Unusual Pattern Research Articles

Seeking their fortunes on the Otago goldfields, New Zealand – Constructing isotopic biographies of colonial goldminers

The nineteenth century New Zealand goldfields were a place where people from across the world came together in search of their fortunes. Written accounts of life on the diggings do exist but are of varying veracity and we therefore have little knowledge of the life experiences of those who came seeking gold. Recent excavations in cemeteries associated with the Otago goldrushes, however, are allowing direct reconstruction of lives using biological evidence from the skeletons themselves. In this study we use dietary isotope analysis (δ13C and δ15N) of tissues which form at different points in the life course of an individual to create ‘isotopic biographies’ of goldrush-era individuals. In addition to telling the individual stories of these people, we also highlight differences in life experience between members of the European and Chinese communities, evidence for seasonal availability of resources on the goldfields, as well as unusual weaning patterns which potentially link to rural poverty experienced during childhood.

Numerical investigation of unsteady aerodynamic characteristics induced by the interaction of oblique/bow shock waves during rotation

The interactions between oblique and bow shock waves are significant problems related to the aerodynamic force and thermal performance of hypersonic vehicles, but few studies have considered the dynamic effect of the body's motion on the phenomena. In this work, a numerical study on the oblique and bow shock waves ahead of an elliptic cylinder rotating with a forced-oscillation approach was conducted at Mach 5 by solving the unsteady, two-dimensional Navier–Stokes equations in a non-inertial coordinate system. The hysteresis loops of aerodynamic coefficients were analyzed first, and it was found that the moment is sensitive to rotation. Then, two different hysteresis forms were found at positive and negative angles of rotation (AOR), corresponding to cases with the interference point above or below the wall, respectively. When AOR is positive, the rate-dependent transition hysteresis among various shock interaction types causes the movement of strong flow structures (reflected shock wave, Mach stem, and jet) to always lag behind the body's motion. When AOR is negative, besides the evolution hysteresis of flow structures, two unusual patterns between Edney Types III and VI were observed on different transition paths, which led to very different peak pressures. Also discussed are the driving mechanisms associated with the effect of the subsonic region and the downstream boundary of the interaction zone, as well as the modulating action of the formed virtual Laval flow channel. Additional simulations were performed to study the effect of rotation speed on the transition boundary and the transition structures between Types III and VI.

First report of Watermelon Crinkle Leaf-Associated Virus (WCLaV) -1 and WCLaV-2 infecting straightneck squash in the United States.

Straightneck squash (Cucurbita pepo var. recticollis) is an important cucurbit crop in Florida. In early fall 2022, straightneck squash showing severe virus-like symptoms of yellowing, mild leaf crinkling (Supplementary Figure 1), unusual mosaic patterns and deformation on the surface of the fruit (Supplementary Figure 2), were observed in a ~15-ha straightneck squash field in Northwest FL with a disease incidence of ~ 30%. Based on the distinct symptoms and severity observed, multi-virus infection was hypothesized. Seventeen plants were sampled randomly for testing. Plants tested negative for zucchini yellow mosaic virus, cucumber mosaic virus, and squash mosaic virus, using ImmunoStrips® (Agdia, USA). Total RNA was extracted from 17 squash plants using Quick-RNA Mini Prep (Cat No.11-327, Zymo, USA). A conventional OneTaq® RT-PCR Kit (Cat No. E5310S, NEB, USA) was used to test plants for cucurbit chlorotic yellows virus (CCYV) (Jailani et al., 2021a) and watermelon crinkle leaf-associated virus (WCLaV-1) and WCLaV-2 (Hernandez et al., 2021). Plants were negative for CCYV and 12 out 17 plants were positive for WCLaV-1 and WCLaV-2 (genus Coguvirus, family Phenuiviridae) using specific primers targeting both RNA-dependent RNA polymerase (RdRP) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). In addition, these 12 straightneck squash plants were also positive for watermelon mosaic potyvirus (WMV) based on RT-PCR and sequencing (Jailani et al., 2021b). The partial RdRP sequences for WCLaV-1 (OP389252) and WCLaV-2 (OP389254) shared 99% and 97.6% nt identity with isolates KY781184 and KY781187, respectively from China; the partial MP sequences for WCLaV-1 (OP389253) and WCLaV-2 (OP389255) shared 98.3% and 95.6% nt identity with isolate from Brazil (LC636069) and from China (MW751425), respectively. Additionally, the presence or absence of WCLaV-1 and WCLaV-2 were further confirmed using SYBR® Green-based real-time RT-PCR assay using different specific MP primers for WCLaV-1 (Adeleke et al., 2022), and newly designed specific MP primers for WCLaV-2 (WCLaV-2FP TTTGAACCAACTAAGGCAACATA/WCLaV-2RP-CCAACATCAGACCAGGGATTTA). Both viruses were detected in 12 out of 17 straightneck squash plants validating the conventional RT-PCR results. Co-infection of WCLaV-1 and WCLaV-2 with WMV resulted in more severe symptoms on leaves and fruits. Previously, both viruses were first reported in the USA on watermelon in Texas, (Hernandez et al., 2021), Florida (Hendricks et al., 2021), OK (Gilford and Ali., 2022), GA (Adeleke et al., 2022) and Zucchini in Florida (Iriarte et al., 2023). This is the first report of WCLaV-1 and WCLaV-2 on straightneck squash in the United States. These results indicate that WCLaV-1 and WCLaV-2 either in single or mixed infections are effectively spreading to other cucurbits beyond watermelon in FL. The need to assess mode(s) of transmission of these viruses is becoming more critical to develop best management practices.

Behavioural Response Patterns on the Government Incentives Influencing Compliance Behaviour of Business Zakat among SMEs

Government incentives and compliance behaviour of business zakat have a significant relationship as revealed by a few studies. However, the lack of study focused on respondents' response on the government incentives in influencing compliance behaviour of business zakat. Hence, this article examines the usage of Rasch Wright map in evaluating the behavioural response patterns on the government incentives and compliance behaviour of business zakat among SMEs. A total of 276 questionnaires were collected from SMEs entrepreneurs in Selangor. The Rasch Measurement Model was employed to analyze the data. Out of the 276 questionnaires collected, only 247 responses were consistent with the Rasch Measurement Model. Among the respondents, 107 individuals (43.3%) who complied with business zakat payment were influenced by government incentives, while 140 individuals (56.7%) who did not comply with business zakat payment were likely not influenced by government incentives. This study's results highlight the importance of the Rasch Measurement Model in elucidating the response patterns of participants, demonstrating its ability to explain how government incentives impact compliance behavior regarding business zakat among SMEs. This study has illustrated that this method of analysis is expedient in identifying the unusual and inappropriate response patterns and items based on fit statistics and misfit response series compared others. This shows that the Rasch Measurement analysis is an alternative tool to investigate the behavioural response patterns since analyze items and respondents of the study. This study suggests that future research regarding compliance and zakat employ the Rasch Measurement Model analysis as an alternative method to identify ability of respondents and the response behavior patterns among respondents.

Cancer detection in breast cells using a hybrid method based on deep complex neural network and data mining.

Diagnosis of cancer in breast cells is an important and vital issue in the field of medicine. In this context, the use of advanced methods such as deep complex neural networks and data mining can significantly improve the accuracy and speed of diagnosis. A hybrid approach that can be effective in breast cancer diagnosis is the use of deep complex neural networks and data mining. Due to their powerful nonlinear capabilities in extracting complex features from data, deep neural networks have a very good ability to detect patterns related to cancer. By analyzing millions of data related to breast cells and recognizing common and unusual patterns in them, these networks are able to diagnose cancer with high accuracy. Also, the use of data mining method plays an important role in this process. Using data mining algorithms and techniques, useful information can be extracted from the available data and the characteristics of healthy and cancerous cells can be separated. This information can be given as input to the deep neural network to achieve more accurate diagnosis. Another method to diagnose breast cancer is the use of thermography, which we use in this research along with data mining and deep learning. Thermography uses an infrared camera to record the temperature of the target area. This method of breast cancer imaging is less expensive and completely safe compared to other methods. A total of 187 volunteers including 152 healthy people and 35 cancer patients were evaluated. Each person had ten thermographic images, resulting in a total of 1870 thermographic images. Four alternative deep complex neural network models, namely ResNet18, ResNet50, VGG19, and Xception, were used to identify thermal images, including benign and malignant images. The evaluation results showed that the use of a combined method based on deep complex neural network and data mining in the diagnosis of cancer in breast cells can bring a significant improvement in the accuracy and speed of diagnosis of this important disease.

Unreported branching pattern of the triplicated anterior cerebral artery associated with multiple bilateral variants of the superior cerebellar artery detected by computed tomography angiography and 3D modeling.

A 26-year-old patient underwent a successful ablation of Grade 2 diffuse astrocytoma of the right parietal lobe. The postoperative computed tomography angiography with 3D modeling revealed a residual avascular porencephalic cyst. Otherwise, multiple arterial variants have been encountered. First, the left A1 segment was fenestrated, and three A2 segments arose from the anterior communicating artery. The middle A2 segment was dominant and supplied left callosomarginal and both pericallosal territories. The right A2 segment supplied the right callosomarginal territory, while the left A1 was limited to the left orbitofrontal and frontopolar territories. This configuration represents a triplicated anterior cerebral artery with an unusual branching pattern not included in the classification of Baptista. In addition, on both sides, superior cerebellar artery duplication was present, with one arising from the basilar artery and the other from the P1 segment of the ipsilateral posterior cerebral artery. The left lower superior cerebellar artery was early bifurcated. It is the first time such a cerebrovascular configuration has been reported. Because of the several clinical and surgical applications of the anterior cerebral artery and superior cerebellar artery variants, this case report is of utmost interest to anatomists, radiologists, and neurosurgeons.

Second-grade elasticity of three-dimensional pantographic lattices: theory and numerical experiments

A continuum theory of pantographic lattices, based on second-grade elasticity, is presented. The proposed model is able to describe the mechanical behavior of a type of material structure made up of multiple layers of pantographic sheets connected with a third family of fibers. Thus, these materials are characterized by an orthogonal pattern of fibers that can bend, stretch and twist. Numerical experiments illustrate the predictive potential of the model when the material is subjected to different types of mechanical loads, including compression, torsion and two kinds of bending. Analyzing the material responses for these various tests makes it possible to reveal unusual deformation patterns characteristic of such “pantographic blocks.” Numerical simulations using the finite element method are intended to assist in designing an experimental program using 3D-printed specimens made of different materials.

Unusual pattern of leptomeningeal cyst with herniation of porencephalic cyst

BackgroundGrowing skull fracture or leptomeningeal cyst is an uncommon occurrence after severe head trauma in childhood. It is mostly observed in infants and children less than 3 years of age. Another uncommon complication of head trauma is development of porencephalic cyst.Case presentationWe present an unusual case of post-traumatic type III leptomeningeal cyst in a 9-month-old infant with history of head trauma 3 months ago. CT and MR imaging revealed widening of bony defect compared to previous imaging, and herniation of porencephalic cyst through the defect, leading to formation of a large cystic swelling in scalp. The 3 month delay in evaluation of the scalp swelling was due to lack of patient education after trauma, and no subsequent follow-up.ConclusionsKnowledge about etiopathogenesis and risk factors of leptomeningeal cyst development after head trauma ensures that close follow-up is done in such cases for early detection and management of growing skull fracture.

Analysis of the action pattern of sequential α-amylases from B. stearothermophilus and B. amyloliquefaciens on highly concentrated soluble starch

Hydrolysis of highly concentrated soluble starch (60%, w/w) was performed using sequential α-amylases from Bacillus stearothermophilus (T, 0.2%, w/w) and Bacillus amyloliquefaciens (B, 0.1%, w/w) to identify their possible action patterns. We found that T reduced the average molecular weight (Mw) of soluble starch from 52,827 Da to 31,914 Da and significantly affected its branched chain length. Compared with soluble starch, the chains with DP 6–12 and DP ≥ 13 in the T samples were diminished by 46% and 96%, respectively. This resulted in an attenuation in the proportions of exterior and inner chains, as well as low iodine binding capacity of the hydrolysates. In contrast, a slower decrease in the average Mw of soluble starch occurred after TB incubation, and the level of DP 6–12 further lowered, causing a gradual decline in the iodine binding capacity of the hydrolysates. Gathered data revealed an unusual action pattern of sequential α-amylase treatment at high substrate concentrations. Bacillus stearothermophilus α-amylase exhibited more pronounced endo-hydrolysis of amylopectin, whereas the attack of Bacillus amyloliquefaciens α-amylase on the exterior chains was enhanced in amylopectin residues. These findings suggest that the synergy of various α-amylases is an effective strategy to promote the dextrinization of highly concentrated starch and finely modify the molecular structure of starch.

Benign Metastasizing Leiomyoma

Benign metastasizing leiomyoma is a rare condition usually seen in reproductive age women which presented with multiple benign smooth muscle tumors in extra uterine sites, which display unusual growth pattern. In this report, a case of benign metastasizing leiomyoma is discussed.

Investigation of vacuum active brazing of (HfZrTiTaNb)C high-entropy carbide ceramic to Nb with TiZrCuNi filler alloy

Good metallurgical joining was carried out between (HfZrTiTaNb)C high-entropy carbide and Nb via 37.5Ti37.5Zr15Cu10Ni (wt.%) filler alloy. The microstructure of the joint was (HfZrTiTaNb)C/(Zr, Ti)C/α-Ti + β-Ti + (Zr, Ti)2(Cu, Ni)/Zr(s, s) + β(Ti, Nb) + Nb(s, s)/Nb. The generation of (Zr, Ti)C and β(Ti, Nb)+Nb(s, s) phases between the liquid phase and ceramic and Nb were vital to realize the joining. The constituent phases of the joint did not change with the variation of brazing process parameters. When the brazing temperature rose from 920 to 1000 °C, the thickness of the (Zr, Ti)C reaction layer increased by 0.2 μm, while it remained roughly unchanged as the holding time was extended from 1 to 30 min. This unusual interfacial evolution pattern could partially attribute to the unique properties of sluggish diffusion and severe lattice distortion of the high-entropy ceramic. With the increase of brazing process parameters, the shear strength of the joints showed a mountain peak characteristic of increasing and then decreasing, and the maximum value of 154 MPa was obtained at 960 °C for 5 min. The fracture took place in the brittle (Zr, Ti)2(Cu, Ni) phase, and then passed through the (Zr, Ti)C phase and the ceramic substrate.

Functional Data Analysis and Person Response Functions

ABSTRACT The purpose of this study is to illustrate the use of functional data analysis (FDA) as a general methodology for analyzing person response functions (PRFs). Applications of FDA to psychometrics have included the estimation of item response functions and latent distributions, as well as differential item functioning. Although FDA has been suggested for modeling PRFs, there has been relatively little research stressing this application. FDA offers an approach for diagnosing person responses that may be due to guessing and other sources of within-person multidimensionality. PRFs provide graphical displays that can be used to highlight unusual response patterns, and to identify persons that are not responding as expected to a set of test items. In addition to examining individual PRFs, functional clustering techniques can be used to identify subgroups of persons that may be exhibiting categories of misfit such as guessing. A small simulation study is conducted to illustrate how FDA can be used to identify persons exhibiting different levels of guessing behavior (5%, 10%, 15% and 20%). The methodology is also applied to real data from a 3rd grade science assessment used in a southeastern state. FDA offers a promising methodology for evaluating whether or not meaningful scores have been obtained for a person. Typical indices of psychometric quality, such as standard errors of measurement and person fit indices, are not sufficient for representing certain types of aberrance in person response patterns. Nonparametric graphical methods for estimating PRFs that are based FDA provide a rich source of validity evidence regarding the meaning and usefulness of each person’s score.

Impact of Extreme Wind and Freshwater Runoff on the Salinity Patterns of a Mesotidal Coastal Lagoon

The interaction between tide, river runoff, and wind in coastal lagoons induces complex salinity gradients, which are remarkable when the meteorological forcing is exacerbated. This work aims to characterize the salinity structure under extreme freshwater and wind events in the Ria de Aveiro coastal lagoon (Portugal). The Delft3D model was implemented and validated in 3D mode and used to perform simulations forced with extreme freshwater and wind scenarios. Results show that forcing conditions determine salinity stratification intensity and location. Generally, stratification increases as the freshwater increases, while the salinity intrusion moves downstream. Extreme wind tends to destroy stratification but fails to promote full-depth mixing, which is also dependent on the wind direction, as shown for the Espinheiro channel. The salinity intrusion is also impacted by wind events, being NW storms responsible for an upstream salt transport along the Mira channel and a downstream transport along the Espinheiro channel, and SW storms for an upstream displacement of the salinity intrusion along the São Jacinto channel. Finally, it is observed that the advection of a freshwater plume from the Vouga River into the middle of the São Jacinto channel under high freshwater scenarios causes an unusual local salinity pattern. This plume can either be pushed upstream or prevented from entering the channel, depending on the wind direction.

Monitoring pollution pathways in river water by predictive path modelling using untargeted GC-MS measurements

To safeguard the quality of river water, a comprehensive approach is required within the European Water Framework Directive. It is vital to conduct non-target screening of the complete chemical fingerprint of the aquatic ecosystem, as this will help to identify chemicals of emerging concern and uncover their unusual dynamic patterns in river water. Achieving this goal calls for an advanced combination of two measurement paradigms: tracing the potential pollution path through the river network and detecting the numerous compounds that constitute the chemical composition, both known and unknown. To address this challenge, we propose an integrated approach that combines the preprocessing of ongoing Gas Chromatography Mass Spectrometry (GC-MS) measurements at nine sites along the Rhine using PARAllel FActor Analysis2 (PARAFAC2) for non-target screening, with spatiotemporal modelling of these sites within the river network using a statistical path modelling algorithm called Process Partial Least Squares (Process PLS). With an average explained variance of 97.0%, PARAFAC2 extracted mass spectra, elution, and concentration profiles of known and unknown chemicals. On average, 76.8% of the chemical variability captured by the PARAFAC2 concentration profiles was extracted by Process PLS. The integrated approach enabled us to track chemicals through the Rhine catchment, and tentatively identify known and as-yet unknown potential pollutants, including methyl tert-butyl ether and 1,3-cyclopentadiene, based on non-target screening and spatiotemporal behaviour.

How to visualize electricity consumption anomalies: The impact of chart types on triggered emotions and eye movements

Home Energy Management Systems (HEMS) show anomalies and unusual patterns of the electricity consumption of households, usually in the form of charts. Charts that show anomalies are very difficult to design in a way that is both comprehensible and visually appealing to users. However, visually appealing charts direct the users’ gaze to the central chart elements and thus trigger positive emotions, which in turn increase the intention to use HEMS. Therefore, this study focuses on the emotions and eye movements that different chart types showing anomalous electricity consumption trigger. An experimental eye-tracking and facial expression study was carried out with 50 participants that were randomly assigned to one of three commonly used chart types (bar, line or rose chart). The participants had to complete three search tasks during which the eye movements and the facial expressions were observed. The results show that different emotions are triggered depending on the chart type. Participants showed the highest number of sad and contempt facial expressions while viewing bar charts. Line charts triggered the most positive and, overall, the least negative facial expressions, followed by the rose charts. Bar charts triggered the most negative emotions among all three chart types. Although most eye-tracking metrics in this study differed by chart type, most results did not show significant differences. However, the later participants saw the area in demand in the rose charts, the sadder facial expressions occurred. HEMS providers can use these findings to design emotionally appealing charts for potential users, which in turn can increase their motivation to use these systems.

Assessment of thyroid cartilage ossification pattern in cancer patients: A suggestion of active ossification by tumor progression.

Ossified cartilage is much more susceptible to cancer infiltration, but the reason remains unknown, and the relationship between the ossification pattern and cancer infiltration has not been studied. The presence of thyroid cartilage ossification, cancer infiltration, ossification pattern (usual: direction from inferior to superior; unusual: other than the usual pattern), and distance between cancer and ossified cartilage were evaluated in laryngectomy specimens. There were 28 and 27 cases of usual and unusual patterns, respectively. There was no association between ossification pattern and cancer infiltration. However, the distance between the ossified area and cancer cells was greater in the usual pattern than in the unusual pattern (p = 0.006). And the usual pattern was more frequently observed in cases with a distance >1 mm than in cases with cancer infiltration or a distance ≤1 mm (p = 0.004). These results suggest the possibility of an active ossification due to tumor progression.

Diagnosis and Management of Severe Water-Related Skin and Soft Tissue Sepsis: A Summative Review of the Literature.

Skin and soft tissue infections (SSTIs) are common presentations in the emergency department. However, this is less common after contact with contaminated saltwater or freshwater. This review presents the diagnosis and management of water-related soft tissue sepsis in this vulnerable and difficult-to-treat subgroup of necrotizing soft tissue sepsis. A summative literature overview is presented regarding bacterial and fungal SSTI after contact with contaminated water, with practical diagnostic and management aspects. The literature indicates that these wounds and infections remain difficult to treat. An approach using appropriate diagnostic tools with both medical and surgical management strategies is provided. SSTIs due to water contamination of wounds involve unusual organisms with unusual resistance patterns, and require a nuanced and directed diagnostic approach with an adaptation of the usual antibiotic or antifungal selection to achieve a successful cure, along with aggressive debridement and wound care.

Unusual serological profile in hepatitis B virus (HBV) infection associated with a probable clinical case of acute exacerbation of pre-existing chronic HBV infection.

Acute or chronic HBV infection in an individual can be laboratory characterized according to the serological profile of the viral markers in the bloodstream, and the dynamics monitoring of these markers is necessary to assess the disorder course and the infection outcome. However, under certain circumstances unusual or atypical serological profiles may be observed in both acute and chronic HBV infection. They are considered as such because they do not properly characterize the form or infection clinical phase or because they seem inconsistent, considering the viral markers dynamics in both clinical contexts. This manuscript comprises the analysis of an unusual serological profile in HBV infection. This clinical-laboratory study, had as reference a patient who presented clinical profile suggestive of acute HBV infection after recent exposure, whose laboratory data were initially compatible with this clinical presentation. However, the serological profile analysis and its monitoring demonstrated unusual pattern of viral markers expression, which has been observed in several clinical contexts, and is often associated a number of agent- or host-related factors. The serological profile analyzed here, associated with the biochemical markers serum levels found, is indicative of active chronic infection, consequence of viral reactivation. This finding suggests that in the event of unusual serological profiles in HBV infection, if the influence of agent- or host-related factors is not properly considered and neither the viral markers dynamics properly analyzed, there may be mistake in the infection clinical diagnosis, especially when the patient's clinical and epidemiological history is unknown.

Synchronizing ice-core and U ∕ Th timescales in the Last Glacial Maximum using Hulu Cave 14C and new 10Be measurements from Greenland and Antarctica

Abstract. Between 15 and 27 kyr b2k (thousands of years before 2000 CE) during the last glacial, Greenland experienced a prolonged cold stadial phase, interrupted by two short-lived warm interstadials. Greenland ice-core calcium data show two periods, preceding the interstadials, of anomalously high atmospheric dust loading, the origin of which is not well understood. At approximately the same time as the Greenland dust peaks, the Chinese Hulu Cave speleothems exhibit a climatic signal suggested to be a response to Heinrich Event 2, a period of enhanced ice-rafted debris deposition in the North Atlantic. In the climatic signal of Antarctic ice cores, moreover, a relative warming occurs between 23 and 24.5 kyr b2k that is generally interpreted as a counterpart to a cool climate phase in the Northern Hemisphere. Proposed centennial-scale offsets between the polar ice-core timescales and the speleothem timescale hamper the precise reconstruction of the global sequence of these climatic events. Here, we examine two new 10Be datasets from Greenland and Antarctic ice cores to test the agreement between different timescales, by taking advantage of the globally synchronous cosmogenic radionuclide production rates. Evidence of an event similar to the Maunder Solar Minimum is found in the new 10Be datasets, supported by lower-resolution radionuclide data from Greenland and 14C in the Hulu Cave speleothem, representing a good synchronization candidate at around 22 kyr b2k. By matching the respective 10Be data, we determine the offset between the Greenland ice-core chronology, GICC05, and the Antarctic chronology for the West Antarctic Ice Sheet Divide ice core (WDC), WD2014, to be 125 ± 40 years. Furthermore, via radionuclide wiggle-matching, we determine the offset between the Hulu speleothem and ice-core timescales to be 375 years for GICC05 (75–625 years at 68 % confidence) and 225 years for WD2014 (−25–425 years at 68 % confidence). The rather wide uncertainties are intrinsic to the wiggle-matching algorithm and the limitations set by data resolution. The undercounting of annual layers in GICC05 inferred from the offset is hypothesized to have been caused by a combination of underdetected annual layers, especially during periods with low winter precipitation, and misinterpreted unusual patterns in the annual signal during the extremely cold period often referred to as Heinrich Stadial 1.

Lithium fluoroarylsilylamides and their structural features

Abstract In order to probe the role of Li⋯F interactions toward the stabilisation of low-coordinate lithium complexes, the four fluoroarylsilylamides [LiN(SiMe3)(2-C6H4F)] (1-Li), [LiN(SiMe3)(2,6-C6H3F2)] (2-Li), [LiN(SiMe3)(C6F5)] (3-Li), and [LiN(SiMe2H)(2-C6H4F)] (4-Li) have been synthesised in high yields by deprotonation of the parent amines with nBuLi. They have been comprehensively characterised by multinuclear NMR spectroscopy, and complete assignments were achieved with the help of 2D NMR data. The molecular solid-state structures of [(2-Li)2]∞, [3-Li·Et 2 O]2, and [4-Li]8 were determined by single-crystal X-ray diffraction. They feature unusual coordination patterns, notably for the formation of the polymeric [(2-Li)2]∞ and a unique octagonal, crown-like [4-Li]8. In both structures, the role of Li⋯F non-covalent interactions was the key toward the building of the final architecture. It is shown that Li–F and C–F interatomic distances, along with |1 J C,F| coupling constants, can be used as qualitative tools for the evaluation of the presence and relative strength of Li⋯F contacts.