variable regions, the substrate recognition sites (SRS): two residues located on the QSDL (SRS1) and, for the class of long QSDL, one residue located in the catalytic domain (SRS2). The MDRED is the first online-accessible resource of MDRs that integrates information on sequence, structure, and function. Annotation of functionally relevant residues assist the understanding of sequence-structure-function relationships. Thus, the MDRED serves as a valuable tool to identify potential hotspots for engineering properties such as substrate specificity.

The Structure and Binding Behavior of the Bacterial Cell Surface Layer Protein SbsC

Surface layers (S-layers) comprise the outermost cell envelope component of most archaea and many bacteria. Here we present the structure of the bacterial S-layer protein SbsC from Geobacillus stearothermophilus, showing a very elongated and flexible molecule, with strong and specific binding to the secondary cell wall polymer (SCWP). The crystal structure of rSbsC((31-844)) revealed a novel fold, consisting of six separate domains, which are connected by short flexible linkers. The N-terminal domain exhibits positively charged residues regularly spaced along the putative ligand binding site matching the distance of the negative charges on the extended SCWP. Upon SCWP binding, a considerable stabilization of the N-terminal domain occurs. These findings provide insight into the processes of S-layer attachment to the underlying cell wall and self-assembly, and also accommodate the observed mechanical strength, the polarity of the S-layer, and the pronounced requirement for surface flexibility inherent to cell growth and division.

Divergent Evolution of Function in the ROK Sugar Kinase Superfamily: Role of Enzyme Loops in Substrate Specificity

The d-allose and N-acetyl-d-mannosamine kinases of Escherichia coli K-12 are divergent members of the functionally diverse ROK (repressor, open reading frame, kinase) superfamily. Previous work in our laboratory has demonstrated that AlsK and NanK possess weak phosphoryl transfer activity toward the alternate substrate d-glucose. To gain insight into the evolutionary mechanisms that fuel the specialization of individual enzyme function, experimental laboratory evolution was conducted to improve the glucokinase activities of AlsK and NanK. Error-prone PCR was combined with in vivo functional selection in a glucokinase-deficient bacterium to identify four independent single nucleotide substitutions in the alsK and nanK genes that improve the glucokinase activity of each enzyme. The most advantageous substitutions, L84P in NanK and A73G in AlsK, enhance the kcat/Km values for phosphoryl transfer to glucose by 12-fold and 60-fold, respectively. Both substitutions co-localize to a variable loop region located between the fourth beta-sheet and the second alpha-helix of the ROK scaffold. A multiple sequence alignment of diverse ROK family members reveals that the A73G substitution in AlsK recapitulates a conserved glycine residue present in many ROK proteins, including some transcriptional repressors. Steady-state kinetic analyses of the selected AlsK and NanK variants demonstrate that their native activities toward d-allose and N-acetyl-d-mannosamine are largely unaffected by the glucokinase-enhancing substitutions. Substrate specificity profiling reveals that the A73G AlsK and L84P NanK variants display systematic improvements in the kcat/Km values for a variety of nonnative carbohydrates. This finding is consistent with an evolutionary process that includes the formation of intermediates possessing relaxed substrate specificities during the initial steps of enzyme functional divergence.

A di‐leucine sorting signal in ZIP1 (SLC39A1) mediates endocytosis of the protein

It has been demonstrated that the plasma membrane expression of ZIP1 is regulated by endocytic mechanisms. In the zinc-replete condition, the level of surface expressed ZIP1 is low due to the rapid internalization of ZIP1. The present study aimed to identify a sorting signal(s) in ZIP1 that mediated endocytosis of ZIP1. Four potential sorting signals (three di-leucine-and one tyrosine-based) were found by searching the eukaryotic linear motif resource for functional sites in proteins (http://elm.eu.org). Site-directed mutagenesis and immunofluorescence microscopic analyses demonstrated that the di-leucine sorting signal, ETRALL144-149, located in the variable loop region of ZIP1, was required for the ZIP1 internalization and lysosomal degradation. Substitutions of alanines for the di-leucine residues (LL148,149/AA) severely impaired the internalization of ZIP1 and subsequent protein degradation, leading to an accumulation of the mutant ZIP1 on the cell surface, as well as inside the cell. Using chimeric proteins composed of an alpha-chain of interleukin-2 receptor fused to the peptides derived from the variable loop region of ZIP1, we found that the di-leucine sorting signal of ZIP1 was required and sufficient for endocytosis of the chimeric proteins.

Design of immunogens that present the crown of the HIV-1 V3 loop in a conformation competent to generate 447-52D-like antibodies

gp120 is a subunit of the envelope glycoprotein of HIV-1. The third variable loop region of gp120 (V3 loop) contains multiple immunodominant epitopes and is also functionally important for deciding cell-tropism of the virus. 447-52D is a monoclonal antibody that recognizes the conserved tip of the V3 loop in a beta-turn conformation. This antibody has previously been shown to neutralize diverse strains of the virus. In an attempt to generate an immunogen competent to generate 447-52D-like antibodies, the known epitope of 447-52D was inserted at three different surface loop locations in the small, stable protein Escherichia coli Trx (thioredoxin). At one of the three locations (between residues 74 and 75), the insertion was tolerated, the resulting protein was stable and soluble, and bound 447-52D with an affinity similar to that of intact gp120. Upon immunization, the V3 peptide-inserted Trx scaffold was able to generate anti-V3 antibodies that could compete out 447-52D binding to gp120. Epitope mapping studies demonstrated that these anti-V3 antibodies recognized the same epitope as 447-52D. Although the 447-52D-type antibodies were estimated to be present at concentrations of 50-400 microg/ml of serum, these were not able to effect neutralization of strains like JRFL and BAL but could neutralize the sensitive MN strain. The data suggest that because of the low accessibility of the V3 loop on primary isolates such as JRFL, it will be difficult to elicit a V3-specific, 447-52D-like antibody response to effectively neutralize such isolates.

Structure and assembly of the pseudopilin PulG

The pseudopilin PulG is one of several essential components of the type II pullulanase secretion machinery (the Pul secreton) of the Gram-negative bacterium Klebsiella oxytoca. The sequence of the N-terminal 25 amino acids of the PulG precursor is hydrophobic and very similar to the corresponding region of type IV pilins. The structure of a truncated PulG (lacking the homologous region), as determined by X-ray crystallography, was found to include part of the long N-terminal alpha-helix and the four internal anti-parallel beta-strands that characterize type IV pilins, but PulG lacks the highly variable loop region with a disulphide bond that is found in the latter. When overproduced, PulG forms flexible pili whose structural features, as visualized by electron microscopy, are similar to those of bacterial type IV pili. The average helical repeat comprises 17 PulG subunits and four helical turns. Electron microscopy and molecular modelling show that PulG probably assembles into left-handed helical pili with the long N-terminal alpha-helix tightly packed in the centre of the pilus. As in the type IV pilins, the hydrophobic N-terminal part of the PulG alpha-helix is necessary for its assembly. Subtle sequence variations within this highly conserved segment seem to determine whether or not a type IV pilin can be assembled into pili by the Pul secreton.

The NMR Structure of Dematin Headpiece Reveals a Dynamic Loop That Is Conformationally Altered upon Phosphorylation at a Distal Site

Dematin (band 4.9) is found in the junctional complex of the spectrin cytoskeleton that supports the erythrocyte cell membrane. Dematin is a member of the larger class of cytoskeleton-associated proteins that contain a modular "headpiece" domain at their extreme C termini. The dematin headpiece domain provides the second F-actin-binding site required for in vitro F-actin bundling. The dematin headpiece is found in two forms in the cell, one of 68 residues (DHP) and one containing a 22-amino acid insert near its N terminus (DHP+22). In addition, dematin contains the only headpiece domain that is phosphorylated, in vivo. The 22-amino acid insert in DHP+22 appeared unstructured in NMR spectra; therefore, we have determined the three-dimensional structure of DHP by multidimensional NMR methods. Although the overall three-dimensional structure of DHP is similar to that of the villin headpiece, there are two novel characteristics revealed by this structure. First, unlike villin headpiece that contains a single buried salt bridge, DHP contains a buried charged cluster comprising residues Glu(39), Arg(66), Lys(70), and the C-terminal carboxylate of Phe(76). Second, (15)N relaxation experiments indicate that the longer "variable loop" region near the N terminus of DHP (residues 20-29) is dynamic, undergoing significantly greater motions that the rest of the structure. Furthermore, NMR chemical shift changes indicate that the conformation of the dynamic variable loop is altered by phosphorylation of serine 74, which is far in the sequence from the variable loop region. Our results suggest that phosphorylation of the dematin headpiece acts as a conformational switch within this headpiece domain.

Differential immune response to the variable surface loop antigen of P66 of Borrelia burgdorferi sensu lato species in geographically diverse populations of lyme borreliosis patients.

We have studied the immune response to a variable surface-exposed loop region of the P66 outer membrane protein from Borrelia burgdorferi sensu lato by using an enzyme immunoassay. Lyme borreliosis populations found in North America and Sweden were preferentially more seroreactive to P66 from their respective regional species, namely, B. burgdorferi sensu stricto and B. garinii and B. afzelii, respectively.

The transfer of transthyretin and receptor-binding properties from the plasma retinol-binding protein to the epididymal retinoic acid-binding protein.

Members of the lipocalin superfamily share a common structural fold, but differ from each other with respect to the molecules with which they interact. They all contain eight beta-strands (A-H) that fold to form a well-defined beta-barrel, which harbours a binding pocket for hydrophobic ligands. These strands are connected by loops that vary in size and structure and make up the closed and open ends of the pocket. In addition to binding ligands, some members of the family interact with other macromolecules, the specificity of which is thought to be associated with the variable loop regions. Here, we have investigated whether the macromolecular-recognition properties can be transferred from one member of the family to another. For this, we chose the prototypical lipocalin, the plasma retinol-binding protein (RBP) and its close structural homologue the epididymal retinoic acid-binding protein (ERABP). RBP exhibits three molecular-recognition properties: it binds to retinol, to transthyretin (TTR) and to a cell-surface receptor. ERABP binds retinoic acid, but whether it interacts with other macromolecules is not known. Here, we show that ERABP does not bind to TTR and the RBP receptor, but when the loops of RBP near the open end of the pocket (L-1, L-2 and L-3, connecting beta-strands A-B, C-D and E-F, respectively) were substituted into the corresponding regions of ERABP, the resulting chimaera acquired the ability to bind TTR and the receptor. L-2 and L-3 were found to be the major determinants of the receptor- and TTR-binding specificities respectively. Thus we demonstrate that lipocalins serve as excellent scaffolds for engineering novel biological functions.

The transfer of transthyretin and receptor-binding properties from the plasma retinol-binding protein to the epididymal retinoic acid-binding protein

Members of the lipocalin superfamily share a common structural fold, but differ from each other with respect to the molecules with which they interact. They all contain eight β-strands (A—H) that fold to form a well-defined β-barrel, which harbours a binding pocket for hydrophobic ligands. These strands are connected by loops that vary in size and structure and make up the closed and open ends of the pocket. In addition to binding ligands, some members of the family interact with other macromolecules, the specificity of which is thought to be associated with the variable loop regions. Here, we have investigated whether the macromolecular-recognition properties can be transferred from one member of the family to another. For this, we chose the prototypical lipocalin, the plasma retinol-binding protein (RBP) and its close structural homologue the epididymal retinoic acid-binding protein (ERABP). RBP exhibits three molecular-recognition properties: it binds to retinol, to transthyretin (TTR) and to a cell-surface receptor. ERABP binds retinoic acid, but whether it interacts with other macromolecules is not known. Here, we show that ERABP does not bind to TTR and the RBP receptor, but when the loops of RBP near the open end of the pocket (L-1, L-2 and L-3, connecting β-strands A—B, C—D and E—F, respectively) were substituted into the corresponding regions of ERABP, the resulting chimaera acquired the ability to bind TTR and the receptor. L-2 and L-3 were found to be the major determinants of the receptor- and TTR-binding specificities respectively. Thus we demonstrate that lipocalins serve as excellent scaffolds for engineering novel biological functions.

Comparison of the variable loop regions of myosin heavy chain genes from Antarctic and temperate isopods

The evolutionary adaptations of functional genes to life at low temperatures are not well characterised in marine and fresh water invertebrates. Temperature has been shown to affect the functional characteristics of fish muscles, with changes in the velocity of shortening and ATPase activity being associated with myosin heavy chain (MyHC) isoform composition and the structure of the surface loop regions. Two PCR products spanning loops 1 and 2 of a MyHC gene from an Antarctic isopod ( Glyptonotus antarcticus) were sequenced and compared with those of a temperate isopod ( Idotea resecata), slow and fast fibres from lobster ( Homarus gammarus) and a cold water amphipod ( Eulimnogammarus verrucosus), revealing specific differences between the species, possibly related to fibre type and habitat temperature. The loop 2 region from G. antarcticus myosin was cloned and used for Northern analysis of total RNA from the other species. The cloned myosin cDNA hybridised specifically to a 6.6-kb transcript, in G. antarcticus muscle. In contrast, cDNA probes for lobster slow myosin and actin hybridised to muscle RNA from all species, demonstrating that a distinct MyHC isoform is expressed in the Antarctic isopod, as opposed to the temperate species. The inter- and intra-specific sequence differences in loop 2 region suggest that this may be a site for muscle adaptation to enable function at the low temperatures found in the Southern Ocean.