Genital Papillae Research Articles

A long-term high temperature on young Nile tilapia females affects its urogenital papilla morphology and future reproductive performance

Dysmorphia in urogenital papilla of Nile tilapia drastically reduces the reproductive performance of this species. However, the study of factors that affect the prevalence of this anomaly have not yet been performed. This study evaluated genetic and environmental (temperature and bacterial agent) effects on the prevalence of urogenital papilla dysmorphia and their impact on reproductive performance, hormonal profile, and biological indices. For such, 2400 larvae from the base generation of a breeding program (without selection or G0) and 3600 larvae from generation 8 (generation obtained after seven generations of selection for body weight - G8) were distributed in 20 tanks of 150 L and exposed to temperature treatments for 60 days after yolk sac absorption (daysa). The G0 and G8 fish were under two and three different ranges of temperature, respectively, as following: control temperature from 25 to 28 °C (CT-G8), moderate temperature from 27 to 30 °C (MT-G8 and MT-G0), and high temperature from 30 to 33 °C (HT-G8 and HT- G0), totaling 5 treatments with 4 replicates. After 60 days, tilapias from the different treatments were reared in the same tank and identified by PIT tags when they achieved 50 g. The animals at six months of age were sexed, and females have the urogenital papillae classified as normal or abnormal (mild or severe), and ten abnormal females were sampled for bacteriological evaluation. The tilapia females were reevaluated at 8 months of age to determine the prevalence of the dysmorphia. To evaluate the impact of treatments on reproductive performance, 70 females per treatment were used in a reproductive assay for 8 weeks. At the end of reproductive assay, the blood plasma was collected to determine the levels of 17-beta-estradiol and 11-ketotestosterone. All samples evaluated were negative in bacteriological analysis. The prevalence of urogenital papilla dysmorphia in CT-G8, MT-G8, HT-G8, MT-G0 and HT-G0 were 20.49 %, 61.59 %, 89.48 %, 68.39 %, and 43.70 %, respectively. The dysmorphia prevalence was similar only between MT-G0 and MT-G8 (p > .05). Except by the HT-G0 group, all treatments presented significant reduction close to 70 % in the reproductive performance in comparison to the control (p < .05). Animals with severe dysmorphia exhibited the highest values of gonadosomatic and viscerosomatic indexes. The HT-G8 group presented a higher concentration of estradiol in plasma, but like MT-G0 group. The CT-G8 showed the highest value of 11-ketotestosterone among all treatments. In conclusion, the rearing of Nile tilapia in temperature close to 25 °C in the first 60 daysa is recommended to produce an efficient broodstock.

Four new earthworm species of the genera Amynthas and Metaphire (Oligochaeta, Megascolecidae) from Hunan and Anhui provinces, China.

This paper describes four new species earthworms from Hunan and Anhui provinces, China, Amynthasxiangtanensis Qiu & Jin, sp. nov., Amynthastaoyuanensis Qiu & Jin, sp. nov., Amynthasxuanchengensis Jin & Li, sp. nov. and Metaphiredonganensis Jin & Jiang, sp. nov. Amynthasxiangtanensis sp. nov., and A.taoyuanensis sp. nov. belong to the Amynthascorticis group. Both have four pairs of intersegmental spermathecal pores in 5/6-8/9; male pores in segment XVIII, separated by 1/3 of body circumference, each on top of a slightly raised porophore, surrounded by several tiny genital papillae. Amynthastaoyuanensis sp. nov. prostate glands are degenerated. Amynthasxuanchengensis sp. nov. belongs to the Amynthasmorrisi group, it has two pairs of spermathecal pores in 5/6 and 6/7; male pores in XVIII, separated by 1/3 of body circumference, each on top of a slightly raised, circular porophore. Metaphiredonganensis sp. nov. belongs to the Metaphirehoulleti group. It has three pairs of spermathecal pores in 6/7-8/9; male pores in XVIII, separated by 1/3 of body circumference, each on the bottom center of the longitudinal copulatory chamber.

Okhotsk sculpin Icelus ochotensis (Cottiformes: Cottidae) is a complex; redescription of the type series

The genus Icelus Krøyer, 1845 includes 18 valid species from shelf and upper slope of the northern Pacific, Arctic and North Atlantic. The taxonomy of the genus is under development. To solve taxonomic problems, there is a need to clarify the diagnostic characters of already known species. As it turned out, information about the composition of the type series of the Okhotsk sculpin I. ochotensis Schmidt, 1927 from different sources is contradictory, and the diagnostic characters in the latest revision of the genus and in the keys for species identification diverge from the original description. The work clarifies the composition of the type series of the Okhotsk sculpin from the ZIN collection (36 specimens), provides a redescription and diagnosis; the Lectotype No. 21898 is designated. Icelus ochotensis, characterized by the presence of only two rows of large scales on the body (dorsal row Dl and lateral line Ll), was included in the group “I. bicornis”, along with I. spatula Gilbert et Burke, 1912, I. uncinalis Gilbert et Burke, 1912 and I. stenosomus Andriashev, 1937. Contrary to results of the latest revision of the genus and modern identifying keys, on the top of its head there is not one pair of spines, but two pairs (parietal and nuchal ones), in the form of blunt tubercles hidden in the skin. The dorsal row of scales (Dl) in front is complete (reaches the head); lateral line begins under scales 3rd–4th of the dorsal row and does not extend posteriorly onto caudal fin; scales Ll below the canal pore are immersed in the skin and usually not serrated (one or two tiny spinules may present); supraorbital cirrus (skin appendage) is simple. The urogenital papilla of males is cylindrical, in contrast to the spatulate one in I. spatula. Vertebrae 37–40, D VII–IX 15–19, A 13–16, P 17–18, Ll 38–40, Dl 29–34; axillary scales 6–13. The distribution of the Okhotsk sculpin requires revision, since modern keys for Icelus identification contain incorrect characters for this species (one pair of spines on the top of the head).

Minimizing the time to evaluate pheromone-mediated reduction of aggressive behavior in Mozambique tilapia (Oreochromis mossambicus).

Some cichlid fishes release urine-containing chemical cues that lower aggression in their opponents. Bioassays to identify the aggression-modulating pheromone include assessing the effect of urine fractions on the behavior towards a mirror image or in interactions with another male. However, many of these methods can be time-consuming and require many fish. The objective of the present study was to assess the behavior of male Mozambique tilapia (Oreochromis mossambicus) towards male urine using two methods with the intent of simplifying the bioassays: aggression towards a mirror image (mirror assay) and real opponents in which the urogenital papilla was tied using surgical silk to prevent urination. The results confirm the aggression-reducing effect of dominant male urine in both experimental approaches. Ten minutes of biting or 15 min of tail-beating behaviors in the mirror assay, or 5 min of opercular expansion or 15 min of lateral display in interactions with real opponents were necessary to detect a statistically significant reduction in aggressive behavior towards dominant male urine. We also found that males with subordinate status had lower latency to initiate aggressive behaviors towards the mirror than dominants in the same condition, even though fish had been isolated for 1 week. However, no such differences in latency were found in the real opponent assay. We conclude that 5 min of opercular expansion behavior in real opponent fights or 10 min of biting behavior in the mirror assay are the shortest times necessary to test aggressive behavior in urine fractions in bioassay-guided identification of pheromones.

Application of germ cell transplantation in generation of surrogate fish gametes: implication for control of invasive species

Germ cell (GC) transplantation (GCT) in teleost is widely used for surrogate gametes production and revitalization of reproductive competence in senescent fish species. Here,an innovative application of GCT is described for control of invasive fish population those compete with the native fish fauna of anecosystem. The donor GCs isolated from zebra fish (Daniorerio) and transplanted through the genital papilla into the gonads of recipients medaka (Oryziaslatipes) that were depleted of endogenous GCs by Busulfan(40 mg/kg BW; 2 dosage) and water temperature (38?C) treatments. Three months after GCT, the donor GCs were able to recolonize the recipients' gonads and resume gamatogenesis. The presence of donor-derived gametes was confirmed by PCR in 70% and 61% of the surrogate O. latipesmales and females, respectively. Four months after the GCT, artificial and natural spawning trails were conducted by crossingsurrogate parents with their wild counterparts. Such crosses produced 40% pure O. latipes individuals whereas remaining 60% embryos, although fertilized, but embryonic development was ceased hours after fertilization. The application of GCT described here could be useful for ecosystem management especially for control of invasive fish species those causes huge economical losses worldwide.. KEYWORDS :Germ cell transplantation; population control; ecosystem management; surrogate fish; assisted reproductive technology.

Pristionchus seladoniae n. sp. (Diplogastridae) isolated from a eusocial soil-dwelling bee, Halictus (Seladonia) aerarius, in Nagano, Japan

Summary A new species of Pristionchus was isolated from a soil-dwelling bee, Halictus (Seladonia) aerarius, collected from Sugadaira, Nagano, Japan. The nematode was successfully cultured on nematode growth medium agar previously inoculated with the Escherichia coli strain OP50; however, it did not propagate well. Typologically, the new species is similar to other Pristionchus belonging to the maupasi, pacificus and lheritieri groups in the stomatal structure of stenostomatous form. However, the species is characterised by the relatively short, conical tail of the female and the arrangement of male genital papillae in which the second- and third-paired papillae are almost at the same level and one of these two are directed laterally. Phylogenetically, the nematode belongs to the maupasi group, the ‘American clade’ within the genus, and is separable from the other species in the group. Biologically, the species has several interesting characters: it is seemingly native to Japan, regardless of its phylogenetic group; it is in tight and specific phoretic association with a eusocial bee; it lacks a eurystomatous form (or this form occurs rarely) under cultured conditions; and it shows characteristic clumping behaviour on culture media. The new species is taxonomically described herein as Pristionchus seladoniae n. sp.

Bursaphelenchus glaucae n. sp. isolated from larval faeces of a longhorn beetle, Aeolesthes chrysothrix chrysothrix (Bates), in its pupal chamber constructed in the dead wood of Quercus glauca Thunb. from Japan

Summary A Bursaphelenchus species belonging to the hofmanni group (corneolus subgroup) was isolated from a small piece of larval faeces of the longhorn beetle Aeolesthes chrysothrix chrysothrix in its pupal chamber. The chamber was constructed in a dead wood section of Quercus glauca obtained from a live tree. The material was obtained during a management procedure of a garden tree to remove the dead part from live tree. The species is typologically characterised by its three-lined lateral field, the position of its secretory-excretory pore overlapping with the metacorpus anterior half, a very small spicule with distinctive broad and rounded condyles, a flattened trapezoid-shaped rostrum and small flattened cucullus, the presence of seven (P1, P2 and P3 papilliform and P5 gland) male genital papillae, a female vulva with a side flap and female tail forming an elongate conoid with a strongly ventrally curved posterior half and narrowly rounded or digitate tip. The species is typologically close to B. corneolus, sharing a small cucullus and female tail shape, but can be distinguished from the other species by the position of the secretory-excretory pore and the spicule rostrum shape. Phylogenetically, the new species forms a well-supported clade with B. corneolus, but can be distinguished by its clearly separable phylogenetic status inferred from SSU and D2-D3 LSU sequences and the difference in the ITS sequence. The new species is described as B. glaucae n. sp. Although the nematode was isolated from the larval faeces of A. c. chrysothrix, it has not been directly isolated from the insect body to date, thus, the carrier insect of the nematode has not been determined.

A new characid species with remarkable sexual dimorphism (Characiformes: Characidae: Stevardiinae) from the upper Guayabero River, Orinoco basin, Colombia.

A new species of characid with remarkable sexual characteristics is described from the upper Guayabero River drainage from the Orinoco basin in Colombia. The new species is included in the genus Monotocheirodon by sharing most of the previously proposed diagnostic features of this genus. It differs from all Stevardiinae by the combination, in adult males, of an enlarged urogenital papilla in contact with the first anal-fin unbranched ray and a highly modified anal fin with enlarged and distally elongated first and second branched anal-fin rays, forming a gonopodium-like structure. In addition, it differs from congeners by the presence of an adipose fin, an incomplete lateral line, an ascending process of the premaxilla dorsally oriented, and a long snout. The new species was discovered from a poorly sampled region in Colombia and is an unexpected new record given its disjunct geographic distribution from other species of the genus. Monotocheirodon species were previously known from piedmont drainages in Bolivia and Peru. The conservation status of the new species is herein categorized following IUCN criteria.

Disruption of Thyroid Hormone Receptor Thrab Leads to Female Infertility in Zebrafish.

Thyroid hormones (THs) T4 and T3 are vital for development, growth, and metabolism. Thyroid dysfunction can also cause problems in fertility, suggesting involvement of THs in reproduction. In zebrafish, there exist 2 forms of TH receptor alpha gene (thraa and thrab). Disruption of these genes by CRISPR/Cas9 showed no reproductive irregularities in the thraa mutant; however, inactivation of the thrab gene resulted in female infertility. Although young female mutants (thrabm/m) showed normal ovarian development and folliculogenesis before sexual maturation, they failed to release eggs during oviposition after sexual maturation. This spawning failure was due to oviductal blockage at the genital papilla. The obstruction of the oviduct subsequently caused an accumulation of the eggs in the ovary, resulting in severe ovarian hypertrophy, abdominal distention, and disruption of folliculogenesis. Gene expression analysis showed expression of both TH receptors and estrogen receptors in the genital papilla, suggesting a direct TH action and potential interactions between thyroid and estrogen signaling pathways in controlling genital papilla development and function. In addition to their actions in the reproductive tracts, THs may also have direct effects in the ovary, as suggested by follicle atresia and cessation of folliculogenesis in the heterozygous mutant (thrab+/m), which was normal in all aspects of female reproduction in young and sexually mature fish but exhibited premature ovarian failure in aged females. In summary, this study provides substantial evidence for roles of THs in controlling the development and functions of both reproductive tract and ovary.

Production of fertile YY pseudofemales in Nile tilapia with LG23 as the sex chromosome

Nile tilapia display conspicuous differences in growth rates between genders, as males tend to outpace and outgrow females. The production of all male Nile tilapia populations using genetically male tilapia (GMT) technology represents the most efficient and scientifically grounded approach. Most of the Nile tilapia stocks in aquaculture use LG23 as sex chromosome. The crux of GMT lies in the acquisition of YY supermales and YY pseudofemales (pF). Nonetheless, the utilization of GMT is impeded by the lower fertility and even infertility of feminized YY-pF. In this study, we found that YY-pF exhibited male-like genital papillae, and exhibited significantly higher androgen levels and lower E2 levels compared with that of fertile XY-pF. YY-pF carries two copies of Amhy but lacks Amh, and XY-pF possesses one Amhy and one Amh. In XY-pF, the expression of Amh/Amhy was only observed in granulosa cells of phase I and II follicles, while in YY-pF, Amhy expression persisted from phase I to IV. On the contrary, Cyp19a1a was found to be highly expressed in granulosa cells of phase III and IV follicles in XY-pF, but significantly reduced in granulosa cells of phase III and IV follicles in YY-pF, exhibiting a reciprocal expression pattern with Amhy. Consistently, YY-pF with one copy of Amhy mutation (YY-Amhy+/−-pF) were fertile. These results indicated that prolonged expression of Amhy led to a decrease in the expression of Cyp19a1a, followed by a decrease in serum E2 levels and an increase in androgen levels. Based on these data, we treated YY-pF with both E2 and trilostane (androgen synthetase inhibitors) simultaneously at the vitellogenic stage to make it fertile. The acquisition of fertile YY-pF laid the foundation for the widespread application of GMT.

Description of a new species of entomopathogenic nematode, Steinernema ramanai sp. n. from Kerala, India

Aim: A novel species of entomopathogenic nematode (EPN) belonging to genus Steinernema was discovered in the rhizosphere of ginger grown at Kozhikode, Kerala, India. Methodology: Morphological and molecular characterization of new species of Steinernema and its phylogenetic relationships with other Steinernema species were investigated using DNA extracted and amplified rDNA of the ITS region using primers 18S (FORWARD) 5' TTGATTACGTCCCTGCCCTTT 3' and 26S (REVERSE) 5' TTTCACTCGCCG TTACTAAGG 3'. Results: New species described based on the length of infective juvenile, which was the smallest species among the described Steinernema species. S. ramanai sp. n. has five incisures in the lateral field, an elongate conoid tail that gradually tapered at the tip in infective juveniles; vulva with double flapped epipytigma and tail without post anal swelling in females; body 'J' shaped upon fixation, ten genital papillae, and a mucron on the tail terminus in males. This new species is distinguished genetically by its unique rDNA ITS region nucleotide sequence. The ITS sections of ribosomal DNA were sequenced to confirm this new species. Interpretation: Native EPNs may yield species and/or strains that are better suited for inundative release against local pests. This logic has prompted coordination of several surveys in the search for novel species and strains, particularly in areas where EPNs had previously remained undetected. Key words: Biocontrol, Morphology, Molecular characterization, Steinernema, Taxonomy

Three new species of the genus Amynthas (Oligochaeta: Megascolecidae) from Guangxi Zhuang Autonomous Region, China.

Three new earthworm species of the genus Amynthas Kinberg, 1867 were found in Guangxi Zhuang Autonomous Region, China: Amynthas huapingensis sp. nov., Amynthas retentus sp. nov. and Amynthas linguiensis sp. nov. Amynthas huapingensis sp. nov. belongs to Amynthas corticis-group characterized by having four pairs of spermathecal pores in 5/68/9; Amynthas retentus sp. nov., without spermathecal pores, belongs to Amynthas illotus-group; Amynthas huapingensis sp. nov. and Amynthas retentus sp. nov. have similar characteristics of male porophores medially surrounded by 23 genital papillae in a pulvinate pad within the male pore area. Amynthas linguiensis sp. nov. has variable spermathecal pores, three pairs in 6/78/9 or four pairs in 5/68/9. And its male pores each on the center of a large elliptical glandular porophore which extends from 1/4xvii to 1/4xix. The morphological comparison and COI gene data of these three new species and their similar species are given in this paper.

MORPHOLOGICAL AND MOLECULAR CHARACTERIZATION OF A BRAND NEW ISOLATE OF ENTOMOPATHOGENIC NEMATODE, STEINERNEMA FELTIAE (FILIPJEV) (RHABDITIDA: STEINERNEMATIDAE) FROM THE UZBEKISTAN

Steinernema feltiae isolate Sf:1 changed into recovered from one soil pattern gathered from the Surkhandarya region, Uzbekistan. The new isolate may be prominent from different isolates through morphologic and morphometric data, and rRNA sequences. The first generation male is characterized through spicule duration 79,5 (73±87) mm, SW ratio [(spicule length/anal body diameter)*100] 160 13 (137±177), GS ratio GS [(gubernaculum/ spicule length)*100] 79 8 (62±87), genital papillae association and the second one technology male through a mucron 10 1 (9±11) mm long. For the infective juvenile, the frame is 883 82 (754±975) mm long, lateral fields with 8 similarly evolved ridges, head smooth, barely offset, massive gonad primordium cells, a protracted hyaline tail portion (identical to 1/2 of of tail duration), and pore-like phasmid at 41% of the tail duration to the semicircle anus are the differentiation factors.

Resolution of the Tetrabothrius jagerskioeldi Cryptic Species Complex among Holarctic Alcidae (Charadriiformes): Cestodes among Fraterculinae—Exploring Marine Diversity, Host Range, and Dynamic Oceanography in the Greater North Pacific

In the biosphere, limits for diversity among species, communities, and biomes are revealed through intensive and extensive field-based inventory and assembly of voucher specimens and associated informatics examined in a phylogenetic, historical, ecological, and biogeographic arena. Archival resources for specimens and information contribute to a cumulative view of faunal structure and assembly under a comparative umbrella. Ultimately, species definitions, and inclusive partitions among populations and lineages, are fundamental in articulating hypotheses that examine interactions about evolution, the nature of organisms, and the condition of environments across space and time. We conclude our proposals establishing species limits for tapeworms of the cryptic complex historically accommodated in Tetrabothrius jagerskioeldi Nybelin, 1916 among Alcidae seabirds (Charadriiformes). Explorations of this facet of marine diversity summarize inventory data for species of Tetrabothrius Rudolphi, 1819 from field collections among 1,976 seabirds of 41 species representing 3 avian orders (Charadriiformes, Suliformes, Procellariiformes) examined across 58 oceanic/geographic localities from the greater North Pacific basin between 1949 and 2019, or over the past 70 years. Cestodes of the complex including T. jagerskioeldi sensu stricto, T. alcae Hoberg and Soudachanh, 2021, and T. sinistralis Hoberg and Soudachanh, 2021, along with 2 previously unrecognized taxa, are documented, occurring in 128 of 1976 seabirds examined (6%) and 17 of 41 marine avian species from 23 insular, coastal, and pelagic sites spanning the North Pacific. In completing an evaluation of this assemblage, we focus on those cestodes among 8 species of medium- to small-bodied alcids, subfamily Fraterculinae. Specimens designated as Tetrabothrius fraterculus n. sp. were observed among puffins (2 species of Fraterculus and Cerorhinca), whereas Tetrabothrius aithuia n. sp. is proposed for tapeworms in auklets (4 species of Aethia and Ptychoramphus) and a puffin (Cerorhinca); both cestodes are currently unknown among the Alcinae species of Cepphus, Uria, Brachyramphus, and Synthliboramphus based on the North Pacific inventory collections. These large-bodied cestodes, typical of the 5 species in the complex, are characterized among 46 currently valid species of Tetrabothrius in avian hosts, based on unique configurations of the genital atrium; male and female genital papillae; terminal genital ducts; numbers of testes; and the structure, position, and dimensions of the vaginal and atrial seminal receptacles. Ancillary characters contributing to differentiation include attributes of the scolex, structure, dimensions, and position of the vitelline gland and relative position of the dorsal and ventral osmoregulatory canals. A suite of complex attributes unequivocally separates 5 respective species that had historically been relegated to a single geographically widespread and morphologically variable taxon under T. jagerskioeldi sensu lato. Host range for respective cryptic species of the T. jagerskioeldi–complex reveal an intricate view of ecological isolation and connectivity across the greater North Pacific basin. Seabirds, marine mammals, and parasites are indicators of changing conditions over space and time. Oceanic regime shifts, prey cascades, and diversity for birds and parasites serve as proxies for revealing accelerating perturbation in marine foodwebs under climate forcing.

Taxonomy of the Family Teneriffiidae (Acari: Prostigmata: Anystoidea): Generic Synonymies with the Key to World Species of the Family

The family Teneriffiidae Thor has an equivocal and patchy generic history due to a lack of proper diagnostic character/s, causing the addition of an over-sufficient number of genera (i.e., nine) for the 28 described species. The present study aimed to resolve those taxonomic uncertainties related to generic divisions and species assignments by thoroughly reviewing all the published literature of the family, identifying key diagnostic character/s for generic divisions while debating on previously used morphological features. In the present research, only two genera, Teneriffia Thor and Parateneriffia Thor, are considered valid genera in the family Teneriffiidae, based on the absence and presence of palpgenu oncophysis, respectively. The previously used other generic diagnostic characters such as coxal setal formula, pectination strength of leg claws, absence or presence of genital papillae, genital discs, and pedal solenidion have been argued for their inconsistencies. A total of four species were synonymized with the closely related species, while additional notes for six poorly described species are given. Moreover, the key to the genera and species of the family Teneriffiidae is provided.

Genetic evidence for differential functions of figla and nobox in zebrafish ovarian differentiation and folliculogenesis

FIGLA and NOBOX are important oocyte-specific transcription factors. Both figla-/- and nobox-/- mutants showed all-male phenotype in zebrafish due to increased dominance of the male-promoting pathway. The early diversion towards males in these mutants has precluded analysis of their roles in folliculogenesis. In this study, we attenuated the male-promoting pathway by deleting dmrt1, a key male-promoting gene, in figla-/- and nobox-/- fish, which allows a sufficient display of defects in folliculogenesis. Germ cells in figla-/-;dmrt1-/- double mutant remained in cysts without forming follicles. In contrast, follicles could form well but exhibited deficient growth in nobox-/-;dmrt1-/- double mutants. Follicles in nobox-/-;dmrt1-/- ovary could progress to previtellogenic (PV) stage but failed to enter vitellogenic growth. Such arrest at PV stage suggested a possible deficiency in estrogen signaling. This was supported by lines of evidence in nobox-/-;dmrt1-/-, including reduced expression of ovarian aromatase (cyp19a1a) and level of serum estradiol (E2), regressed genital papilla (female secondary sex characteristics), and more importantly the resumption of vitellogenic growth by E2 treatment. Expression analysis suggested Nobox might regulate cyp19a1a by controlling Gdf9 and/or Bmp15. Our discoveries indicate that Figla is essential for ovarian differentiation and follicle formation whereas Nobox is important for driving subsequent follicle development.

Cabdio occidentalis, a new species from Lake Mashkid basin and the Makran region (Teleostei: Danionidae).

Cabdio occidentalis, new species, is described from the Lake Mashkid basin and the Makran region of Iran. It is distinguished from other species of the genus by a combination of characters: 3842+12 total lateral-line scales, 1923 predorsal scales, 911 pectoral-fin rays, and the absence of a keel between the pelvic-fin base and the genital papilla. The cytochrome c oxidase subunit I (COI) sequence separates C. occidentalis from C. morar, its closest congener, by a p-distance of 5.5%.

Taxonomic and molecular characterization of a new entomopathogenic nematode species, Heterorhabditis casmirica n. sp., and whole genome sequencing of its associated bacterial symbiont

BackgroundNematodes of the genus Heterorhabditis are important biocontrol agents as they form a lethal combination with their symbiotic Photorhabdus bacteria against agricultural insect pests. This study describes a new species of Heterorhabditis.MethodsSix Heterorhabditis nematode populations were recovered from agricultural soils in Jammu and Kashmir, India. An initial examination using mitochondrial and nuclear genes showed that they belong to a new species. To describe this new species, a variety of analyses were conducted, including reconstructing phylogenetic relationships based on multiple genes, characterizing the nematodes at the morphological and morphometric levels, performing self-crossing and cross-hybridization experiments, and isolating and characterizing their symbiotic bacteria.ResultsThe newly discovered species, Heterorhabditis casmirica n. sp., shares 94% mitochondrial cytochrome C oxidase subunit I gene (COI) sequence identity with Heterorhabditis bacteriophora and Heterorhabditis ruandica, and 93% with Heterorhabditis zacatecana. Morphologically, it differs from H. bacteriophora in its infective juvenile phasmids (present vs. inconspicuous) and bacterial pouch visibility in the ventricular portion of the intestine (invisible vs. visible); genital papilla 1 (GP1) position (at manubrium level vs. more anterior), and in its b ratio (body length/neck length), c ratio (tail length/bulb width), and D% [(excretory pore/neck length) × 100]. Other morphological differences include anterior end to the nerve ring distance (77–100 vs. 121–130 μm), V% [(anterior end of vulva/body length) × 100] (46–57 vs. 41–47) in hermaphroditic females; rectum size (slightly longer than the anal body diameter vs. about three times longer), phasmids (smaller vs. inconspicuous), body length (0.13–2.0 vs. 0.32–0.39 mm), body diameter (73–150 vs. 160–220 μm), anterior end to the excretory pore distance (135–157 vs. 174–214 μm), and demanian ratios in amphimictic females. Morphological differences with H. ruandica and H. zacatecana were also observed. Furthermore, H. casmirica n. sp. did not mate or produce fertile progeny with other Heterorhabditis nematodes reported from India. It was also discovered that H. casmirica n. sp. is associated with 'Photorhabdus laumondii subsp. clarkei symbiotic bacteria.ConclusionsThe discovery of H. casmirica n. sp. provides novel insights into the diversity and evolution of Heterorhabditis nematodes and their symbiotic bacteria. This new species adds to the catalog of entomopathogenic nematodes in India.Graphical

Evaluation of Endoparasites in &lt;i&gt;Oreochromis aureus, Amia calva&lt;/i&gt; and &lt;i&gt;Clarias gariepinus&lt;/i&gt;, in Ase River, Delta State, Nigeria

Parasites constitute a major problem for fish health and their prevalence hamper fish growth and productivity by increasing their morbidity and mortality. Fish endoparasites are often associated with zoonotic disease in humans. The aim of this study was to determine the endoparasitic prevalence and feeding habits of Oreochromis aureus, Amia calva and Clarias gariepinus, in Ase River, Delta State, Nigeria. Atotal of 104 fish comprising of 40 O. aureus, 21 A. calva and 43 C. gariepinus were collected from seven locations of the river during dry and wet seasons, for parasitological investigations. The livers, gills, muscles, small and large intestines of fish specimens were examined, and the sex determination was done by physical observation of the genital papilla, which appeared long in males and reddish round in females. From the specimens, 96 (92.3%) had 191 overall endoparasitic loads. The highest and lowest percentage abundance of 51.18% and 13.08% were recorded in Locations 1 and 4 had respectively. Of the 96 infected fish, 29 (29.8%) were male and 68 (70.1%) female, indicating a much higher infection rate in females. On prevalence abundance across species, A. calva was highest with 21(100%). C. gariepinus was 40 (93.0%) and O. aureus was least with 35(87.5%). The study also identified a total of 21 endoparasites in five taxonomic groups; Protozoans (32.46%), Nematode (38.74%), Annelid (3.66%), Trematode (15.70%) and Cestode (9.42%). The mean intensity of parasitic load showed 58.6, 37.0 and 31.6 to be moderately, highly and slightly affected. ANOVA result on prevalence indicated a significant distribution of endoparasites across specimens (P&lt;0.05; P=0.001). Considering the effect of parasites on fish morbidity and mortality, human food-borne zoonoses, there is need for the communities and industries on the riverbank to adopt right policies for water pollution control.

Sachsia putridicola n. sp. (Rhabditida: Diplogastridae), isolated from an Onthophagus dung beetle (Coleoptera: Scarabaeidae) from Tsukuba, Japan

Summary An undescribed Sachsia species (Diplogastridae) was isolated from a dung beetle, Onthophagus sp. cf. atripennis, and the species is described here as Sachsia putridicola n. sp. The new species is characterised by its cheilostom; anterior part forming a cuticular ring, posterior part in the form of a thin-walled tube; an anisotopic gymnostom, a metastegostom with dorsal small tooth and no subventral armature, and setiform male genital papillae with the arrangement &lt;v1d, v2, v3/v4, ad, ph, v5-7, pd&gt;. Sachsia putridicola n. sp. is typologically similar to two previously described congeners, Sachsia zurstrasseni and Sachsia postpapillata, but can be readily distinguished by its anisotopic gymnostom (vs isotopic gymnostom in the two nominal species) and the direction of the anterior three pairs of genital papillae, which are directed sublaterally in the new species (vs second or third pair directed sublaterally in S. zurstrasseni and S. postpapillata, respectively). Phylogenetically, the new species is close to Eudiplogasterium evidentum, not S. zurstrasseni. Based on the typological and phylogenetic characters, the status of S. zurstrasseni is discussed.