Medicinal Value Research Articles

Assembly and comparative analysis of the first complete mitochondrial genome of Astragalus membranaceus (Fisch.) Bunge: an invaluable traditional Chinese medicine

BackgroundAstragalus membranaceus (Fisch.) Bunge is one of the most well-known tonic herbs in traditional Chinese medicine, renowned for its remarkable medicinal value in various clinical contexts. The corresponding chloroplast (cp) and nuclear genomes have since been accordingly sequenced, providing valuable information for breeding and phylogeny studies. However, the mitochondrial genome (mitogenome) of A. membranaceus remains unexplored, which hinders comprehensively understanding the evolution of its genome.ResultsFor this study, we de novo assembled the mitogenome of A. membranaceus (Fisch.) Bunge var. mongholicus (Bunge) P. K. Hsiao using a strategy integrating Illumina and Nanopore sequencing technology and subsequently performed comparative analysis with its close relatives. The mitogenome has a multi-chromosome structure, consisting of two circular chromosomes with a total length of 398,048 bp and an overall GC content of 45.3%. It encodes 54 annotated functional genes, comprising 33 protein-coding genes (PCGs), 18 tRNA genes, and 3 rRNA genes. An investigation of codon usage in the PCGs revealed an obvious preference for codons ending in A or U (T) bases, given their high frequency. RNA editing identified 500 sites in the coding regions of mt PCGs that exhibit a perfect conversion of the base C to U, a process that tends to lead to the conversion of hydrophilic amino acids into hydrophobic amino acids. From the mitogenome analysis, a total of 399 SSRs, 4 tandem repeats, and 77 dispersed repeats were found, indicating that A. membranaceus possesses fewer repeats compared to its close relatives with similarly sized mitogenomes. Selection pressure analysis indicated that most mt PCGs were purifying selection genes, while only five PCGs (ccmB, ccmFc, ccmFn, nad3, and nad9) were positive selection genes. Notably, positive selection emerged as a critical factor in the evolution of ccmB and nad9 in all the pairwise species comparisons, suggesting the extremely critical role of these genes in the evolution of A. membranaceus. Moreover, we inferred that 22 homologous fragments have been transferred from cp to mitochondria (mt), in which 5 cp-derived tRNA genes remain intact in the mitogenome. Further comparative analysis revealed that the syntenic region and mt gene organization are relatively conserved within the provided legumes. The comparison of gene content indicated that the gene composition of Fabaceae mitogenomes differed. Finally, the phylogenetic tree established from analysis is largely congruent with the taxonomic relationships of Fabaceae species and highlights the close relationship between Astragalus and Oxytropis.ConclusionsWe provide the first report of the assembled and annotated A. membranaceus mitogenome, which enriches the genetic resources available for the Astragalus genus and lays the foundation for comprehensive exploration of this invaluable medicinal plant.

Diversity and ethnobotanical study of homegarden plants in Goba district, Oromia region, Ethiopia

Homegardens are one of the most diverse agroforestry systems and make a vital contribution to meeting various household needs, especially for smallholder farmers in developing countries. The aim of this study was to record the diversity and use of homegarden plant species in the Goba District. The households were randomly selected from five kebeles, with the number selected proportionate to the size of each kebele using the probability proportional to size (PPS) calculation. Seventy-one homegarden owners were chosen for the detailed study and data collection. Of the fifteen kebeles in the Goba District, five kebeles were chosen at random. Observations, semi-structured interviews, preference rating, direct matrix rankings, and paired comparisons were the methods used to gather ethno-botanical data. Descriptive statistical approaches, including density, frequency, relative frequency, relative density, and the Shannon and Wiener indices for species diversity were used to analyze the data. A total of 67 plant species belonging to 31 families were identified. Of the 67 plant species, 36 (or 54%) were herbs, 15 (or 22%) were tree species, 22% shrubs, and 2% were climbers. Twenty-eight (20.8%) species collected from homegardens had food and forage value, 17 (25.3%) had fence value, 12 (18%) had shade value, and 23 (34.3%) had medicinal value; moreover, 90% of the homes had home gardens, indicating that farmers value gardening plants that helps improve household food security and revenue generation. The involvement of the local population and government institutions in providing awareness through instruction or training on the sustainable use and management of plant resources is vital to conserve homegarden plants.

Unraveling the Dual Anti-Inflammatory and Antioxidant Mechanisms of Acteoside: Computational Insights and Experimental Validation.

Acteoside (ACT) is one of the primary bioactive ingredients in Cistanche tubulosa (Schenk). Its remarkable efficacy in treating immune-related and inflammatory disorders has garnered significant interest among scientific circles. However, the anti-inflammatory and antioxidant effects of ACT and its underlying molecular mechanisms require further investigation. In this study, pharmacophore-based reverse docking and molecular dynamics simulations identified potential anti-inflammatory targets in silico. Studies conducted in vitro with lipopolysaccharide (LPS)-induced RAW264.7 cells validated the anti-inflammatory properties of ACT. Methyl thiazolyl tetrazolium (MTT) and lactate dehydrogenase (LDH) assays indicated ACT's non-toxic and growth-promoting effects on cells. ACT significantly reduced nitric oxide (NO) and reactive oxygen species (ROS) production and restored levels of antioxidant enzymes. It also decreased pro-inflammatory cytokines. Western blotting assays indicated that ACT inhibited p38, TNF-α, PI3 K/AKT, and NF-κB signaling pathways. These findings underscore ACT's ability to mitigate acute inflammation in RAW264.7 cells by modulating key signaling pathways and provide the scientific basis for enhancing the medicinal value of ACT and future drug development.

Star Anise (Illicium verum Hook. f.): Dual Therapeutic and Nutritional Potential in Food and Medicine

Star anise (Illicium verum Hook. f., SA) is a well-known culinary seasoning in China and Vietnam. Actually, SA also has been widely used as a traditional Chinese medicine in China with a long history. Phytochemical analysis has revealed that SA contains a high concentration of essential oils, phenols, flavonoids, and other bioactive compounds that contribute to its diverse pharmacological properties. These properties include anti-bacterial, anti-inflammatory and analgesic, anti-oxidation, anti-viral, anti-cancer, anti-diabetes, anti-diarrheal and promoting hair growth. Various preclinical studies have shown that SA extracts and their active constituents may have potential therapeutic applications in preventing and treating various diseases. However, a comprehensive report on the relationship between the active ingredient, biological activity and food characteristics of SA is rare. The medicinal value of SA has not been well valued and developed. This review provides an overview of the botanical chemistry and pharmacological properties of SA, as well as its potential innovative applications in food and personal care products, aiming to provide theoretical support for its further development and utilization. Graphical abstract: http://links.lww.com/AHM/A138

Industrial Production of Functional Foods for Human Health and Sustainability

Functional foods significantly affect social stability, human health, and food security. Plants and microorganisms are high-quality chassis for the bioactive ingredients in functional foods. Characterised by precise nutrition and the provision of both nutritive and medicinal value, functional foods serve a as key extension of functional agriculture and offer assurance of food availability for future space exploration efforts. This review summarises the main bioactive ingredients in functional foods and their functions, describes the strategies used for the nutritional fortification and industrial production of functional foods, and provides insights into the challenges and future developments in the applications of plants and microorganisms in functional foods. Our review aims to provide a theoretical basis for the development of functional foods, ensure the successful production of new products, and support the U.N. Sustainable Development Goals, including no poverty, zero hunger, and good health and well-being.

First Report of Root-knot Nematode, Meloidogyne enterolobii, on Luffa cylindrica (L.) in Guangxi, China.

Luffa cylindrica (L.), an annual climbing herb of the Cucurbitaceae family, has a long planting history in China and is deeply loved by people due to its nutritional and medicinal value (Partap S, Kumar A et al., 2012). April 2023, symptoms such as plant dwarfism, decreased yield and serious root-knots appeared on L. cylindrica sampled from a commercial production base in Beihai, Guangxi, China (GPS 21°55'79″ N;109°49'61″ E). The investigated area of L. cylindrica was about 1.3 ha, the incidence of root-knot nematode disease was almost 90%. The roots of 20 L. cylindrica were dug up and many root-knots and egg masses were found. Nematodes in samples at different stages were collected by shallow dish method, and morphological identification was caried out. Males were worm-like, annulated, with the anterior part slightly conical. Females were globular to pyriform. The perineal pattern was oval, with the dorsal arch being moderately high to tall. The tail of the second-stage juvenile (J2) was very slender with a sharp tip. The transparent tail end was clearly visible. Morphological measurements of females (n = 20): body length = 677.2 ± 34.4 μm, body width = 512.8 ± 45.4 μm, stylet = 13.7 ± 0.5 μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 5.7 ± 0.8 μm. The measurements of J2s (n = 20): body length = 412.5 ± 19.4 μm, body wide = 16.2 ± 1.3 μm, stylet lengths = 12.6 ± 0.92 μm, DGO length = 3.1 ± 0.3 μm. Average tail length = 45.44 ± 4.1μm. The observed typical characteristics of M. enterolobii were consistent with those previously described by Yang & Eisenback (1983) and EPPO (2016). J2s hatched by single egg mass were used for DNA extraction and identification of molecular biology. Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), the specific primers of M. enterolobii, was used to validate this pathogen (Long et al., 2006). Consistent with that described before, the target amplification product was about 236 bp, and no product was obtained from the negative control, M. incognita and M. javanica (Chen et al., 2023). Using V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG), the rDNA ITS region was obtained and sequenced (Vrain et al., 1992). The target product was 765 bp (GenBank accession no. PQ205316), which was 100% homologous to those M. enterolobii ITS sequence available in the GenBank (KX823372, KJ146863). Koch's postulates were used to verify the pathogenicity of M. enterolobii on L. cylindrica, twelve 2-week-old L. cylindrica were planted in sterilized soil and inoculated with M. enterolobii J2s at a rate of 3,000 individuals per plant. The plants were grown at 26°C in a greenhouse, with non-inoculated controls set up. After 8 weeks, the roots of the non-inoculated plants (n = 12) showed no root-knot and grew well, while all inoculated plants developed root-knots and exhibited stunted growth. The average reproduction factor of the inoculated plants was 19.5, and the average root-knot rating was 7.2 (on a scale of 0 to 10) (Bridge and Page 1980), confirming the pathogenicity of M. enterolobii on L. cylindrica. We found that this is consistent with the description of M. enterolobii infecting Coriandrum sativum in Shanxi, China (Pan et al., 2024) and the infection of Selenicereus costaricensis in Guangxi, China by M. enterolobii (Wu et al., 2023). To our knowledge, this is the first report of M. enterolobii parasitizing L. cylindrica in Guangxi, China. With the increase of vegetable planting area, root-knot nematodes are becoming more and more serious and have become a limiting factor on vegetable production. This finding is of significant importance for vegetable growers to control M. enterolobii in this region, based on which suitable management measures will be taken.

Characterization of Chemical Information and Content Prediction of Dendrobium officinale Based on ATR‐FTIR

ABSTRACTDendrobium officinale is a medicinal and food plant with high commercial and medicinal value. Yunnan is known as China's “plant kingdom,” and although the climatic conditions are favorable, the large vertical climatic differences have led to a large difference in the quality of dendrobium from different origins. The analysis of quality differences between several origins with large ecological advantages has not been reported yet. Therefore, the aim of this study is to compare these regions in terms of both morphology and chemical composition and to analyze the variation of their chemical composition in spectral information. The PLS‐DA, SVM, and PLSR models were developed to qualitatively and quantitatively evaluate Dendrobium from different production areas. The results show that the Menghai production area was superior to other production areas in terms of phenotypic morphology, quality, and yield. Within the appropriate range, the higher the specific absorbance, the higher the quercetin content.

Integrated Metabolomics and Transcriptomics Provide Key Molecular Insights into Floral Stage-Driven Flavonoid Pathway in Safflower

Safflower (Carthamus tinctorius L.) is a traditional Chinese medicinal herb renowned for its high flavonoid content and significant medicinal value. However, the dynamic changes in safflower petal flavonoid profiles across different flowering phases present a challenge in optimizing harvest timing and medicinal use. To enhance the utilization of safflower, this study conducted an integrated transcriptomic and metabolomic analysis of safflower petals at different flowering stages. Our findings revealed that certain flavonoids were more abundant during the fading stage, while others peaked during full bloom. Specifically, seven metabolites, including p-coumaric acid, naringenin chalcone, naringenin, dihydrokaempferol, apigenin, kaempferol, and quercetin, accumulated significantly during the fading stage. In contrast, dihydromyricetin and delphinidin levels were notably reduced. Furthermore, key genes in the flavonoid biosynthesis pathway, such as 4CL, DFR, and ANR, exhibited up-regulated expression with safflower’s flowering progression, whereas CHI, F3H, and FLS were down-regulated. Additionally, exposure to UV-B stress at full bloom led to an up-regulation of flavonoid content and altered the expression of key flavonoid biosynthetic genes over time. This study not only elucidates the regulatory mechanisms underlying flavonoid metabolism in safflower but also provides insights for maximizing its medicinal and industrial applications.

Comparative Mitogenomics Provides Valuable Insights for the Phylogeny and New DNA Barcodes of Ganoderma

Ganoderma is the most important genus in the family Ganodermataceae; many species have attracted much attention and widely cultivated because of their medicinal values, but so far, not a sequenced mitogenome derived from dikaryon strains has been explicitly recorded. Herein, four novel mitogenomes of commonly cultivated Ganoderma (G. leucocontextum H4, G. lucidum G6, G. sinense MZ96 and G. tsugae SS) were de novo assembled and given detail functional annotations. Collinearity analysis revealed that the four mitogenomes shared 82.93–92.02% similarity with their corresponding reference mitogenomes at the nucleotide level. A total of 15 core protein-coding genes (PCGs), along with rrnL and rrnS (mtLSU and mtSSU) were chosen as potential candidates for constructing their individual phylogenetic trees. These trees were compared with those derived from the concatenated sequences of 15 core PCGs. And finally, we found that the atp9 and nad4L were the most reliable markers for the phylogenetic analysis of Ganoderma and chosen as standard sequences to generate new DNA barcodes. This finding was further verified by comparing it against almost all available Ganoderma mitogenomes in the NCBI, with Trametes versicolor (Polyporaceae) and Rigidoporus microporus (Meripilaceae) as two outgroups. A total of 52 mitogenomes from three families were highly conserved, with identical gene lengths for atp9 (222 bp) and nad4L (267 bp). These genes were capable of distinguish distinctly different various species, which are grouped into separate clades within the phylogenetic trees. The closest related clades (I and II), including at least 30 samples of the three classical taxonomic species (G. lingzhi, G. sichuanense and G. lucidum), differed in only one SNP. The single base mutation rate increased with the evolutionary divergence of the phylogenetic clades, from two to three SNPs in earlier clades (e.g., clade IV containing G. leucocontextum) to five to six SNPs in later clades (e.g., clade X containing G. sinense). Despite these variations between species, the atp9 and nad4L genes of Ganoderma mitogenomes consistently encoded the same ATP synthase F0 subunit c (73 aa) and NADH dehydrogenase subunit 4L (88 aa). These two genes have been identified as reliable markers of new DNA barcodes, offering valuable insights and contributing significantly to understanding the evolutionary relationships and phylogeny of the Ganoderma genus and even the Ganodermataceae family.

Comparison of the chloroplast genomics of nine endangered Habenaria species and phylogenetic analysis

BackgroundHabenaria, a genus in the family Orchidaceae, are the nearly cosmopolitan orchids, and most species have significant medicinal and ornamental values. Despite the morphological and molecular data that have been studied in recent years, the phylogenetic relationship is still unclear.ResultsWe sequenced, assembled, and annotated the chloroplast (cp) genomes of two species (Habenaria aitchisonii Rchb.f. and Habenaria tibetica Schltr.ex Limpricht) of Habenaria grown on the Qinghai-Tibetan Plateau (QTP), and compared them with seven previously published cp genomes which may aid in the genomic profiling of these species. The two genomes ranged from 155,259–155,269 bp in length and both included 132 genes, encoding 86 proteins, 38 tRNAs and 8 rRNAs. In the cp genomes, the tandem repeats (797), SSRs (2195) and diverse loci (3214) were identified. Comparative analyses of codon usage, amino frequency, microsatellite, oligo repeats and transition and transversion substitutions revealed similarities between the species. Moreover, we identified 16 highly polymorphic regions with a nucleotide diversity above 0.02, which may be suitable for robust authentic barcoding and inferring in the phylogeny of Habenaria species. Among the polymorphic regions, positive selection was significantly exerted on several genes, such as cemA, petA, and ycf1. This finding may suggest an important adaptation strategy for the two Habenaria species on the QTP. The phylogenetic relationship revealed that H. aitchisonii and H. tibetica were more closely related to each other than to the other species, and the other seven species were clustered in three groups. In addition, the estimated divergence time suggested that the two species separated from the others approximately 0.39 Mya in the Neogene period. Our findings also suggest that Habenaria can be divided into different sections.ConclusionsThe results of this study enriched the genomics resources of Habenaria, and SSR marker may aid in the conservation management of two endangered species.

Chromosome-scale genome assembly of Apocynum pictum, a drought-tolerant medicinal plant from the Tarim Basin.

Apocynum pictum Schrenk is a semishrub of the Apocynaceae family with a wide distribution throughout the Tarim Basin that holds significant ecological, medicinal, and economic values. Here, we report the assembly of its chromosome-level reference genome using Nanopore long-read, Illumina HiSeq paired-end, and high-throughput chromosome conformation capture sequencing. The final assembly is 225.32 Mb in length with a scaffold N50 of 19.64 Mb. It contains 23,147 protein-coding genes across 11 chromosomes, 21,148 of which (91.36%) have protein functional annotations. Comparative genomics analysis revealed that A. pictum diverged from the closely related species Apocynum venetum approximately 2.2 million years ago and has not undergone additional polyploidizations after the core eudicot WGT-γ event. Karyotype evolution analysis was used to characterize interchromosomal rearrangements in representative Apocynaceae species and revealed that several A. pictum chromosomes were derived entirely from single chromosomes of the ancestral eudicot karyotype. Finally, we identified 50 members of the well-known stress-responsive WRKY transcription factor family and used transcriptomic data to document changes in their expression at 2 stages of drought stress, identifying a number of promising candidate genes. Overall, this study provides high-quality genomic resources for evolutionary and comparative genomics of the Apocynaceae, as well as initial molecular insights into the drought adaptation of this valuable desert plant.

Mythimna separata herbivory primes Coix resistance in systemic leaves.

Coix lacryma-jobi L. belongs to family Poaceae, is widely cultivated in tropical Asian countries for its nutritional and medicinal values. Coix is often threatened by lepidopteran such as Mythimna separata during its life cycle, resulting in severe yield reduction. Insect feeding can trigger defense signaling and increased defense responses in many other crops, yet little is known about whether simulated armyworm feeding on Coix leaves could induce anti-herbivory responses and whether armyworm feeding could activate priming in systemic leaves. In this study, Mythimna separata simulated herbivory elicited increased jasmonic acid (JA) level, JA-Ile (JA-isoleucine conjugate) and altered transcriptome in the Coix leaves. Meanwhile, M. separata simulated herbivory in local leaves primed the systemic leaves for increased accumulation of jasmonic acid and enhanced resistance to M. separata. Consistently, transcriptome analysis showed the systemic leaves were primed, which were up- or down-regulated comparing with the non-primed systemic leaves. In this study, we first reported Mythimna separata simulated herbivory induced increased defense response in leaves of Coix, also Mythimna separata herbivory primed Coix resistance in systemic leaves. This study provides new insight into the regulation of defense responses of Coix against M. separata and the ecological function of priming in Coix.

Ethnobotany, Phytochemistry, Pharmacology and Therapeutic Potential of Su‘ad Kūfī (Cyperus rotundus L.): An Insight

Background: Cyperus rotundus, an important medicinal plant belonging to the Cyperaceae family, is therapeutically used in many traditional systems of medicine, such as Unani medicine, Ayurveda, Siddha, Homeopathy, Chinese medicine, etc. Aim: The prime goal of this review is to provide a scientific basis and classical references for clinical use and further scientific exploration of Cyperus rotundus. Materials and Methods: This systemic review was carried out after searching Unani classical and other ethnobotanical literature and published research work available on PubMed, SCOPUS, Science Direct, Google Scholar, Research Gate, etc. Results: Cyperus rotundus L. is the accepted botanical name of Su'ad Kūfī, Nagarmotha, or Nutgrass as referred in Unani and other traditional medicines. It is grown in India, China, the Philippines, Thailand, Taiwan, Indonesia, Korea, Vietnam, Malaysia, the Pacific Islands, South America, Africa, the Middle East, North America, Mexico, Australia, New Zealand, and Europe. Usually, the rhizome of this important medicinal plant is therapeutically used for various ailments, including indigestion, constipation, dysentery, neurogenic gastralgia, skin diseases, mental weakness, cardiac weakness, nervine weakness, palpitation, weakness of stomach, flatulence, retention of urine, amenorrhea, dribbling of urine, etc. It contains many important secondary metabolites, including flavonoids, tannins, glycosides, monoterpenes, sesquiterpenes, sitosterol, alkaloids, saponins, terpenoids, essential oils, sugar, protein, amino acids, etc., which have been reported to possess antibacterial, anti-tumour, anticonvulsant, antidiabetic, anti-diarrhoeal, anti-inflammatory, antilipidemic, antimalarial, anti-obesity, antioxidant, hepatoprotective, cardioprotective, and neuroprotective pharmacological activities. Conclusion: It is concluded that abundant bioactive compounds identified and separated from Cyperus rotundus possess potential medicinal values on different systems of the body.

Phytochemical Profiling and Pharmacological Evaluation of Methanolic Leaf Extract of C. digyna for Cytotoxic, Anti‐inflammatory, Antioxidant, Antiarthritic, and Analgesic Activities

ABSTRACTCaesalpinia digyna (Family: Fabaceae) is traditionally used in Ayurvedic medicine for various medicinal purposes, including as a treatment for wounds, leprosy, skin diseases, fever, diabetes, etc. Although the root and stem of this plant have a significant medicinal value, there was little research on the leaves of this plant. This study aimed to investigate the qualitative phytochemical profile and evaluate the in vitro cytotoxic, anti‐inflammatory, antioxidant, and antiarthritic activities, as well as the in vivo anti‐inflammatory and analgesic activities, of C. digyna leaf extract. The methanolic extract of C. digyna leaves was prepared using an ultrasonic‐assisted extraction process. In vitro and in vivo anti‐inflammatory activities were evaluated using the hypotonicity‐induced hemolysis and carrageenan‐induced paw edema methods, respectively. Additionally, the extract was assessed for in vitro DPPH (1, 1‐diphenyl‐2‐picrylhydrazyl) free radical scavenging, antiarthritic (protein denaturation), and in vivo analgesic (acetic acid‐induced writhing and tail immersion) activities. Brine shrimp lethality bioassay (BSLB) showed moderate cytotoxic activity (LC50 = 2.25 μg/mL) compared with the standard vincristine sulfate (LC50 = 1.61 μg/mL). In vitro, anti‐inflammatory activity exhibited 85.13% (IC50 value = 2.51 μg/mL) inhibition of Human Red Blood Cell (HRBC) membrane lysis at a concentration of 2000 μg/mL whereas in vivo anti‐inflammatory study exerted its maximum effect (p < 0.05) at 400 mg/kg bw dose. This extract also showed significant antioxidant (IC50 = 0.218 μg/mL), antiarthritic (83.61% inhibition) activity, and moderate analgesic effect (p < 0.05) in both methods. These research findings indicated that C. digyna leaves extract has potent antioxidant, analgesic, and anti‐inflammatory effects which can be used as a supplementary medication for inflammatory pain‐relieving factors. In future, finding the mechanism involved in these effects could have significant impact on clinical science.

Metabolic Effects of Loquat Juice (Eriobotrya japonica Lindl Mkarkeb Variety) on Lipid Homeostasis, Liver Steatosis, and Oxidative Stress in Hyperlipidemic Mice Fed a High-Fat–High-Fructose Diet

Background: Loquat fruit is consumed for its flavorful taste and a rich array of health-promoting compounds like phenolics, flavonoids, and carotenoids. This study aimed at the biochemical characterization of fresh juice from the Moroccan Mkarkeb variety of loquat and evaluating its effects on lipid homeostasis and liver steatosis in hyperlipidemic mice. Methods: The biochemical characterization followed AOAC methods. In vivo study involved hyperlipidemic mice fed a high-fat, high-fructose diet for 6 weeks and treated with loquat juice at 3.5 and 7 mL kg−1 or fenofibrate at 4 mg·kg−1. The concentrations of lipids in plasma, liver, adipose tissue, feces, and bile and blood glucose levels were quantified. Liver steatosis was visually examined and confirmed histologically, and liver injury markers (AST, ALT, ALP, LDH, and TB) were measured. Liver oxidative stress was assessed by measuring MDA content and antioxidative enzyme activities. Results: Our findings indicate that fresh loquat juice is poor in fat and protein and contains moderate sugars with a low energy value (40.82 ± 0.25 kcal/100 g). It is also rich in minerals, vitamin C, phenolic acids, flavonoids, and carotenoids. The juice effectively restored lipid metabolism by enhancing reverse cholesterol transport and lowering LDL-cholesterol, triglycerides, and the atherogenic index. The studied juice decreases blood glucose and prevents weight gain and lipid accumulation in the liver and adipose tissue. The juice prevents lipotoxicity-induced liver injury, corrects toxicity markers, and improves the liver’s morphological and histological structures. It also reduces oxidative stress by lowering MDA and activating SOD and catalase. Conclusions: The juice holds high nutritional and medicinal value, potentially preventing lipid disorders and cardiovascular issues.

Metabolomic characteristics and anthraquinones accumulation patterns of Rhubarb in different tissues and roots from different developmental stages

Rhubarb’s multifaceted value in culinary and medicine is renowned, especially Rheum tanguticum (Rhubarb), whose bountiful content of anthraquinones (AQs) makes it increasingly attractive in the realms of dietary supplements and natural edible pigments. Current understanding of the spatiotemporal dynamics of AQs accumulation in Rhubarb remains limited, and the knowledge of other valuable metabolites is even more scarce. This gap limits the ability to fully explore Rhubarb's potential as a food ingredient and hinders its efficient use in food development, potentially leading to unnecessary resource waste. This study integrated widely targeted metabolomics and AQs quantification to determine the metabolic profiles in four tissues and the roots at three developmental stages in Rhubarb. The high levels of malic and citric acids in the stems paved the way for their use in flavored beverages and substantiated the practice of traditional consumption. The abundance of flavonoids in the leaves and seeds, and the AQs, phenolic acids of the seeds, which potentially bestowed upon them exceptional antioxidant capabilities, underscore the significant potential of edible product development. The widespread traditional use of roots was mirrored by the preferential accumulation of AQs, and the roots' value escalated in tandem with the time-accumulated increase of AQs. The root bark and root tip with high AQs should be given attention in production and not simply discarded. This research clarifies the chemical composition and spatiotemporal variation patterns of Rhubarb’s characteristic components, offering valuable scientific insights for their efficient use and value enhancement in the food industry.

Molecular theranostics: principles, challenges and controversies.

Theranostics is a new term for long-established principles in nuclear medicine. The generalisability of the term means there is a very broad use of the term across the medical literature, not all of which is consistent with the intent in nuclear medicine. The term molecular theranostics better reflects the philosophy and application in nuclear medicine. Even with a clearer definition, there are a number of challenges or controversies whose debate provides a richer understanding of the principles and applications of molecular theranostics. Radioiodine imaging and therapy of hyperthyroidism and thyroid cancer provide the historical context for theranostics. The prototype molecular theranostic is the 68Ga/177Lu DOTATATE pair that targets somatostatin receptor subtype 2 in neuroendocrine tumors. The potential value of precision medicine of radiation dosimetry in molecular theranostics needs a balanced discussion with limitations of reactive dosimetry and the opportunities for predictive or pre-treatment dosimetry. Despite challenges and limitations, molecular theranostics is a powerful tool in the precision medicine landscape. Molecular theranostics is a vehicle for improved outcomes in cancer patients with a future-facing portfolio of opportunities.

The Composition, Antioxidant and Antibacterial Activity of Essential Oils from Five Species of the Magnoliaceae Family

The leaves of Magnoliaceae family plants contain abundant essential oils (EOs), and these species can be used in many fields due to their high industrial, medicinal, and ornamental values. This study aims to identify the main compounds of the EOs from the leaves of five common Magnoliaceae species (Michelia maudiae, Michelia hedyosperma, Michelia macclurei, Manglietia lucida, Manglietia conifer) using hydrodistillation, GC–MS analysis, and in vitro tests. Additionally, the antioxidant and antibacterial activities of the EOs were also evaluated. The results show that 151 compounds were identified across five species, with sesquiterpenes being dominant. Some key compounds (such as β-caryophyllene, δ-amorphene, β-guaiene, globulol, and β-acorenol) were common among all the species, highlighting their crucial roles in plant physiology and resilience. Other compounds (like valeranone and nerolidol in M. maudiae and β-elemene in M. macclurei) were specific, indicating different functions. Among the five species, the essential oil of M. macclurei contains β-elemene and nerolidyl acetate, and it has the weakest antioxidant activity (IC50 value: 2918.61~21,341.98 μg/mL) but the strongest antibacterial activity (inhibition zone diameter: 8.55 ± 0.93~22.92 ± 0.46 mm; LC50 value: 0.02~0.78 mg/mL). Meanwhile, the EO of M. maudiae demonstrated the best antioxidant activity (the IC50 value was 1283.58~6258.32 μg/mL) and the second-best antibacterial activity (the inhibition zone diameter ranged from 7.61 ± 0.02 to 26.92 ± 0.46 mm, and the LC50 value was 0.03~2.28 mg/mL). Overall, the EO of M. maudiae had the best comprehensive performance. Therefore, the EOs of M. macclurei and M. maudiae showed different performances in biological activity categories, and they could be developed and used in different fields, with the possibility of discovering new applications. This brings inspiration to the potential commercial and industrial uses of sesquiterpenes in Magnoliaceae.

Neuroprotection and mechanisms of ginsenosides in nervous system diseases: Progress and perspectives.

Ginsenosides are the primary component discernible from ginseng, including Rb1, Rb2, Rd, Rg1, Rg2, and compound K, and so forth. They have been shown to have multiple pharmacological activities. In recent years, more and more studies have been devoted to the neuroprotection of various ginsenosides against neurological diseases and their potential mechanisms. This paper comprehensively summarizes and reviews the neuroprotective effects of various ginsenosides on neurological diseases, especially acute and chronic neurodegenerative diseases, and their mechanisms, as well as their potential therapeutic applications to promote neuroprotection in disease prevention, treatment, and prognosis. Briefly, ginsenosides exert effective neuroprotective effects on neurological conditions, including stroke, Alzheimer's disease, Parkinson's disease, and brain/spinal cord injuries through a variety of molecular mechanisms, including anti-inflammatory, antioxidant, and anti-apoptotic. Among them, some signaling pathways play important roles in related processes, such as PI3K/Akt, TLR4/NF-κB, ROS/TXNIP/NLRP3, HO-1/Nrf2, Wnt/β-catenin, and Ca2+ pathway. In conclusion, the present study reviews the research progress on the neuroprotective effects of ginsenosides in the last decade, with the aim of furnishing essential theoretical underpinning and effective references for further research and exploration of the multiple medicinal values of Chinese herbal medicines and their small molecule compounds, including ginseng and panax ginseng. Because there is less evidence in the existing clinical studies, future research should be focused on clinical trials in order to truly reflect the clinical value of various ginsenosides for the benefit of patients.

Discerning the Multi-dimensional Role of Salicin: Bioactive Glycoside Beyond Analgesic: Different Perspectives

: Salicin is a glycoside that can be found in several Salix and Populus species. Salicin is also connected to the glycoside populin, commonly known as benzoyl Salicin, in the Salicaceae tree barks. D-glucose is a component of the alcoholic glycoside Salicin (C13H18O7). The willow tree, as well as other trees like poplar and aspen, contains the natural chemical Salicin, which is a member of the salicylate family. Salicin is an anti-inflammatory and analgesic used in conventional medicine, and it served as the inspiration for the creation of aspirin. This molecule may have important human pharmacological actions that need to be considered in determining the efficacy and safety of willow herbal medicines. The extracts obtained from the bark of the tree, belonging to the Saliceae family in different solvents have been known for possessing many important medicinal values by potent pharmacological actions. The current effort deals with exquisite detailed aspects and concerns related to Salicin, which will be fruitful for the futuristic approaches to Salicin.