Universal Reverse Primer Research Articles

A multi-AS-PCR-coupled CRISPR/Cas12a assay for the detection of ten single-base mutations

Single-nucleotide polymorphism (SNP) detection is critical for diagnosing diseases, and the development of rapid and accurate diagnostic tools is essential for treatment and prevention. Allele-specific polymerase chain reaction (AS-PCR) is widely used for detecting SNPs with multiplexing capabilities, while CRISPR-based technologies provide high sensitivity and specificity in targeting mutation sites through specific guide RNAs (gRNAs).In this study, we have integrated the high sensitivity and specificity of CRISPR technology with the multiplexing capabilities of AS-PCR, achieving the simultaneous detection of ten single-base mutations. As for Multi-AS-PCR, our research identified that competitive inhibition of primers targeting the same loci, coupled with divergent amplification efficiencies of these primers, could result in diminished amplification efficiency. Consequently, we adjusted and optimized primer combinations and ratios to enhance the amplification efficacy of Multi-AS-PCR. Finally, we successfully developed a novel nested Multi-AS-PCR-Cas12a method for multiplex SNPs detection. To evaluate the clinical utility of this method in a real-world setting, we applied it to diagnose rifampicin-resistant tuberculosis (TB). The limit of detection (LoD) for the nested Multi-AS-PCR-Cas12a was 102 aM, achieving sensitivity, specificity, positive predictive value, and negative predictive value of 100 %, 93.33 %, 90.00 %, and 100 %, respectively, compared to sequencing.In summary, by employing an innovative design that incorporates a universal reverse primer alongside ten distinct forward allele-specific primers, the nested Multi-AS-PCR-Cas12a technique facilitates the parallel detection of ten rpoB gene SNPs. This method also holds broad potential for the detection of drug-resistant gene mutations in infectious diseases and tumors, as well as for the screening of specific genetic disorders.

Development and evaluation of a high-sensitivity RT-PCR lateral flow assay for early detection of HIV-1 infection

Early diagnosis of HIV-1 is crucial to minimize transmission, morbidity, and mortality, particularly for neonates with developing immune systems. This study aimed to develop and evaluate a simplified, high-sensitivity assay for early HIV-1 detection before seroconversion. The assay utilizes reverse-transcription-polymerase chain reaction (RT-PCR) to amplify the HIV-1 RNA protease gene. Digoxigenin (dig)-labeled forward, and biotin-labeled universal reverse primers are used, generating digoxigenin-amplicon-biotin (DAB) products. These products are detected using a lateral flow assay (LFA) containing a conjugated pad with colloidal gold-labeled 6-histidine tag-fused maltose-binding protein-monomeric streptavidin (6HISMBP-mSA-CGC). Anti-dig monoclonal antibody (mAb) and biotinylated-BSA are immobilized in the test and control line zones, respectively. Five plasma samples with known viral load (VL) were used to simulate the efficacy of early HIV-1 detection. RNA extracted from these samples was amplified by RT-PCR using the labeled primers, and DAB products were examined on agarose gel electrophoresis and LFA. RT-PCR from diluted clinical samples yielded visible DNA bands in agarose gel electrophoresis, consistent with positive LFA results. Conversely, negative samples only displayed the control line on LFA. This assay exhibited a limit of detection (LOD) of 82.29 RNA copies/mL, comparable to other nucleic acid amplification tests (NAATs). This novel technique provides a highly sensitive assay for early HIV-1 diagnosis, even with low VL, making it suitable for resource-limited settings.

Development of rapid and cost-effective multiplex PCR assays to differentiate catfish of the genus Brachyplatystoma (Pimelodidae-Siluriformes) sold in Brazil.

The catfishes Brachyplatystoma filamentosum (Kumakuma), Brachyplatystoma vaillantii (Laulao catfish), and Brachyplatystoma rousseauxii (gilded catfish) are important fishery resources in Brazil, where they are sold both fresh and in the form of fillets or steaks. These species have morphological similarities, thus, they can be easily misidentified or substituted, especially after processed. Therefore, accurate, sensitive, and reliable methods are needed for the identification of these species to avoid commercial fraud. In the present study, we develop two multiplex PCR assays for the identification of the three catfish species. Each multiplex protocol combined three species-specific forward primers and a universal reverse primer to produce banding patterns able to discriminate the target species unequivocally. The length of the cytochrome C oxidase subunit I (COI) fragments was approximately 254 bp for B. rousseauxii, 405 bp for B. vaillantii, and 466 bp for B. filamentosum, while the control region (CR) assay produced fragments of approximately 290 bp for B. filamentosum, 451 bp for B. vaillantii, and 580 bp for B. rousseauxii. The protocols were sensitive enough to detect the target species at a DNA concentration of 1 ng/µL, with the exception of the CR of B. vaillantii, in which the fragment was only detectable at 10 ng/µL. Therefore, the multiplex assays developed in the present study were sensitive, accurate, efficient, rapid, and cost-effective for the unequivocal identification of the target species of Brachyplatystoma. They can be utilized by fish processing industries to certify their products, or by government agencies to authenticate products and prevent fraudulent commercial substitutions.

Fast genotyping of K-RAS codons 12 and 13 based on streptavidin magnetic microbeads equipped with biotin-coupled single base-pair mismatch PCR (SM-PCR)

In this study, a single base-pair mismatch polymerase chain reaction (SM-PCR) combined with streptavidin magnetic microbeads (MB) for genotyping of codons 12 and 13 of K-RAS gene was established. It was performed by adding three primers including codon 12 forward single-base mismatch primer, codon 13 forward single-base mismatch primer and one universal reverse primer to differentiate single nucleotide polymorphisms. The both forward primers were designed to carry a single-base mismatch nucleotide to either codons 12 and 13. This design was included to increase the primer specificity and to enhance the discrimination power of the point mutation. Two restriction enzymes (StyD4I and HaeIII) were available for double digestion of codons 12 and 13 at the single tube. The wild type of codon 12 and 13 was digested, but the mutant type was not. And then, using the magnetic microbeads for purifying. Finally, wild type of codon 12 and 13 have different emission wavelength, but mutant type did not due to no digestion. This method showed a good consistency between genotyping results and direct sequencing results. The SM-PCR combined with MB method was feasible and efficient for screening of K-RAS codons 12 and 13 in populations.

Blood Meal Analysis and Molecular Detection of Leishmania DNA in Wild-Caught Sand Flies in Leishmaniasis Endemic Areas of Turkey and Northern Cyprus.

Phlebotomine sand flies (Diptera: Psychodidae) are known as the vector of diseases such as leishmaniasis, bartonellosis and viral diseases. The aim of this study is to detect the host feeding pattern of sand flies in the endemic areas for leishmaniasis in Turkey (Antalya, Kayseri) and Northern Cyprus (TRNC) as well as the presence of Leishmania DNA in the specimens. One-hundred seventy-six blood-fed sand fly specimens were examined for blood meal analysis. A SYBR Green-PCR assay was performed with specific forward primers for each host and a universal reverse primer. Primers of human and goat were used together in multiplex PCR while goat and cow were studied separately. ITS-1 qPCR assay was also performed on both blood-fed and non-blood-fed females to detect Leishmania parasites. Blood sources could be detected in 69 out of 176 blood-fed sand fly specimens. The results of blood meal analysis showed that specimens were fed mostly on cows (22.2%) followed by humans (5.7%), goats (2.8%) and dogs (0.6%). Multiple feeding patterns were also detected as human + cow (3.4%), cow + goat (2.8%) and human + goat (1.7%). Five of the blood-fed specimens were Leishmania spp. positive: P. major s.l. (n = 1), P. tobbi (n = 2) were L. tropica positive from Antalya, P. simici was positive for L. infantum from Kayseri and P. papatasi (n = 1) was positive for L. major from Cyprus. Leishmania infection rates were determined as 3.79%, 1.69% and 2.63% among the blood-fed sand fly specimens in Antalya, Kayseri and TRNC, respectively. The SYBR-Green-based multiplex PCR assay is a cost-effective and promising tool for blood meal identification of wild-caught sand flies as well as other blood-sucking arthropods. Feeding patterns of important vector species detected in the present study show the high risk in these endemic areas. As a next step, to identify the blood source in a shorter time and to make the test more sensitive, development of this assay to probe-based and multiplex PCR will be also planned.

GRAPHENE OXIDE AFFECT THE EXPRESSION OF PROLIFERATION RELATED GENES AND microRNA IN NORMAL HUMAN ASTROCYTES

Aim. In this study we investigate the impact of low doses of graphene oxide on the expression of key regulatory genes which control cell proliferation as well as microRNAs in normal human astrocytes. Methods. The expression level of genes related to cell proliferation was studied by real-time qPCR in normal human astrocytes line NHA/TS (Cambrex Bio Science, Walkersville, MD, USA) using SYBRGreen Mix and specific for each mRNA forward and reverse primers. These astrocytes were treated with graphene oxide (1 and 4 ng/ml of medium) for 24 hrs. Graphene oxide (2 mg/ml, dispersion in water) was received from Sigma-Aldrich Chemie GmbH, Germany. Total RNA was extracted using TRIZOL reagent. For reverse transcription of mRNAs we used Thermo Scientific Verso cDNA Synthesis Kit (Germany). The values of mRNA expressions were normalized to the level of ACTB mRNA and represented as percent of control (100 %). For polyadenylation and reverse transcription of miRNAs we used Mir-X miRNA First-Strand Synthesis Kit (Takara, Japan). The expression level of microRNAs was studied by real-time qPCR using SYBRGreen Mix and specific for each miRNA forward primers and universal reverse primer. For normalization of microRNA expressions the level of U6 RNA expression was used. Results. It was shown that the expression level of TOB1, HSPA5, EDEM1, MYBL1, and MYBL2 significantly increased in normal human astrocytes line NHA/TS, which were treated with graphene oxide (1 and 4 ng/ml of medium) for 24 hrs. Up-regulation of these genes expression was dose-dependent: bigger dose of graphene oxide (4 ng/ml of medium) introduced more significant changes in the expression of all these genes. Furthermore, bioinformatics analysis of 3′-untranslated regions of mRNA allowed identifying binding sites of microRNA: miR-19a for MYBL1, miR-143 for MYBL2 and miR-182 for TOB1. It was also shown that the expression of all these microRNA significantly down-regulated by graphene oxide, supporting the idea of both post-transcriptional and transcriptional regulation of MYBL1, MYBL2 and TOB1 gene expressions. Conclusions. Graphene oxide significantly disturbs genome stability by up-regulation of the expression of key regulatory genes and down-regulation of microRNA.

First report of 'Candidatus Liberibacter solanacearum' on carrot in Serbia.

At the beginning of July 2020, three-month-old carrot plants (Daucus carota L. variety Maestro F1) grown in a commercial field 1.2 ha in size at the Begeč locality (45°14'30.38" N 19°36'44.82" E) in southern part of the Bačka region, Vojvodina, Serbia, exhibited symptoms of yellowing and reddish leaf discoloration. At the end of July, leaves on the infected plants became bronze and purplish, while their shoots and roots were stunted due to dehydration, with pronounced proliferation. In some cases, the damage was so extensive that it led to plant decay. The disease incidence of 0.5-1% recorded early in July rapidly escalated, reaching 10-15% in the first ten days of August. The observed symptoms resembled those caused by 'Candidatus Liberibacter solanacearum' (CaLso), a phloem-limited proteobacterium (1). To detect and identify CaLso, 15 symptomatic diseased and 5 asymptomatic healthy carrot plants were subjected to conventional polymerase chain reactions (PCR) using two primer sets specific to CaLso, and positive PCR products were further sequenced using commercial facilities (Macrogen Europe). Total DNA was extracted from petiole and root tissues using a commercial kit (Qiagen DNEasy Plant Mini Kit) following the manufacturer-recommended protocol. In the first PCR, using the Lso TX 16/23 F/R primer pair that targets the 16S-23S rRNA IGS region specific to CaLso (2), all 15 diseased samples yielded a band of 383 bp size. After sequencing, 100% homology was noted among tested isolates; therefore, one isolate coded as 1842/20 was chosen as representative and was deposited in NCBI GenBank under Accession number MT948144. BLAST analysis showed 99.70% identity of Serbian carrot isolates with those of the CaLso isolate 80022 originating from celery seed in Slovenia or Italy (Acc. no. KY619977) (3), as well as 99.41% identity with isolate GBBC_Clso_03 from carrot in Belgium (Acc. no. MH734515) and 98.22% identity with the sequence of the CaLso reference strain NZ082226 (Acc. no. EU834130) isolated from tomato in New Zealand (4). In the second PCR, species-specific forward primer LsoF empirically designed at the signature region of the 16S rRNA sequence of CaLso (5) in combination with the universal liberibacter reverse primer OI2c (6) yielded a target of 1163 bp size in all 15 diseased symptomatic carrot samples. Representative isolate 1842/20 was deposited in NCBI GenBank under Acc. no. MW187524. Based on the nucleotide BLAST analysis, the sequence of Serbian carrot isolate showed 100% identity with CaLso strains 16-004 and 16-011 originating from carrot in Finland (Acc. no. MG701014 and MG701015, respectively) and 99.64% identity with CaLso reference strain NZ082226 (Acc. no. EU834130). Five healthy asymptomatic carrot plant samples were negative for the presence of CaLso in both PCR tests employed in this work. To our knowledge, this is the first report of CaLso causing the disease in carrot in Serbia. These results suggest a wider distribution of this pathogen than previously reported in Europe. In 2014, Psyllid Bactericera trigonica (Hemiptera, Triozidae) was described for the first time as a potential vector for CaLso transmission in few localities, including Begeč (7). Considering that its vectors are presently unidentified, certain aspects of CaLso genomics, diversity, epidemiology and vector dynamics will be studied further in future investigations.

P0069MICRO RNA 155, 210, 494, 29B AND 34A EXPRESSION PROFILE IN PREECLAMPSIA AND NORMAL PREGNANCIES

Abstract Background and Aims Preeclampsia (PE) is a complex disorder that is characterized by hypertension and proteinuria after the 20th week of pregnancy, and it causes most neonatal morbidity and perinatal mortality. Despite many efforts, the knowledge acquired regarding its pathogenesis and pathophysiology does not allow us to treat it efficiently. It is not possible to arrest its progressive nature, and the available therapies are limited to symptomatic treatment. MicroRNAs (miRNAs) are small non-coding RNAs of approximately 19–23 nucleotides that can bind to the 3’ untranslated region of target mRNAs resulting in the degradation and translation inhibition of the mRNA, thereby regulating gene expression at the post-transcriptional level. Many studies have confirmed deregulated miRNA in pregnant patients with PE, and the function and mechanism of these differentially expressed miRNA are gradually being revealed. Method Sample collection Among the patients in the maternity ward, Department of Obstetrics and Gynecology. pregnant women who carried fetuses from 26 to 40 weeks of gestation were selected for study. Plasma samples were obtained from a total of 90 women in two groups; 48 being preeclamptic and 42 being healthy pregnancies, forming the control group. None of these subjects had undergone an invasive procedure. A volume of 5 mL maternal venous blood was drawn and collected in an ethylenediamine tetraacetic acid (EDTA) tube. The blood samples were centrifuged initially at 1200 g for 10 min and a second time at 10,000 g for 10 min, and 500 mL from the supernatant layer were used. The supernatant layer of the plasma was taken to Department of Molecular Biology and Genetics, Molecular Diagnosis Laboratory for storage at -80°C until the time of study. Total RNA extraction Total RNA was isolated from plasma using Trizol (Invitrogen, Carlsbad, CA) following the manufacturer protocol. Total RNA was analyzed using the commercially available Bioanalyzer Agilent RNA 6000 picoassay. MicroRNA isolation from maternal plasma MicroRNAs were obtained with the High-Specificity miRNA QRT-PCR detection kit (Stratagene-an Agilent Technologies Company, USA-Canada) according to manufacturer recommendations. Micro RNAs were subjected to a polyadenylation reaction as previously described. Next, using an oligo dT primer harboring a consensus sequence, reverse transcription was performed using an Affinity Script RT/RNase Block Enzyme mixture (Stratagene). miRNA was anayzed using the Bioanalyzer 2100- Agilent Small RNA assay. QRT-PCR platform The cDNA was amplified by real-time PCR. The real-time PCR analysis was performed on a Stratagene Mx3005P. This reaction contained a microRNA-specific forward primer, a TaqMan probe complementary to the 3ꞌ of the specific microRNA sequence, as well as part of the polyA adaptor sequence, and a universal reverse primer complementary to the consensus 3ꞌ sequence of the oligodT tail. Results were recorded in clinic sheets and were analyzed using SPss version 22. Results G1 consist of 48 and G2 42 pts. There were no differences in two group in respect to age (mean age was 28± 9.5 and 27± 5.23 in G1 and G2 respectively). Micro RNA155, 210 and 494 were significantly higher in plasma of G1 (Pv 0.001, 0.0001, 0.005 respectively). Micro RNA 29b was significantly lower in G1 (Pv 003). And there was no difference between two groups in respect to Micro RNA 34a (Pv 0.09). And also PE patients with higher plasma creatinine have more plasma level of Micro RNA155 and 210. There was a significant correlation between Micro RNA 494 and anemia in PE patients Conclusion In this study we showed that Micro RNA155, 210 and 494 increased and Micro RNA 29b decreased in PE and after clarifying by further studies may use as a predictor in clinical practice.

Design of targeted primers based on 16S rRNA sequences in meta-transcriptomic datasets and identification of a novel taxonomic group in the Asgard archaea

BackgroundAmplification of small subunit (SSU) rRNA genes with universal primers is a common method used to assess microbial populations in various environmental samples. However, owing to limitations in coverage of these universal primers, some microorganisms remain unidentified. The present study aimed to establish a method for amplifying nearly full-length SSU rRNA gene sequences of previously unidentified prokaryotes, using newly designed targeted primers via primer evaluation in meta-transcriptomic datasets.MethodsPrimer binding regions of universal primer 8F/Arch21F for bacteria or archaea were used for primer evaluation of SSU rRNA sequences in meta-transcriptomic datasets. Furthermore, targeted forward primers were designed based on SSU rRNA reads from unclassified groups unmatched with the universal primer 8F/Arch21F, and these primers were used to amplify nearly full-length special SSU rRNA gene sequences along with universal reverse primer 1492R. Similarity and phylogenetic analysis were used to confirm their novel status.ResultsUsing this method, we identified unclassified SSU rRNA sequences that were not matched with universal primer 8F and Arch21F. A new group within the Asgard superphylum was amplified by the newly designed specific primer based on these unclassified SSU rRNA sequences by using mudflat samples.ConclusionWe showed that using specific primers designed based on universal primer evaluation from meta-transcriptomic datasets, identification of novel taxonomic groups from a specific environment is possible.

Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis.

Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons. The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software. The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed. The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.

Meat Species Identification: Amplification Refractory Mutation System-Polymerase Chain Reaction–Based Assay

True verification of meat species is critical for religious, economical, legal, and/or public health concerns. Current methods available for verification of meat species are very time-consuming and/or costly. So considering the necessity, a novel polymerase chain reaction assay (PCR)–based ARMS (amplification refractory mutation system) type identification assay for detection of 6 most common mammalian species—Equus asinus (donkey), Equus caballus (horse), Bos Taurus (cow), Bubalus bubalis (buffalo), Capra hircus (goat), and Canis lupus familiaris (dog)—was described in present study by designing species-specific forward primers against variable regions and a single universal reverse primer against a very conserved region of nuclear beta actin (ACTB) gene by investigation of areas of homology and variation. As compared with conventional designing of primers, ARMS type primer designing is a better alternative as it allows more room for choice and offers differentiation of closely related species by exploiting just a single nucleotide base difference. PCR bands of 128, 229, 273, 362, 710, and 796 bp were generated on electrophoretic gel for buffalo, donkey, cow, horse, dog, and goat meat species respectively. Besides singleplexing, duplex (multiplex) PCR for donkey and horse, donkey and goat, and donkey and buffalo were also performed which successfully generated corresponding bands. The method is a simple and straightforward setup; results can be interpreted easily in a short time and do not need validation by sequencing. Results of the present study clearly demonstrate that the method can be used as an identification tool for differentiation between cow, buffalo, goat, donkey, horse, and dog species.

Molecular Identification of Mammalian Blood Meals in Mosquito Vectors in Nile Delta, Egypt

The degree of contact of the vector and the vertebrate host is an important variable in determining the vectorial capacity of mosquito species for the arthropod-borne disease. This study conducted in Monufia Governorate, Egypt, to describe the mosquito community composition and species-specific host-feeding patterns. Mosquitoes were surveyed over a 2-years period and their host-feeding patterns were determined in relation to species relative abundance by polymerase chain reaction (PCR).This diagnostic technique was used to identify mammalian blood meals from female mosquitoes by sized DNA fragments following agarose gel electrophoresis. One universal reverse primer and five animal-specific forward primers included Human, Pig, Cow, Dog and Goat were used. Multiple blood meals from distinctive mammalian hosts were identified from single mosquito abdomens. Ninety-nine mosquito blood meals from four mosquito species were identified, 67.7% (67) were mixed blood. Both Cx. pipiens and Cx. antennatus fed on human and animals but feeding strategies differed from outdoors to indoors. Inside houses engorged female Cx. pipiens accounted for (94) 74% of collections and out of this, 53.8% fed on humans as single blood and 40% as mixed blood. However, outdoor, collected Ochlerotatus caspius constituted 7.1% of the collected females. Results suggested that, Cx. pipiens an important bridge of disease vector to humans in Egypt.

A sensitive nested multiplex RT-PCR assay for the simultaneous detection of three common viruses infecting pear plants

A highly sensitive nested multiplex reverse transcription-polymerase chain reaction (nmRT-PCR) assay was developed for the simultaneous detection of Apple chlorotic leaf spot virus (ACLSV), Apple stem grooving virus (ASGV) and Apple stem pitting virus (ASPV) infecting pear trees. In the assay, a set of three forward primers specific to each of the three viruses and a universal reverse primer was used as external primers in the first-round PCR, which was followed by a second-round PCR developed previously. The nmRT-PCR assay was 104 times more sensitive than conventional mRT-PCR assay in detecting the three viruses in in vitro pear plantlets. This assay was subsequently used to detect these viruses in leaf and bark samples of cultivated and wild pear trees from orchards and demonstrated to be highly sensitive and reliable. This is the first report describing a use of nmRT-PCR for the sensitive and simultaneous detection of the three viruses infecting pear plants. The assay would be useful for the certification of pear planting materials and surveillance of nursery stocks.

Efficient and accurate analysis of microRNA using a specific extension sequence.

We present here on an innovative assay for detecting miRNAs using a uniquely designed specific extension sequence that provides high efficiency and accuracy. This assay consists of poly(A) tailing and reverse transcription followed by real-time PCR. In the first step of this reaction, target miRNAs are poly(A) tailed by poly(A) polymerase followed by cDNA synthesis using poly(T) adaptors. In the second step, cDNA is hybridized to the 3'-end of a specific extension sequence that contains part of a miRNA sequence; this cDNA-specific extension sequence hybrid forms the novel PCR template. The PCR template is amplified in a SYBR Green-based quantitative real-time PCR with universal forward and reverse primers. The miR-106b in human brain total RNA could be detected quantitatively in the range of seven orders of magnitude with high linearity and reproducibility. This innovative extension-based assay has several performance advantages over the poly(A) tailing method that include lower CT values, clear gel electrophoresis images, and distinct nucleotide peaks in sequencing chromatograms.

Diversity of sediment-associated Planctomycetes in the Arabian Sea oxygen minimum zone.

We examined the diversity of Planctomycetes in the sediment sample collected from an oxygen minimum zone (OMZ) in the southeast Arabian Sea. A 16SrRNA gene library was constructed using the forward primer specific for Planctomycetes and a universal reverse primer. The 237 sequences obtained were grouped into 130 operational taxonomic units, and the majority of them were clustered with phylum Planctomycetes (45.0%) and unclassified bacteria (27.0%). There were sequences that clustered with distantly separated monophyletic groups such as Latescibacteria (9%), Actinobacteria (6%), Proteobacteria (5%), and others (8%). Among Planctomycetes, 55.7% belonged to family Planctomycetaceae, followed by unclassified Planctomycetes (25.0%) and family candidatus Brocadiaceae (19.2%). The family Planctomycetaceae included the genera Blastopirellula (11.5%), Rhodopirellula (3.8%), and a large number unclassified Planctomycetaceae sequences (40.4%). The members of family candidatus Brocadiaceae included the genera candidatus Scalindua (11.5%), candidatus Brocadia (1.9%) and unclassified genera (5.8). Our study indicates the relatively large diversity of Planctomycetes in sediments underlying the oxygen minimum zone of Arabian Sea. Also, the sequence data generated in the present study may support the efforts on isolation and purification of Planctomycetes from marine environment for understanding their biogeochemical significance.

Molecular identification of Vermamoeba vermiformis from freshwater fish in lake Taal, Philippines

Free Living Amoebae (FLA) are considered ubiquitous. FLAs may infect various biological organisms which act as reservoir hosts. Infected freshwater fishes can pose a public health concern due to possible human consumption. This study aims to identify possible pathogenic FLAs present in freshwater fishes. Seventy five (75) Oreochromis niloticus were studied for the presence of FLAs. Fish organs were suspended in physiologic saline pelleted and cultured in non-nutrient agar (NNA) lawned with Escherichia coli and were incubated in 33 °C for 14 days. Eighteen (18) fish gills and nineteen (19) fish intestine samples presented with positive growth. Trophozoites and cystic stages of FLAs were subcultured until homogenous growth was achieved. Cells were harvested from cultured plates and DNA was extracted using Chelex resin. DNA was subjected to polymerase chain reaction using universal forward primer EukA and reverse primer EukB targeting the 18s RNA. Of the 37 plates that presented with positive amoebic growth, 9 samples showed the presence of DNAs and were sent for further purification and sequencing. Basic Local Alignment Search Tool (BLAST) results showed that protists isolated from fish organs in Lake Taal include: Eocercomonas (HM536152), Colpoda steinii (KJ607915) and Vermamoeba vermiformis (KC161965). The results showed that fresh-water fishes can harbour FLAs in the gut. It is proposed that freshwater reservoirs utilized for aquaculture be monitored for the presence of FLAs and extensive study be conducted on the pathogenicity of bacterial endosymbionts and infecting viruses to its mammalian and non-mammalian host.

Using Quantitative Real-Time PCR to Detect MicroRNA Expression Profile During Embryonic Stem Cell Differentiation.

Quantitative real-time PCR (qRT-PCR) is a reliable method to determine and monitor microRNA (miRNA) expression profiles in different cells, tissues, and organisms. Although there are several different strategies in performing qRT-PCR to determine miRNA expression, all of them have two steps in common: reverse transcription for obtaining cDNA from mature miRNA sequencing and standard real-time PCR for amplification of cDNA. This chapter demonstrates the application of quantitative real-time PCR for determining miRNA expression profiles during mouse embryonic stem cell differentiation. In this method, a mature miRNA sequence is first reverse transcribed into a long cDNA with a 40-50nt miRNA-specific stem-loop primer; then, a standard real-time PCR reaction is performed for determining miRNA expression using a forward miRNA-specific primer and a universal reverse primer.

Development of multiplex RT-PCR for detection and differentiationof foot-and-mouth disease virus O and A serotypes in Turkey

In this study, a two-step multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed and evaluated using designed primers for the simultaneous detection and differentiation of Turkish foot-and-mouth disease virus (FMDV) serotypes A and O from clinical samples. In the method, a mix of one universal reverse primer designed from the 2B gene and two serotype-specific forward primers designed from the hypervariable regions of the capsid VP1-1D coding gene of FMDV were used. Totally, 272 FMDV-infected samples collected between 2006 and 2008 constituted the material of the study. mRT-PCR was compared to ELISA in terms of positivity percentage (%) and the difference between the two tests was found to be statistically significant (P < 0.05). In the study, 148 (54.4%) of 272 samples were undetermined by ELISA. Ninety-nine (66.8%) of these 148 undetermined samples were found FMDV RNA-positive with mRT-PCR. Consequently, the diagnostic sensitivity and specificity of mRT-PCR was determined as 95% and 84%, respectively. The study showed that mRT-PCR was more efficient than ELISA and concluded that the technique can be used as an alternative to ELISA for molecular typing of FMDV samples. This is the first report providing the differentiation of FMDV serotypes A and O in Turkey by mRT-PCR.

In vitro functional assessment of natural HIV-1 group M Vpu sequences using a universal priming approach

The HIV-1 accessory protein Vpu exhibits high inter- and intra- subtype genetic diversity that may influence Vpu function and possibly contribute to HIV-1 pathogenesis. However, scalable methods to evaluate genotype/phenotype relationships in natural Vpu sequences are limited, particularly those expressing the protein in CD4+ T-cells, the natural target of HIV-1 infection. A major impediment to assay scalability is the extensive genetic diversity within, and immediately upstream of, Vpu's initial 5′ coding region, which has necessitated the design of oligonucleotide primers specific for each individual HIV-1 isolate (or subtype). To address this, we developed two universal forward primers, located in relatively conserved regions 38 and 90 bases upstream of Vpu, and a single universal reverse primer downstream of Vpu, which are predicted to cover the vast majority of global HIV-1 group M sequence diversity. We show that inclusion of up to 90 upstream bases of HIV-1 genomic sequence does not significantly influence in vitro Vpu expression or function when a Rev/Rev Response Element (RRE)-dependent expression system is used. We further assess the function of four diverse HIV-1 Vpu sequences, revealing reproducible and significant differences between them. Our approach represents a scalable option to measure the in vitro function of genetically diverse natural Vpu isolates in a CD4+ T-cell line.

Stem-Loop qRT-PCR for the Detection of Plant microRNAs.

Plant microRNAs (miRNAs) play important roles in the posttranscriptional regulation of protein-coding genes, and they are essential for a normal development and survival. Mature miRNAs are cleaved from larger precursor RNAs and are typically 21-22 nt long.The small size, the lack of a common feature like a poly(A) tail, 3' end-modifications, and presence of a precursor-all these factors affect the detection and hinder the quantification of miRNAs. The stem-loop qRT-PCR method described here is designed to detect and quantify mature miRNAs in a fast, specific, accurate, and reliable manner. Firstly, a miRNA-specific stem-loop RT primer is hybridized to miRNA and then reverse transcribed. Next, the RT product is amplified and monitored in real time using a miRNA-specific forward primer and a universal reverse primer. This method enables miRNA expression profiling from as little as 10 pg of total RNA, and it is suitable for a relatively high-throughput analysis of miRNA expression.