Universal Reverse Primer Research Articles

Abstract 1088: Efficient detection of germ cell cancer related miRNAs in serum using the TaqMan miRNA ABC purification bead kit in combination with the Taqman advanced miRNA assays

Abstract Malignant germ cell tumors, also known as germ cell cancers (GCC), are the most frequent cancer in young Caucasian males, with an increasing incidence during the last decades. They are clinically and histologically subdivided into seminomas and nonseminomas. The last can be composed of different elements, including embryonal carcinoma (the stem cell component), teratoma (TE) (somatic lineage) as well as yolk sac tumor (YST) and choriocarcinoma (CHC) (extra-embryonic lineages). The currently used serum markers, informative for both diagnosis as well as follow-up are AFP and hCG, predominantly indicative for the presence of the YST and CHC components. Recently, we reported that a selected set of miRNAs are highly expressed in all histological elements of GCC, with the exception of TE, including the miR 371-3 cluster. In addition to the presence in the primary cancers, they can also be identified in the serum of patients with such a malignancy, outperforming the classical markers AFP and hCG (Gillis and Rijlaarsdam et al. Molec. Oncol. 2013; Rijlaarsdam et al. Andrology, 2015). Here we demonstrate the power of the TaqMan Advanced miRNA Assays (PN 478007, Applied Biosystems) in combination with the use of the TaqMan miRNA ABC Purification Kit (PN 4473087, Applied Biosystems), starting with 50 μL human serum. The protocol includes polyadenylation of the miRNA targets at the 3’ end, followed by an adapter ligation at the 5’ end. Universal forward and reverse primers are used for amplification, followed by detection using the Applied Biosystems 7500 RealTime PCR System. Quality controls were added using dilution experiments of the cell lines, also included as inter-plate control, as well as for cDNA synthesis and RT-PCR efficiency. The non-human spike-ins ath-miR159a and cel-miR-39-3p were added as exogenous controls, while hsa-miR-30b-5p was used as endogenous control for normalization (reference). In total 30 GCC-related sera as well as 10 normal controls proved the informativity as well as efficiency of the developed pipeline in a standardized laboratory setting. Citation Format: Leendert HJ Looijenga, Ton Van Agthoven, Ad Gillis. Efficient detection of germ cell cancer related miRNAs in serum using the TaqMan miRNA ABC purification bead kit in combination with the Taqman advanced miRNA assays. [abstract]. In: Proceedings of the 107th Annual Meeting of the American Association for Cancer Research; 2016 Apr 16-20; New Orleans, LA. Philadelphia (PA): AACR; Cancer Res 2016;76(14 Suppl):Abstract nr 1088.

High-Content Analysis of CRISPR-Cas9 Gene-Edited Human Embryonic Stem Cells.

SummaryCRISPR-Cas9 gene editing of human cells and tissues holds much promise to advance medicine and biology, but standard editing methods require weeks to months of reagent preparation and selection where much or all of the initial edited samples are destroyed during analysis. ArrayEdit, a simple approach utilizing surface-modified multiwell plates containing one-pot transcribed single-guide RNAs, separates thousands of edited cell populations for automated, live, high-content imaging and analysis. The approach lowers the time and cost of gene editing and produces edited human embryonic stem cells at high efficiencies. Edited genes can be expressed in both pluripotent stem cells and differentiated cells. This preclinical platform adds important capabilities to observe editing and selection in situ within complex structures generated by human cells, ultimately enabling optical and other molecular perturbations in the editing workflow that could refine the specificity and versatility of gene editing.

Comparison of myxobacterial diversity and evaluation of isolation success in two niches: Kiritimati Island and German compost

Myxobacteria harbor an enormous potential for new bioactive secondary metabolites and therefore the isolation of in particular new groups is of great interest. The diversity of myxobacteria present in two ecological habitats, namely sand from Kiritimati Island and German compost, was evaluated by both cultivation‐based and cultivation‐independent methods. Phylogenetic analyses of the strains in comparison with 16S rRNA gene sequences from cultured and uncultured material in GenBank revealed a great potential of undescribed myxobacteria in both sampling sites. Several OTUs (operational taxonomic units) represent unknown taxa and were detected by clone bank analyses, but not by cultivation. Clone bank analyses indicated that the myxobacterial community is predominantly indigenous. The 16S rDNA libraries from the two samples were generated from total community DNA with myxobacterial specific forward and universal reverse primer sets. The clones were partially sequenced. Cultivation was successful for exclusively bacteriolytic, but not for cellulolytic myxobacteria and revealed 42 strains from the genera Corallococcus, Myxococcus, and Polyangium. The genera of Myxococcaceae family were represented by both approaches. But, even in this well studied family, as well as in the suborders Sorangiineae and Nannocystineae, a considerable number of clones were assigned to, if any, uncultivated organisms. Our study shows an overrepresentation of the genera Myxococcus spp. and Corallococcus spp. with standard cultivation methods. However, high deficits are demonstrated in the cultivation success of the myxobacterial diversity detected by exclusively cultivation‐independent approaches. Especially, clades which are exclusively represented by clones are of high interest with regard to the cultivation of new bioactive secondary metabolite producers.

Performing body fluid identification with microRNAs using capillary electrophoresis

MicroRNAs have a potential to be ideal forensic markers due to their small size (∼22nt), high abundance per cell, and sensitive and specific detection. Thousands of microRNAs are present in biological material and they are suitable for body fluid identification (BFID). Their advantageous properties increase the chances of successful analysis from challenged crime scene samples. In addition, it has been demonstrated that informative microRNA expression levels can be obtained from common DNA extracts. Following an earlier pilot project on a single stream process with the integration of microRNA analysis into a DNA profiling multiplex, progress on this line of research is now presented. A panel of 8 microRNAs (hsa-miR-10a, -16a, -135a, -142, -203a, -205, -451a and -1260b) has been identified to allow differentiation between blood, saliva, semen and vaginal material. Here the analysis of the BFID markers using capillary electrophoresis (CE) on ABI’s 3130 genetic analyser is presented. The markers are reverse transcribed using a multiplex stem-loop reverse transcription, followed by PCR with ROX-labelled universal reverse primer for the detection of cDNA.It is shown that – after careful optimization – BFID microRNA analysis using CE has similar discriminatory power as using qPCR in singleplex reactions and is therefore a viable technique for BFID. Multiplexing these markers is a next step that can result in a single test for BFID with the advantageous properties of microRNAs.

CYP2D6 Haplotype Determination Using Long Range Allele-Specific Amplification: Resolution of a Complex Genotype and a Discordant Genotype Involving the CYP2D6*59 Allele

Cytochrome P450 (CYP) 2D6, a major contributor to the metabolism and bioactivation of many clinically used drugs, is encoded by a complex, highly polymorphic gene locus. To aid in the characterization of CYP2D6 allelic variation, we developed allele-specific long-range PCR (ASXL-PCR) to amplify only the allele of interest for further characterization by PCR. This development was achieved utilizing single-nucleotide polymorphisms in the upstream region of CYP2D6 and a universal CYP2D6-specific reverse primer. This approach was assessed and optimized on samples with known genotypes. The application of ASXL-PCR clarified a case with a complex genotype (CYP2D6*2x2/*4N+*4) by amplifying the duplicated gene units separately for subsequent analysis. Furthermore, ASXL-PCR and subsequent sequence analysis also resolved genotype discord in a mother/daughter relationship by revealing the presence of the CYP2D6*59 allelic variant in both individuals. Finally, we demonstrated that the 2939G>A single-nucleotide polymorphism present on CYP2D6*59 interfered with the TaqMan genotype assay that detected 2850C>T, causing false genotype assignments. Assay interference was resolved using an alternative TaqMan genotype assay currently available as a custom-made assay. These examples demonstrate the utility of ASXL-PCR for improved CYP2D6 allele/haplotype characterization. This fast, easy-to-perform method is not limited to CYP2D6 but can be adapted to any gene locus for which polymorphic sites are known.

First Report of Blueberry Mosaic Disease Caused by Blueberry mosaic associated virus in Kentucky.

In 2011, a grower in Casey County, Kentucky, observed persistent yellow, green, and red mosaic patterns on leaves of highbush blueberry plants. Twenty-three randomly-scattered cv. Bluecrop plants out of approximately 1,400 5-year-old plants showed symptoms, with coverage on each plant ranging from 5 to 100%. Asymptomatic canes bloomed normally and produced fruit; affected canes were stunted and did not bloom. These symptoms are generally consistent with those described for blueberry mosaic disease (BMD) (1,3), the casual agent of which is Blueberry mosaic associated virus (BlMaV) (4). All plants were purchased from a local nursery, but their origin was unknown. In 2012, leaves from each of five symptomatic plants were tested by reverse transcription-polymerase chain reaction (RT-PCR) for BlMaV. Total nucleic acid was isolated from the symptomatic leaves, and asymptomatic leaves of randomly selected healthy plants served as negative controls. The CTAB method was used as described (2), and RNA was isolated using lithium chloride. cDNA was synthesized using the SuperScript VILO cDNA synthesis kit (Invitrogen, Carlsbad, CA). Two different primer sets were used for detection of BlMaV; BlMaVCP5'-1F (GGTTGATGGATGCTTACGAA) and BlMaVRNA3-1378R (CTTCACTTACCACATTATACATCTC) to amplify a 1,370-bp portion of RNA3 and RNA2-2F (TTCGATCCCAGCCCTCTCCC) and RNA2-2R (AGGCAAAGGGAAAGAAATTCAGGTGTC) to amplify a 1,281-bp portion of RNA2. All symptomatic samples tested by RT-PCR yielded a fragment for each primer set, and the amplicon sizes were as expected. No fragments were amplified from the negative controls. To further confirm diagnosis, the primer sets noted above were used to re-amplify the same two fragments from each of three of the samples. These fragments were cloned and sequenced on the CEQ8000 (Beckman-Coulter, Brea, CA) using the GenomeLab DTCS Quick Start sequencing kit (Beckman-Coulter) and the universal M13 forward and reverse primers as well as internal primers: BlMaV-CP Int 1F (ACAATTAAGAAGTCCTCGTAT), BlMaV-CP Int 2F (ATGTCCGGATGCTAGTCGCT), and BlMaV RNA2 IntR (GGTGGGGACGGAATAATACAGAG). All sequences were consistent with those now published for BlMaV, with 98% identity at the nucleic acid level for both fragments. In 2013, the grower removed plants with more than 50% symptomatic tissue, and no newly symptomatic plants were observed that year. Sixteen remaining symptomatic plants, as well as 36 asymptomatic plants adjacent to those with symptoms, were sampled and tested by RT-PCR. All symptomatic plants were confirmed to be infected with BlMaV, as well as 30 of the 36 asymptomatic plants. It has been suggested that newly infected plants may take a year to express symptoms (5), which may explain the finding of 30 infected but asymptomatic plants. This is the first report of an association of BIMaV with BMD in Kentucky. These results indicate that BMD can establish in Kentucky blueberry fields.

Epidemiologicl and Genetic Studies of Enterotoxigenic Staphylococcus aureus Isolated from Goat and Human

The objective of the present study was to investigate the epidemiological and genetic relationships of classical enterotoxins of S. aureus in goat's raw milk, meat and food handlers in Toukh city in Qaluobia governorate, Egypt. A total of 100 goat, s raw milk and meat samples (50 of each) were collected from randomly distributed herds in streets for buying milk and in public markets for peddler meat. Hand and nasal swabs were collected from milkers and butchers (30 of ech). All samples were subjected for bacteriological examination for isolation and identification of S. aureus. Isolates were underwent reversed passive latex agglutination technique for detection of enterotoxigenic S. aureus. A multiplex PCR assay could successfully amplify the diagnostic DNA bands of 270bp, 165bp, 69bp and 306bp of genes for staphylococcal enterotoxins A, B, C, and D respectively. PCR was applied on the serologically identified 16 (20.25%) isolates out of 79 S. aureus which isolated from the examined goat's food samples and human handlers by using one universal forward and reverse primers, specific for each individual toxin gene. None of the samples was positive for SEE indicating the zoonotic and genetic relationships.

MiRNA-24 and miRNA-466i-5p controls inflammation in rat hepatocytes.

miRNA-24 and miRNA-466i-5p controls inflammation in rat hepatocytes.

First Report of Pantoea beijingensis Induced Soft Rot Disease of Pleurotus nebrodensis in China.

Pleurotus nebrodensis is a popular edible fungus in China. In December 2009, soft rot disease appeared on fruiting bodies of P. neberodensis in greenhouses located at Haidian District of Beijing, China. Early symptoms were water-soaked lesions on the pilei of the fruiting bodies. Lesions then spread and purulent tissues were formed. Severe soft rot induced production of deformed fruiting bodies and offensive odor. Diseased fruiting bodies stopped growth and commercial losses were estimated at 5 to 10%. Internal sections of the diseased pilei about 0.5 × 0.5 cm were suspended in 0.85% NaCl and the suspension was spread on trypticase soy agar (TSA) media. After incubation at 30°C for 2 days, dominant bacterial colonies were yellow, smooth, round, and convex. Cells were gram-negative, short rods, non-capsulated, motile, and non-spore forming. The 16S rRNA gene (1,408 bp, GenBank Accession No. KF849293) was amplified by using the universal forward primer P1 (5'-AGAGTTTGATCCTGGTCAGAACGCT-3') and the universal reverse primer P6 (5'-TACGGCTACCTTGTTACGACTTCACCCC-3'). Neighbor-joining tree analysis based on 16S rRNA gene sequences demonstrated the isolates belonged to the genus Pantoea and showed highest similarity with Pantoea beijingensis LMG 27579T (99.9% similarity, 2 base pair differences), which was isolated from the diseased fruiting bodies of P. eryngii in China. Pantoea sp. PA4, reported to be the pathogen of soft rot disease of P. eryngii in Korea (1), showed 99.8% similarity with P. ananatis ATCC 33244T, which suggested our isolates belonged to a different species with Pantoea sp. PA4 (supported by 97.9% similarity between the present isolates and Pantoea sp. PA4) (2). Results of physiological properties and enzyme activities determined by the API 20E, API 20NE, API 50CH, API ZYM (bioMérieux), and GN2 MicroPlate (Biolog) system showed that there was no difference between the present isolates and P. beijingensis LMG 27579T. Pathogenicity tests for these isolates were performed with bacterial suspensions (approximately 1 × 106 CFU/ml) that were grown for 24 h in trypticase soy broth (TSB). Fruiting bodies of P. nebrodensis were induced after spawn was run for 30 days in plastic bags. When the young fruiting bodies were forming, the prepared bacterial suspension was sprayed onto the surface of the pilei. Sterilized TSB media was used as a negative control. All inoculated fruiting bodies were then incubated at 16°C with 80 to 95% relative humidity. Assays were conducted twice and five fruiting bodies were used each time. Results were observed after 5 to 10 days of incubation. The symptoms that developed were similar to those observed in the original samples. The negative control remained symptomless. Koch's postulates were fulfilled by re-isolating bacteria, which were identical to the original isolates based on 16S rRNA gene sequence analysis, physiological properties and enzyme activities. Pantoea ananatis was first reported as a pathogen of Pleurotus eryngii, causing soft rot disease (1), but to the best of our knowledge, this is the first report of P. beijingensis- induced soft rot disease of P. nebrodensis in China. This disease may be an emerging disease problem in the near future and information on this pathogen will be useful in the development of management practices.

Colorimetric detection of PCR products of DNA from pathogenic bacterial targets based on a simultaneously amplified DNAzyme

A novel strategy was devised for colorimetric analysis of the products of the polymerase chain reaction (PCR). The method takes advantage of simultaneous amplification of a horseradish peroxidase-mimicking DNAzyme (HRPzyme) during the PCR process. It is performed using a DNA specific forward primer and a universal reverse primer containing a complementary HRPzyme sequence. The double-strand PCR products, which include the HRPzyme sequence, are treated with a mixture of hemin and TMB (3,3′,5,5′–tetramethylbenzidine) in the presence of hydrogen peroxide. The resulting HRPzyme/hemin complex then promotes a peroxidase mimicking reaction, which produces the blue colored oxidized TMB. This colorimetric method can be more easily performed than previously developed gel based detection procedures and, as a result, can be conveniently applied to the specific and sensitive colorimetric analysis of DNA sequences arising from pathogenic bacteria. The potentially broad applicability of the new method has been demonstrated by its use in the identification of the 16s rDNA of Salmonella Typhimurium.

Application of the ASLP technology to a novel platform for rapid and noise-free multiplexed SNP genotyping

A novel multiplexing method, which relies on universal amplification of separated ligation-dependent probes (ASLP), has been developed to genotype single-nucleotide polymorphisms (SNPs). The ASLP technique employs two allele-specific oligonucleotides (ASO), modified with universal forward primer sequences at the 5′-end and a common locus-specific oligonucleotide (LSO) extended with a universal separation (US) sequence at the 3′-end. In the process, allele-specific ligation first takes place when target genomic DNA is hybridized by perfectly matching the ASO together with the LSO. A separation probe, which consists of a universal reverse primer sequence labeled with biotin at the 5′-end and complementary sequence of US at the 3′-end, is then applied to the resulting ligation product. During the extension reaction of the separation probe, the ligated probes dissociate from target genomic DNA in the form of a double-stranded DNA and are separated from the reaction mixture, which includes genomic DNA and unligated probes, by simply using streptavidin-coated magnetic beads. PCR amplification of the separated ligation products is then carried out by using universal primers and the PCR products are hybridized on a DNA microarray using the RecA protein. The advantageous features of the new method were demonstrated by using it to genotype 15 SNP markers for cultivar identification of pepper in a convenient and correct manner.

Aberrant Expression Of miRNA and mRNA Of Cell Cycle and Adhesion-Related Genes In Bone Marrow Stroma Cells Derived From Patients With Multiple Myeloma

Multiple myeloma (MM) is a B-cell malignancy characterized by accumulation of malignant plasma cells (PC) within the bone marrow. The bone marrow microenvironment such as bone marrow stroma cells (BMSC) supports MM disease progression, resistance to chemotherapy, protects the tumor cells against apoptosis and causes osteolytic bone disease and angiogenesis.The aim of this study was to identify constitutive genetic alterations in BMSC derived from patients with MM (MM-BMSC) in comparison to BMSC from healthy donors. For BMSC selection, mononuclear cells were isolated from fresh bone marrow aspirates and were further expanded in cell culture. We studied 25 MM patients and 5 healthy donors. Senescence status was determined in passage 1 of cell cultures. MM-BSMC displayed a considerably higher percentage of senescence cells (p<0,05). We investigated the expression of cell cycle and adhesion-associated genes (CCNE1, CCND1, CDKN1B, VCAM, ICAM, IKK-alpha) in BMSC (passage 4) using SYBR-Green Real-Time PCR and relative quantification by linear regression.A downregulation of CCNE1 (p=0,05), CDKN1B (p=0,29), and an upregulation of CCND1 (p=0,05), VCAM-1 (p=0,33), ICAM-1 (p=0,33), and IKK-alpha (p=0,05) was demonstrated. Furthermore, the expression profile of miRNAs, targeting the analyzed mRNA genes or correlating with senescence, was studied (miR-16, miR-221, miR-126, miR-223, miR-485-5p and miR-519d). For miRNA detection treatment with Poly(A)-Polymerase and cDNA-Synthesis with a Poly(T)VN-Adaptor primer were carried out following an amplification with an universal reverse primer corresponding to the adaptor sequence and a miRNA-specific primer. miR-16, miR-223, miR-485-5p and miR-519d were significantly upregulated, (p=0,02; p=0,004; p=0,02; and p=0,002, respectively), whereas miR-221 and miR-126 showed no considerable differences to BMSC obtained from healthy donors. Next we investigated incubation of immunmodulatory drug Lenalidomid in BMSC cultures. Cells were treated with 10 µM Lenalidomid over 72 hours and expression was normalized to a 0,01 % DMSO control. Significant difference in gene expression were visible for ICAM-1 (p=0,01). For CDKN1B (p=0,16) and VCAM-1 (p=0,12) we demonstrated changes in gene expression.Our results indicate aberrant expression of cell cycle and adhesion-related genes, such as CCNE1, CCND1 and CDKN1B VCAM-1, ICAM-1 and IKK-alpha in MM-BMSC as compared with healthy donors. Furthermore, we found significant upregulation of miR-16, miR-223, miR-485-5p and miR-519d. Further investigation are needed to determine molecular mechanisms in MM-BMSC and PC interaction that lead to constitutive changes in BMSC characteristics and gene expression patterns. Disclosures:No relevant conflicts of interest to declare.

Molecular identification of pathogenic bacteria and PCR specific primer design

Management of healthy seaweed aquaculture and control of ice ice disease are important component in seaweed production. To support the integrated prevention of ice ice disease, information about genetic variation of bacterial pathogen and the availability of fast and accurate detection are required. This study aimed to identify bacterial pathogen based on gene sequence analysis 16S-rRNA, construction of specific PCR primer from gene sequent analysis 16S-rRNA from bacteria that had the highest pathogenicity. Gene 16S rRNA of bacteria that had the highest pathogenicity was amplificated with universal primer PCR domain forward primer 63f (5’-CAG GCC TAA CAC ATG CAA GTC-3’) and reverse primer 1387r (5’-GGG CGG WGT GTA CAA GGC-3’). DNA Sequence obtained was compared to data base European Bioinformatics Institute (EBI) BLASTN. Construction and feasibility analysis of primer pair was done using primer 3 program. Two specific primer PCR were successfully constructed namely aSEFM-F (5- CAGCCACACTGGAACTGAGA-3) and aSEFM-R(5 TTAGCCGGTGCTTCTTCTGT -3). Both primer reacted optimum at 60°C and produced 201 bp amplicon. Keywords: pathogenicity, gene 16S-rRNA, PCR, primer, specific

First Report of a Novel Potyvirus from Florida Causing Chlorotic Mottling in Squash (Cucurbita pepo).

During the 2010 to 2011 growing seasons, nine cucurbit leaf samples including cantaloupe, cucumber, pumpkin, squash, and watermelon, showing mosaic and mottling, were collected from fields in the Homestead and Tampa areas in Florida (1). Eight of the nine samples were positive by dot-immunobinding assay (DIBA) and reverse transcription (RT)-PCR for either Watermelon mosaic virus (WMV), Papaya ringspot virus (PRSV-W), or mixed infection of both viruses. One squash sample from the Homestead area showing unique symptoms including chlorotic spots, yellowing, mottling, vein clearing, and mild mosaic was negative by RT-PCR against PRSV-W, Squash vein yellowing virus (SqVYV), WMV, and Zucchini yellow mosaic virus (ZYMV).The presence of virus-like particles (VLP) from symptomatic squash leaves (1) was prepared as described previously (2). Typical potyvirus-like particles ~700 nm long and 12 to 14 nm wide were observed by electron microscope from VLP preparations. Analysis of VLP on SDS-PAGE demonstrated a slightly larger coat protein (CP) (37 kDa compared with PRSV-W [35 kDa]). Sap from symptomatic squash leaf samples or VLP was mechanically inoculated to 10 squash seedlings at cotyledon stage using 0.1 M K2HPO4 buffer. Chlorotic spots were observed on the first true leaf 7 days post inoculation. However, symptoms became more severe by 2 to 3 weeks post inoculation and systemically infected leaves showed chlorosis and mottling similar to the original symptoms when tissues were collected from the field. Mock-inoculated control squash seedlings did not produce any symptoms. Symptomatic leaves from mechanically infected squash plants were used for VLP preparations and virus particles and size of the CP on SDS-PAGE was observed as before. Total RNA was extracted from VLP (2) and tested by RT-PCR using universal Potyviridae primers (forward primer 5'-CACGGATCCCGGG (T)17AGC and reverse primer 5'-GGBAAYAAYAGYGGDCARCC (3) to amplify a fragment from the 3' end of the genome (including part of NIb gene, whole CP). A band of 1.2 kb was observed when the PCR product was analyzed on 1% agarose gel. PCR product was purified using QIAquick PCR Purification Kit (QIAGEN, USA), cloned (pGEM-T Easy Vector, Promega, USA), and sequenced in both directions. Consensus sequence was obtained from at least five clones and submitted to GenBank (KC522968). A BLASTn comparing the sequence from the squash potyvirus to others in GenBank found the highest similarity was 72.0% at nucleotide level and 64.8% at amino acid level with PRSV-W (JN831646), and less than 70% nucleotide similarity with WMV (NC_006262) and SqVYV (NC_010521). Based on the particle morphology, CP size on SDS-PAGE, nucleotide identity with other cucurbit potyviruses, and unique symptoms, it is concluded that this could be a new potyvirus. The threshold for classifying distinct species in Potyviridae is less than 76% identity at nucleotide level for either CP gene or the whole genome (4). This virus has been tentatively named as Squash chlorosis mottling virus (SqCMV). Florida is one of the leading states in acreage and production of cucurbits in the United States. The emergence of this new virus could be a potential future threat to cucurbits production.

The Use of Pyrosequencing to Analyze Microbial Populations in Poultry Management to Minimize Downstream Food Contamination

The use of antibiotics in animals grown for human consumption has been banned in many parts of the world and is becoming less favorable in the US. With less or no antibiotics fed, the risk of microbial contamination of food is higher when processed. In the current study, the objective was to identify and compare the effect of both ceca and litter microbial communities present before and after treatment. The treatments consisted of 1) challenging newborn chicks at 3 days and then again at 38 days with either Salmonella enteritidis or Campylobacter jejuni or no bacteria in the presence of or without probiotics added to the feed and 2) windrow composting or no composting of litter as part of poultry house management. Aseptically ceca and litter samples were collected and stored at 4°C until processed. Bacterial genomic DNA was isolated from both sets of samples using either the Promega SV Wizard Genomic DNA Purification kit (Ceca) or Zymo‐spin soil microbe DNA midiprep kit (litter). The DNA from each sample was then amplified using 16s universal forward and reverse primers containing the specific Roche defined library‐L specific sequences as well as Multiplex Identifiers (MID) to allow for automated software identification of the samples after pooling, multiplexing and sequencing. We report the bioinformatic pipeline and the microbial distributions at the genus and species level for each treatment.. Pyrosequencing can be used to obtain valid comparisons between effects of various treatments on pathogenic versus beneficial bacteria in growth and management of animals used for human consumption.Funding: Office of Research and Sponsored Projects, Stephen F. Austin State University; Ed and Gwen Cole, Nacogdoches, TX.

Development of a robust, low cost stem-loop real-time quantification PCR technique for miRNA expression analysis

Development of a rapid and accurate quantification method for the detection of microRNAs (miRNAs) has been desired, in particular, when they are differently expressed in normal and pathological conditions. However, various methods for the quantification of small non-coding RNAs as well as miRNAs have been described. These methods mainly include hybridization-based approaches such as primer extension, northern blotting, microarray profiling, and reverse transcription (RT) PCR. Here, we developed a simple and rapid method based on stem-loop primer-based real-time PCR assay for sensitive and accurate detection of mature miRNAs. Initially, a miRNA-specific stem-loop RT primer is used for RT, which is followed by TaqMan real-time PCR assay using specific forward primer in combination with universal reverse primer and TaqMan probe. The assay has shown high sensitivity (≤50 copies/reaction) for miRNA detection in two breast cancer cell lines, MCF-7 and MDA-MB-231. This assay might be implicated as a rapid and cost effective method for the detection of small non-coding RNAs.

Mitochondrial DNA Markers for PCR-Based Phylogenetic Analysis of Ark Shells

Arcidae species are commercially important bivalves in Japan and are commonly referred to as bloody ark due to their red blood. They have thick shells with distinct radiating ribs, and the numbers of these ribs are important morphological features for species discrimination. However, some Arcidae species are morphologically indistinguishable, with a similar number of the ribs in adults and deficient rib formation, particularly among juveniles. Thus, we developed a reliable molecular marker to genetically discriminate between 7 Arcidae species belonging to Scapharca, Anadara, and Tegillarca based on species-specific polymorphic segments of mitochondrial DNA. PCR amplification of partial COI, 16S rRNA, 12S rRNA, and Cyt b genes was performed on 7 species using 8 primer sets. Only the set of Scapharca-specific forward primer and universal reverse primer for the partial COI gene successfully yielded single PCR products from all 7 species examined. Thus, nucleotide sequences of 481 bp portion of these PCR products were determined, and the degrees of nucleotide substitutions ranged from 0.4% between S. broughtonii and T. granosa to 20.2% between S. satowi and A. antiquata. In addition, a phylogenetic tree showed significant differences between 7 species, with higher bootstrap support than 69.

A Novel Real-Time PCR Assay of microRNAs Using S-Poly(T), a Specific Oligo(dT) Reverse Transcription Primer with Excellent Sensitivity and Specificity

BackgroundMicroRNAs (miRNAs) are small, non-coding RNAs capable of postranscriptionally regulating gene expression. Accurate expression profiling is crucial for understanding the biological roles of miRNAs, and exploring them as biomarkers of diseases.Methodology/Principal FindingsA novel, highly sensitive, and reliable miRNA quantification approach,termed S-Poly(T) miRNA assay, is designed. In this assay, miRNAs are subjected to polyadenylation and reverse transcription with a S-Poly(T) primer that contains a universal reverse primer, a universal Taqman probe, an oligo(dT)11 sequence and six miRNA-specific bases. Individual miRNAs are then amplified by a specific forward primer and a universal reverse primer, and the PCR products are detected by a universal Taqman probe. The S-Poly(T) assay showed a minimum of 4-fold increase in sensitivity as compared with the stem-loop or poly(A)-based methods. A remarkable specificity in discriminating among miRNAs with high sequence similarity was also obtained with this approach. Using this method, we profiled miRNAs in human pulmonary arterial smooth muscle cells (HPASMC) and identified 9 differentially expressed miRNAs associated with hypoxia treatment. Due to its outstanding sensitivity, the number of circulating miRNAs from normal human serum was significantly expanded from 368 to 518.Conclusions/SignificanceWith excellent sensitivity, specificity, and high-throughput, the S-Poly(T) method provides a powerful tool for miRNAs quantification and identification of tissue- or disease-specific miRNA biomarkers.

Identification and Prevalence of Botrytis spp. from Blackberry and Strawberry Fields of the Carolinas.

Gray mold disease of blackberry and strawberry is caused by Botrytis cinerea and B. caroliniana in the southeastern United States. In this study, methods to distinguish both species were established and their prevalence was determined in commercial blackberry and strawberry fields. Using DNA from B. cinerea and B. caroliniana reference strains, a species-differentiating polymerase chain reaction (PCR) amplification was developed that amplified G3PDH gene fragments of two different sizes depending on the species. The PCR is performed with three primers (two species-differentiating forward primers and one universal reverse primer) and amplified a 238-bp product from B. cinerea and a 536-bp fragment from B. caroliniana reference isolates. A total of 400 Botrytis isolates were collected from 6 commercial blackberry and 11 strawberry fields of the Carolinas and identified to the species level by the new PCR method. Both Botrytis spp. were identified in blackberry and strawberry fields, but B. caroliniana was less common than B. cinerea. Only 33 of 202 isolates from blackberry fields were identified as B. caroliniana, and the majority of these isolates came from two fields in South Carolina. Only 1 of 198 isolates from strawberries was identified as B. caroliniana, and this isolate was found in central North Carolina. B. cinerea but not B. caroliniana isolates sporulated on potato dextrose agar and Kings medium B. Our results show that B. cinerea and B. caroliniana coexist in at least some commercial blackberry and strawberry fields of the Carolinas, with B. cinerea being the more prevalent species.

Molecular diversity analysis of planctomycete-like bacteria in inosine fermentation and municipal wastewater treatment systems

In this study, the diversity of planctomycete-like bacteria in an inosine fermentation and amunicipal wastewater treatment plants was investigated by denaturing gradient gel electrophoresis (DGGE) of nested polymerase chain reaction (nested PCR) amplified 16S rRNA gene fragments using planctomycete-specific forward primer and a bacteria universal reverse primer. The bacterial community structures in the two wastewater treatment systems were obviously different due to the different treatment processes and different wastewater characteristics. The highest similarity of the microbial community structure happened in the two samples from the acidification and the anaerobic tank in inosine fermentation plant reaching 67%. While the two samples from the anaerobic and the aerobic tank of municipal wastewater treatment plant reached 66%. Ten sequences were recovered from the DGGE gel and were assigned to Clostridia, Proteobacteria, Bacteroidete and Candidate division based on the phylogenetic analysis. The two sequences grouped into Candidate division had more than 92% similarities with the Planctomycete-like bacterial clones. However, no anaerobic ammonium oxidation (anammox) activities were detected in the samples of these two wastewater treatment plants. Key words: Planctomycete-like bacteria, wastewater treatment, denaturing gradient gel electrophoresis (DGGE).